The DOI matches its Crossref record; 183 of the 185 references it cites were found in a registry or an index.
Regulation of insulin sensitivity by serine/threonine phosphorylation of insulin receptor substrate proteins IRS1 and IRS2.
Open accessAbstract
The insulin receptor substrate proteins IRS1 and IRS2 are key targets of the insulin receptor tyrosine kinase and are required for hormonal control of metabolism. Tissues from insulin-resistant and diabetic humans exhibit defects in IRS-dependent signalling, implicating their dysregulation in the initiation and progression of metabolic disease. However, IRS1 and IRS2 are regulated through a complex mechanism involving phosphorylation of >50 serine/threonine residues (S/T) within their long, unstructured tail regions. In cultured cells, insulin-stimulated kinases (including atypical PKC, AKT, SIK2, mTOR, S6K1, ERK1/2 and ROCK1) mediate feedback (autologous) S/T phosphorylation of IRS, with both positive and negative effects on insulin sensitivity. Additionally, insulin-independent (heterologous) kinases can phosphorylate IRS1/2 under basal conditions (AMPK, GSK3) or in response to sympathetic activation and lipid/inflammatory mediators, which are present at elevated levels in metabolic disease (GRK2, novel and conventional PKCs, JNK, IKKβ, mPLK). An emerging view is that the positive/negative regulation of IRS by autologous pathways is subverted/co-opted in disease by increased basal and other temporally inappropriate S/T phosphorylation. Compensatory hyperinsulinaemia may contribute strongly to this dysregulation. Here, we examine the links between altered patterns of IRS S/T phosphorylation and the emergence of insulin resistance and diabetes.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Insulin resistance in adipocytes is associated with impaired phosphorylation of insulin receptor substrate 1 (IRS-1) in obesity, which is further impaired in T2DM”
From Effect of Exercise Training on Fat Loss—Energetic Perspectives and the Role of Improved Adipose Tissue Function and Body Fat Distribution (2021) · cites this paper as Copps and White, 2012
Experimental — accuracy not yet measured
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
3 retracted
Insulin Stimulates PKCζ-mediated Phosphorylation of Insulin Receptor Substrate-1 (IRS-1)
Liu, Y., Paz, K., Herschkovitz, A., Alt, A., Tennenbaum, T., Sampson, S. R., Ohba, M., Kuroki, T., LeRoith, D., & Zick, Y. (2001) · Journal of Biological Chemistry · doi:10.1074/jbc.m007281200 · Cited by 159
RetractedHerschkovitz, A., Liu, Y., Ilan, E., Ronen, D., Boura‐Halfon, S., & Zick, Y. (2007) · Journal of Biological Chemistry · doi:10.1074/jbc.m610949200 · Cited by 98
RetractedG Protein–Coupled Receptor Kinase 2 Plays a Relevant Role in Insulin Resistance and Obesity
García‐Guerra, L., Nieto-Vázquez, I., Vila‐Bedmar, R., Jurado-Pueyo, M., Zalba, G., Dı́ez, J., Murga, C., Fernández‐Veledo, S., Mayor, F., & Lorenzo, M. (2010) · Diabetes · doi:10.2337/db10-0771 · Cited by 92
RetractedPhosphorylation and regulation of Akt/PKB by the rictor-mTOR complex
Sarbassov, D. D., Guertin, D. A., Ali, S. M., & Sabatini, D. M. (2005) · Science · doi:10.1126/science.1106148 · Cited by 6,216 · cited 2×
“In contrast, ‘priming’ phosphorylation of AKT at S473—by mammalian target of rapamycin (mTOR) complex 2 (mTORC2) [21] (Fig.”
BackgroundEndoplasmic Reticulum Stress Links Obesity, Insulin Action, and Type 2 Diabetes
Özcan, U., Cao, Q., Yilmaz, E., Lee, A.-H., Iwakoshi, N. N., Özdelen, E., Tuncman, G., Görgün, C., Glimcher, L. H., & Hotamisligil, G. S. (2004) · Science · doi:10.1126/science.1103160 · Cited by 3,844 · cited 1×
“phosphorylation is frequently used as evidence of insulin resistance (or its resolution) in mice, despite the influence of insulin on S307 phosphorylation and the probable contribution of other phospho-S/Ts [44].”
BackgroundNewgard, C. B., An, J., Bain, J. R., Muehlbauer, M. J., Stevens, R. D., Lien, L. F., Haqq, A. M., Shah, S. H., Arlotto, M., Slentz, C. A., et al. (2009) · Cell Metabolism · doi:10.1016/j.cmet.2009.02.002 · Cited by 3,165 · cited 1×
“Increased plasma BCAA levels in obese, insulin-resistant persons have long been regarded as part of an insulin-resistant metabolic ‘signature’ [110, 111], but supplementation of rodent diets with mixed BCAA or leucine has not clarified that this is diabetogenic [111, 112].”
BackgroundSkeletal Muscle Insulin Resistance Is the Primary Defect in Type 2 Diabetes
DeFronzo, R. A., & Tripathy, D. (2009) · Diabetes Care · doi:10.2337/dc09-s302 · Cited by 2,102 · cited 2×
“Prospective studies first identify insulin resistance in human skeletal muscle, which is thought to contribute, via a dys-metabolic process, to the emergence of phenotypic disease [3, 74].”
BackgroundCho, H., Mu, J., Kim, J. K., Thorvaldsen, J. L., Chu, Q., Crenshaw, E. B., Kaestner, K. H., Bartolomei, M. S., Shulman, G. I., & Birnbaum, M. J. (2001) · Science · doi:10.1126/science.292.5522.1728 · Cited by 1,860 · cited 2×
“but not Akt1, gene deletion in mice causes a diabetes-like phenotype [22].”
BackgroundAbsence of S6K1 protects against age- and diet-induced obesity while enhancing insulin sensitivity
Um, S. H., Frigerio, F., Watanabe, M., Picard, F., Joaquin, M., Sticker, M., Fumagalli, S., Allegrini, P. R., Kozma, S. C., Auwerx, J., et al. (2004) · Nature · doi:10.1038/nature02866 · Cited by 1,677 · cited 3×
“1b); S6K2 can also phosphorylate IRS1 in vitro, but does not compensate for loss of S6K1 in knockout mice [51, 106].”
BackgroundAdipose tissue as an endocrine organ
Galić, S., Oakhill, J. S., & Steinberg, G. R. (2009) · Molecular and Cellular Endocrinology · doi:10.1016/j.mce.2009.08.018 · Cited by 1,654 · cited 1×
“IKKβ and JNK—Impaired glucose uptake and/or insulin resistance within adipose tissue can contribute to the development of type 2 diabetes [164], likely by altering its secretion of adipokines, such as adiponectin or retinol-binding protein 4 (reviewed in [165]).”
Background
Cited by
Sorted by citations
Items 801–900 of 1,000
Ekasaputra, V. M., Mughni, A., Putra, A. B., Riwanto, I., Nugrahadi, D. E., Prasetya, A. T., Putranto, I. K. A., Alif, I., & Makarim, F. R. (2022) · Open Access Macedonian Journal of Medical Sciences · doi:10.3889/oamjms.2022.8211 · Cited by 2
“The translocations of Glut4 to cell membranes of target tissues are responsible for improvement in sensitivity to insulin action [16].”
BackgroundReceptor Tyrosine Kinases and the Insulin Signaling System
White, M. F. (2018) · Endocrinology · doi:10.1007/978-3-319-44675-2_7 · Cited by 2
Self-citationPrakash, T., & Ramachandra, N. B. (2022) · Avicenna Journal of Medical Biotechnology · doi:10.18502/ajmb.v14i3.9831 · Cited by 2
“Downstream signaling partners are then activated through kinases such as FOXO, AMPK, GSK3, ERK, mTOR, PI3K and AKT 39-42 .”
BackgroundInfluentialThe Importance of Metabolites in Modulating Insulin Sensitivity
Meiliana, A., Dewi, N. M., & Wijaya, A. (2022) · The Indonesian Biomedical Journal · doi:10.18585/inabj.v14i3.1872 · Cited by 1
“(18) Tyrosine phosphorylation activates IR and IRS proteins, while serine/threonine phosphorylation inactivates them.(15,19) The effects are site-dependent in granular level, but serine/threonine phosphorylation is a fundamental method for fine-tuning, antagonizing, or terminating IR signaling.”
BackgroundSun, P., Bouwman, L. M. S., de Deugd, J.-L., van der Stelt, I., Oosting, A., Keijer, J., & van Schothorst, E. M. (2022) · International Journal of Molecular Sciences · doi:10.3390/ijms231810207 · Cited by 2
“Insulin receptor substrate proteins play vital roles in insulin signaling, with Irs1 and Irs2 representing the most important ones [32].”
BackgroundMechanistic Studies on the Antidiabetic Properties of Gallotannins
Li, X., Wu, W., Liu, Y., Zhao, J., Gui, Y., Wang, H., Wang, L., Luo, Y., Zhou, G., YuMin, H., et al. (2024) · Current Pharmaceutical Design · doi:10.2174/0113816128338114241021110221 · Cited by 2
Suryandari, D. A., Tedjo, A., & Fadilah, F. (2024) · Tropical Journal of Natural Product Research · doi:10.26538/tjnpr/v8i12.19 · Cited by 2
Zong, J., Tang, Y., Wang, T., Ullah, I., Xu, K., Wang, J., Chen, P., Chen, Z., Zhu, T., Chen, J., et al. (2022) · Journal of the American Heart Association · doi:10.1161/jaha.121.025058 · Cited by 2
“Patients who met any of the following criteria were excluded: (1) allergic or intolerant to aspirin or clopidogrel; (2) at high risk for bleeding (eg, platelet count <80×109/L, known bleeding diathesis, active peptic ulcer, or with a history of cerebral hemorrhage within 1 year); and (3) planning to take drugs that co…”
BackgroundCheng, M., Xie, D., Price, M., Zhou, C., & Zhang, X. (2022) · Genetica · doi:10.1007/s10709-022-00173-7 · Cited by 2
“For example, a gene enriched in the GO terms, IRS1 (Insulin Receptor Substrate 1) with a (GCT)5, is related to carbohydrates metabolism (Copps and White 2012), and its function may be regulated by variable STRs in its coding region.”
BackgroundZhuo, M.-Q., Pan, Y., Wu, K., Xu, Y., Zhang, L.-H., & Luo, Z. (2016) · Fish Physiology and Biochemistry · doi:10.1007/s10695-016-0316-1 · Cited by 2
“…TACCGTCGTTCCACTAGTGATTT 3′outer CACTCTGTTTCCCCAAAGGT CGCGGATCCTCCACTAGTGATTTCACTATAGG 3′inner TCATCCTGTAAGTTCTCCAGCATC CACTAAAGAGGACGCAGAGTTG 5′outer CGCGGATCCACAGCCTACTGATGATCAGTCGATG TACCAGCTTTCCTGCTCGTT 5′inner sites of tyrosine phosphorylation (White 1998; Copps and White 2012).”
BackgroundBouzid, T., Hamel, F. G., & Lim, J. Y. (2016) · Cited by 2
Zhang, W., Su, R., Feng, H., Lin, L., Wang, C., & Yang, H. (2019) · Journal of Diabetes Research · doi:10.1155/2019/6320839 · Cited by 3
“Rho protein kinase (ROCK), a serine/threonine (Ser/Thr) kinase, is the predominant and most direct effector molecule downstream of Rho GTPases [12, 13], and it can directly affect the Ser/Thr phosphorylation of the insulin receptor substrate (IRS) and regulate insulin resistance through the PI3K/AKT signaling pathway…”
BackgroundPathogenetic mechanisms of statin dysglycemia and risk of new-onset diabetes
Pappa, M. B., Tsimihodimos, V., & Alaveras, A. (2021) · Journal of Atherosclerosis Prevention and Treatment · doi:10.53590/japt.02.1018 · Cited by 2
Müller‐Wieland, D. (2013) · Der Diabetologe · doi:10.1007/s11428-012-1019-6 · Cited by 2
Approaches and methods to study cell signaling: Linguistics of cellular communication
Neog, S., & Trivedi, V. (2022) · Elsevier eBooks · doi:10.1016/b978-0-323-90264-9.00036-2 · Cited by 2
Cellular Mechanisms of Insulin Action
Ciaraldi, T. P. (2017) · Springer eBooks · doi:10.1007/978-3-319-18741-9_5 · Cited by 2
Imran, S., Ain, H. B. U., Tufail, T., Nasir, M., Maqsood, M., Kanwal, J., Ijaz, N., & Ali, M. (2022) · Pakistan BioMedical Journal · doi:10.54393/pbmj.v5i3.332 · Cited by 2
Xiang, X., Zhang, C., & Long, D. (2021) · Journal of Biomaterials and Tissue Engineering · doi:10.1166/jbt.2021.2576 · Cited by 2
Rendina-Ruedy, E. (2015) · SHAREOK (University of Oklahoma; Oklahoma State University; Central Oklahoma University) · doi:10.13140/rg.2.1.5090.3208 · Cited by 2
A benchmark dataset for analyzing and visualizing the dynamic epiproteome
Kaur, S., Baldi, B. F., Vuong, J., & O’Donoghue, S. I. (2019) · Data in Brief · doi:10.1016/j.dib.2019.104000 · Cited by 2
“Phosphorylation of Irs1 at sites Y460 [10], Y608 [10], Y628 [10], Y891 [11], Y935 [10], Y983 [10], Y1171 [11] and Y1218 [11], respectively, by Insr irs1_grb2 Binding of Irs1(at Y891) and grb2 [11,12]”
Interferon regulates stem cell function at all ages by orchestrating mTOR and cell cyclePreprint
Ibañez, D. C., Skabkin, M. A., Hooli, J., Cerrizuela, S., Göpferich, M., Jolly, A., Zumwinkel, M., Bertolini, M., Höfer, T., Kramer, G., et al. (2022) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2022.02.03.478954 · Cited by 2
“Additionally, p-Irs1Ser1134 and p-Irs1Ser1137 displayed a biphasic trend, correlating with the activation status of mTOR (Copps & White, 2012; Karlsson et al, 2021; Langlais et al, 2011) (Appendix Table 1).”
BackgroundHan, B., Li, G. X., Liew, W. L., Chan, E., Huang, S., Khoo, C. M., Leow, M. K., Lee, Y. S., Zhao, T., Wang, L. C., et al. (2023) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2023.06.30.547176 · Cited by 2
White, M. F. (2024) · Wiley eBooks · doi:10.1002/9781119697473.ch9 · Cited by 2
Self-citationSun, X., Yin, Y., Song, M., Droz, B. A., LIN, Y., Beaty, K. N., Zhou, B., Roh, H. C., Wilson, J. M., Cain, P., et al. (2025) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.64898/2025.12.18.695152 · Cited by 2
Insulin signaling in the heart is impaired by growth hormone: a direct and early event
Muñoz, M. C., Piazza, V. G., Burghi, V., Giani, J. F., Martinez, C. S., Cicconi, N. S., Muia, N. V., Fang, Y., Lavandero, S., Sotelo, A. I., et al. (2022) · Journal of Molecular Endocrinology · doi:10.1530/jme-21-0242 · Cited by 1
Wisessaowapak, C., Weeraphan, C., Visitnonthachai, D., Chokchaichamnankit, D., Srisomsap, C., Watcharasit, P., Svasti, J., & Satayavivad, J. (2023) · Heliyon · doi:10.1016/j.heliyon.2023.e14385 · Cited by 1
Physical principles and molecular interactions underlying protein phase separation
Subedi, S., Shukla, H., Uversky, V. N., & Tripathi, T. (2024) · Elsevier eBooks · doi:10.1016/b978-0-443-21809-5.00008-9 · Cited by 1
Insulin-Sensitizing Properties of Decoctions from Leaves, Stems, and Roots of Cucumis prophetarum L.
Mekonnen, Z., Petito, G., Shitaye, G., D’Abrosca, G., Legesse, B. A., Addisu, S., Ragni, M., Lanni, A., Fattorusso, R., Isernia, C., et al. (2024) · Molecules · doi:10.3390/molecules30010098 · Cited by 2
“The serine phosphorylation of IR and IRS proteins impairs insulin-stimulated signaling by reducing their tyrosine phosphorylation [9,10].”
Gao, G., Chen, A., Yan, Y., Sagor, M. I. H., Lin, W., Lin, H., Lian, G., Xie, L., & Luo, L. (2025) · Frontiers in Cardiovascular Medicine · doi:10.3389/fcvm.2025.1543319 · Cited by 1
“As a serine/threonine kinase (30), PKC can phosphorylate IRS-1 on serine residues, affecting its stability and signaling function (31, 32).”
Interaction of IRS2 with PLK1 protects cells from mitotic stress
Lee, J.-S., Bui, Q. T., Jo, M., Morgan, J. S., Nasa, I., Kettenbach, A. N., & Shaw, L. M. (2026) · Cell Death & Disease · doi:10.1038/s41419-026-08706-0 · Cited by 1
“Primaryantibodies used in this study include:”
Kyratzi, P., Gadsby, S., Knowles, E., Harris, P., Menzies‐Gow, N. J., Elliott, J., Páldi, A., Wattis, J. A. D., & Rauch, C. (2026) · Physiological Genomics · doi:10.1152/physiolgenomics.00205.2025 · Cited by 1
Kalafut, K. C., Cormerais, Y., Cissé, M. Y., Lapp, S. C., Inouye, K., Hotamışlıgil, G. S., & Manning, B. D. (2026) · Nature Communications · doi:10.1038/s41467-026-77216-6 · Cited by 2
“It has been proposed that liver mTORC1 activation becomes elevated in obesity 4,13,89 and contributes to hepatic insulin resistance, with in vitro studies implicating a variety of negative feedback mechanisms on insulin signaling 13,45 – 47, 49, 50 .”
Anand, S., Kantari, K., Kumar, P., Pradhan, S. S., & Agraharam, A. (2025) · Network Modeling Analysis in Health Informatics and Bioinformatics · doi:10.1007/s13721-025-00618-x · Cited by 1
“Activated MAPKs phosphorylate multiple serine res - idues on IRS-1, especially within phosphorylation insulin resistance (PIR) domain, disrupting its interaction with the insulin receptor and amplifying insulin resistance(Sugita et al. 2004 ; Copps and White 2012; Arkun 2016; Jubaidi et al. 2022 ).”
Wang, J., Liu, T.-Y., Lu, J., Yang, X., Feng, X., & Li, Y. (2025) · Experimental Eye Research · doi:10.1016/j.exer.2025.110814 · Cited by 1
Shen, W., Niu, A., Zhang, Q., Deng, J., Xu, X., Ma, X., Zhao, H., & Lou, Y. (2026) · PLoS ONE · doi:10.1371/journal.pone.0333081 · Cited by 2
“IRS1, as a principal mediator of insulin signaling, undergoes tyrosine phosphorylation to activate the phosphoinositide 3-kinase (PI3K)/Akt signaling pathway, thereby promoting GLUT4 translocation to the plasma membrane and enhancing cellular glucose uptake capacity [41,42].”
Perimenopause-induced insulin resistance via 5-HT dysregulation
Chen, Y., Yu, J., Liu, C., Wang, K., & Yang, Y. (2026) · Clinical Science · doi:10.1042/cs20257657 · Cited by 1
Pathophysiology and pharmacotherapy of cardiovascular complications in metabolic syndrome
Dhalla, N. S., Patel, C. A., Beladiya, J., Mehta, A. A., & Gandhi, T. R. (2026) · Journal of Molecular and Cellular Cardiology · doi:10.1016/j.yjmcc.2026.04.007 · Cited by 1
Bhattacharjee, M. J., Sheikh, Y., Das, S., Bala, A., Mukherjee, A. K., & Khan, M. R. (2026) · Food Research International · doi:10.1016/j.foodres.2026.119241 · Cited by 1
An engineered insulin analog with dual insulin and IGF-1 receptor agonism and distinct signaling
Selicharová, I., Kirk, N. S., Kertisová, A., Lubos, M., Mitrová, K., Ticháčková, T., Žáková, L., Chrudinová, M., Březinová, J., Harant, K., et al. (2026) · Science Advances · doi:10.1126/sciadv.aeb7558 · Cited by 1
Lu, X. G., Jin, H., Wang, Y. P., Li, H. B., & Cheng, Y. X. (2026) · Renal Failure · doi:10.1080/0886022x.2026.2672189 · Cited by 1
Galiano, Á., & Notario-Pérez, F. (2026) · Journal of Computer-Aided Molecular Design · doi:10.1007/s10822-026-00836-z · Cited by 1
“Specifically, in proteins like P11597 (IRS1), a key node in insulin receptor signaling, Fmol021 yielded a more favorable score (− 12.0 kcal/mol) than the clinical references tested, pointing towards its potential to influence insulin sensitivity [135 ].”
InfluentialAi, W., Pan, Q., Shen, Z., Yang, W., JIANG, W., Song, J., & Guo, S. (2026) · Metabolism · doi:10.1016/j.metabol.2026.156654 · Cited by 1
Fu, Z., Shi, R., Jiang, L., Zhang, W., Liu, Y., Chen, W., Zhu, F., Chen, R., Jin, G., Chen, Y., et al. (2026) · Cell investigation. · doi:10.1016/j.clnves.2026.100078 · Cited by 1
Singh, R., Kaur, J., & Upadhyay, B. (2026) · Journal of Basic and Clinical Physiology and Pharmacology · doi:10.1515/jbcpp-2026-0068 · Cited by 1
“…disrupting IRS-1 serine phosphorylation and PI3K-Akt activation, resulting in the inability of the liver to respond to insulin ’ s glucose-lowering e ff ects and establishing a condition of hepatic insulin resistance, where the liver becomes insensitive to insulin ’ s glucose-lowering e ff ects [37].”
Sarić, M. M., Šikić, N. L., Sorić, T., Sarić, A., Ivanišin, A., Brodić, I., & Milić, M. (2026) · International Journal of Molecular Sciences · doi:10.3390/ijms27125495 · Cited by 2
“Chronic mTOR activation also promotes phosphorylation of p70S6K1, which contributes to degradation of insulin receptor substrate-1 (IRS-1) and further worsens IR through negative feedback signaling [80,81].”
Wang, Q., Zhu, L., He, F., Zhu, T., Tang, Y., Chen, C., Zhang, X., & Wang, L. (2026) · Frontiers in Immunology · doi:10.3389/fimmu.2026.1903979 · Cited by 1
“Among these pathways, JNK signaling is especially related to insulin resistance; it can increase the serine phosphorylation of IRS-1, disturb the downstream signaling of the insulin receptor, and then make insulin resistance more serious (141).”
Gastaldelli, A., Choi, E., Conde‐Knape, K., Göransson, O., Krook, A., Lehtonen, S. H., Roden, M., Schrauwen, P., Sparks, L. M., & Heni, M. (2026) · Diabetologia · doi:10.1007/s00125-026-06853-9 · Cited by 1
LASSARRE, C., Legay, C., Karam, M., & Ricort, J. (2013) · Biochimica et Biophysica Acta (BBA) - Molecular Cell Research · doi:10.1016/j.bbamcr.2013.02.019 · Cited by 1
Signalling Pathways Implicated in Obesity Associated Cancers
Drew, J. E. (2014) · The Open Obesity Journal · doi:10.2174/1876823701406010044 · Cited by 1
“It has been noted that insulin stimulated kinases, such as atypical PKCs activate NF B [80, 81].”
BackgroundStretch Control of Adipocyte Insulin Signaling
Bouzid, T. (2017) · Lincoln (University of Nebraska) · Cited by 1
Ziablitsev, S. V., Chernobrytsev, O. P., & Ziablitsev, D. S. (2019) · Clinical endocrinology and endocrine surgery · doi:10.30978/cees-2019-1-72 · Cited by 1
“Моле кулярною основою цього ефекту є роль TNFα в передачі сигналу з інсулінового рецептору в адипоцитах: TNFα індукує фосфорилювання субстрату інсулінового рецептору (IRS-1) [2] за сериновими залишками 636/639 та інгібує фосфорилювання ти розину, що запобігає подальшій активації шляхів PI3K/Akt- і Erk/MAP-кіназ та пог…”
NEW PREDICTIVE FACTORS OF DIABETIC MACULOPATHY DEVELOPMENT IN DIABETES MELLITUS TYPE 2
Panchenko, Y. O., Mogilevskyy, S. Y., Ziablitsev, S. V., & Chernobrivtsev, O. P. (2018) · Medical Science of Ukraine (MSU) · doi:10.32345/2664-4738.3-4.2018.08 · Cited by 1
Su, C., Cheng, Q., & Wang, L. (2021) · Diabetes Metabolic Syndrome and Obesity · doi:10.2147/dmso.s298897 · Cited by 1
Gao, J., Mizokami, A., Takeuchi, H., Li, A., Huang, F., Nagano, H., Kanematsu, T., Jimi, E., & Hirata, M. (2021) · Journal of Cell Science · doi:10.1242/jcs.258584 · Cited by 1
Solís‐Muñoz, P., Berlana, Á., Pozo-Maroto, E. D., Domínguez-Alcón, L., Elbouayadi, L., García‐Monzón, C., & González‐Rodríguez, Á. (2022) · Metabolism and Target Organ Damage · doi:10.20517/mtod.2021.18 · Cited by 1
Overview of Glucose Homeostasis
Ferrannini, E., & Seghieri, M. (2018) · Endocrinology · doi:10.1007/978-3-319-45015-5_1 · Cited by 1
Differentiated Mouse Adipocytes in Primary Culture: A Model of Insulin Resistance
Ruíz‐Herrera, X., Luzardo‐Ocampo, I., de la Escalera, G. M., Clapp, C., & Macotela, Y. (2023) · Journal of Visualized Experiments · doi:10.3791/63979 · Cited by 1
Structure-related relationship: Plant-derived antidiabetic compounds
Gupta, M. K., Gouda, G., Sultana, S., Punekar, S. M., Vadde, R., & Ravikiran, T. (2023) · Studies in natural products chemistry · doi:10.1016/b978-0-323-91294-5.00008-7 · Cited by 2
Multifactorial Aspects Influencing Non-Alcoholic Fatty Liver Disease (Nafld)
Raveendran, R. R. R., A, A. J. J., P, P. K. K., Varalakshmi, S., SB, K. S. B. K., Thahira, T. A. A., T, S. T. S., K, P. K. P., PV, A. P. A., & Roy, D. (2023) · Journal Of Advanced Zoology · doi:10.17762/jaz.v44is-1.1248 · Cited by 2
“[67, 65, 66]”
BackgroundZorina, I. I., Avrova, N. F., Zakharova, I. O., & Shpakov, A. O. (2023) · Biochemistry (Moscow) · doi:10.31857/s0320972523030077 · Cited by 1
Hemmati, F., Valian, N., Ahmadiani, A., Mohamed, Z., Raymond, A. A., Ibrahim, N. M., & Shirazi, S. F. H. (2024) · Physiology and Pharmacology · doi:10.61186/phypha.28.2.128 · Cited by 1
Insulin signaling in primary adipocytes in insulin sensitive and insulin resistant states
Fagerholm, S. (2013) · Cited by 1
Mathematical Modeling in Systems Medicine: New Paradigms for Glucose Control in Critical Care
Pritchard‐Bell, A. (2016) · D-Scholarship@Pitt (University of Pittsburgh) · Cited by 1
Bioactivities and Mechanisms of Egg Protein-derived Peptides
Liao, W., & Wu, J. (2019) · Royal Society of Chemistry eBooks · doi:10.1039/9781788013833-00285 · Cited by 1
Ziablitsev, S. V., Chernobrytsevs, O. P., & Ziablitsev, D. S. (2018) · Medical Science of Ukraine (MSU) · doi:10.32345/2664-4738.3-4.2018.06 · Cited by 1
Вацеба, Т. С., SOKOLOVA, L. K., PUSHKAREV, V. V., Ковзун, О. І., Guda, B. B., Pushkarev, V. M., & Tronko, M. D. (2019) · Endokrynologia · doi:10.31793/1680-1466.2019.24-4.302 · Cited by 1
Вацеба, Т. С., SOKOLOVA, L. K., PUSHKAREV, V. V., Ковзун, О. І., Guda, B. B., PUSHKAREV, V. V., & Tronko, M. D. (2019) · Endokrynologia · doi:10.31793/1680-1466.2019.24-3.228 · Cited by 1
Narne, P. (2020) · Clinical Science · doi:10.1042/cs20200686 · Cited by 1
The Link of Nutrient Fluxes to Hepatic Insulin Resistance at Gene Expression
Zhang, Y., & Chen, G. (2020) · Archives of Gastroenterology Research · doi:10.33696/gastroenterology.1.011 · Cited by 1
“These proteins include the regulatory subunits of phosphatidylinositol 3-kinase, growth factor receptorbound protein 2, and protein tyrosine phosphatase-2 [27].”
BackgroundPanchenko, I. O., Могилевский, С. Ю., Rykov, S. О., Жабоедов, Д. Г., Umanets, M., & Ziablitsev, S. V. (2021) · Ukrainian Journal of Ophthalmology · doi:10.31288/oftalmolzh20214918 · Cited by 1
FUJII, N. L. (2016) · Springer eBooks · doi:10.1007/978-4-431-55720-3_9 · Cited by 1
Tronko, M. D., Kovzun, О. I., Левчук, Н. І., PUSHKAREV, V. V., Lukashenia, O. S., & Pushkarev, V. M. (2023) · Endokrynologia · doi:10.31793/1680-1466.2023.28-1.5 · Cited by 2
Qi, Y., Guo, X., & Guo, S. (2015) · Springer eBooks · doi:10.1007/978-3-319-12125-3_28-1 · Cited by 1
Insulin Signaling, Epigenetics, and Human Diseases
Chruvattil, R., Belani, M., Patel, T. P., & Gupta, S. S. (2017) · Wiley eBooks · doi:10.1002/9783527697274.ch18 · Cited by 1
Raizel, R. (2017) · Digital Library of Theses and Dissertations (Universidade de São Paulo) · doi:10.11606/t.9.2017.tde-26102017-112453 · Cited by 1
Singh, R. K., & Kumar, A. (2023) · Research Square · doi:10.21203/rs.3.rs-2627730/v1 · Cited by 1
PARMAR, N. R., Patel, R., RATHWA, N. N., Dwivedi, M., Begum, R., & Ramachandran, A. V. (2025) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2025.03.17.639558 · Cited by 1
“Overnutrition causes mTOR/S6K1 signalling activation and impairs insulin signalling by increased serine phosphorylation of IRS1 [36,37].”
Nyman, E. (2014) · Linköping University Electronic Press eBooks · doi:10.3384/diss.diva-104725
Insulin signaling dynamics in human adipocytes
Nyman, E. (2014)
Effects of Chronic Insulin and High Glucose on Insulin-Stimulated Responses in Human Preadipocytes
Bilali, J. E. (2016) · uO Research (University of Ottawa) · doi:10.20381/ruor-5962
“Due to their proximity to the IRS PTB domain, phosphorylation of hSer312 and other neighboring Ser/Thr residues are believed to sterically disrupt interaction between the activated IR and IRS (Copps and White, 2012; Du and Wei, 2014).”
BackgroundThe role of ER stress in lipogenesis and insulin resistance in response to over nutrition
Sun, R. (2016) · RMIT Research Repository (RMIT University Library) · doi:10.25439/rmt.27581124
Human Adipocytes : Proteomic Approaches
Jufvas, Å. (2016) · Linköping University medical dissertations · doi:10.3384/diss.diva-125907
Rebuttal from Scott A. Summers and Bret H. Goodpaster
Summers, S. A., & Goodpaster, B. H. (2016) · The Journal of Physiology · doi:10.1113/jp272136
“The second argument relates to the fact that insulin resistant patients sometimes display downregulation of IRS1 (Copps & White, 2012), a signalling step that is unaffected by ceramides (Stratford et al. 2004).”
BackgroundInfluentialCell and Biological Models for the C Terminal Fragment of Adiponectin Receptor
Pugia, M. J., & Ma, R. (2015) · Springer eBooks · doi:10.1007/978-3-319-21927-1_5
Kimball, R. (2016) · ScholarsArchive (Brigham Young University)
Landis, J. (2014) · eScholarship@UMassChan · doi:10.13028/m2bc82
“also phosphorylated on serine residues, some of which inhibit their ability to recruit and activate PI3K signaling (75).”
BackgroundBarbosa‐da‐Silva, S., Sarmento, I. B., Bargut, T. C. L., Souza‐Mello, V., Águila, M. B., & Mandarim‐de‐Lacerda, C. A. (2014)
Functional Interaction Between Pten And Nedd4 In Igf Signaling
Shi, Y. (2014) · eCommons (Cornell University)
Rajan, M. R. (2016) · Linköping University medical dissertations · doi:10.3384/doss.diva-131421
Receptor Tyrosine Kinases and the Insulin Signaling System
White, M. F. (2017) · Endocrinology · doi:10.1007/978-3-319-27318-1_7-1
Self-citationRegulating GLUT4 Sorting into the Insulin-Responsive Compartment in Muscle Cells
Foley, K. P. (2014) · TSpace (University of Toronto)
Mühlhäusler, B. S. (2012) · Elsevier eBooks · doi:10.1016/b978-0-12-812019-4.00020-9
Vulf, M., Skuratovskaia, D., Кириенкова, Е. В., Затолокин, П. А., Mironyuk, N. I., & Litvinova, L. S. (2018) · Human Physiology · doi:10.1134/s036211971804014x
İNSÜLİN DİRENCİNDE İNSÜLİN RESEPTÖR SUBSTRAT 1 (IRS1) PROTEİNİNİN ROLÜ
Görgişen, G. (2018) · Bozok Tıp Dergisi · doi:10.16919/bozoktip.348488
Littlejohn, E. L. (2018) · UKnowledge (University of Kentucky) · doi:10.13023/etd.2018.292
Der Einfluss westlicher Ernährung
Melnik, B. C. (2019) · Der Deutsche Dermatologe · doi:10.1007/s15011-019-2434-4
The role of c-Kit and insulin receptor tyrosine kinases in beta cell function and insulin secretion
Oakie, A. (2019) · Scholarship@Western (Western University)
Petrie, J. R., & Salt, I. P. (2019) · Springer eBooks · doi:10.1007/978-3-030-16481-2_40
Metadata
- Authors
- Copps, K. D., & White, M. F.
- Affiliations
- Boston Children's Hospital (US)
- Corresponding author
- White, M. F.
- ORCID
- White, M. F.
- Venue
- Diabetologia
- Published
- 2012-08-08
- Volume
- 55
- Issue
- 10
- Pages
- 2565-2582
- ISSN
- 0012-186X (ISSN-L)
- 1432-0428
- PMC
- PMC4011499
- OpenAlex
- W1982479748
- Cited by
- 1,017
- References
- 185
- Citations by year
- 2026: 72 · 2025: 56 · 2024: 76 · 2023: 83 · 2022: 103 · 2021: 113 · 2020: 83 · 2019: 76 · 2018: 75 · 2017: 70 · 2016: 59 · 2015: 63 · 2014: 51 · 2013: 31 · 2012: 5
- FWCI
- 4.40
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- www.springer.com/tdm (tdm)
- Locations
- Diabetologia (publishedVersion)
- PubMed (publishedVersion)
- Europe PMC (PubMed Central) (acceptedVersion)
- PubMed Central (acceptedVersion)
- Funders
- Howard Hughes Medical Institute
- National Institutes of Health (5r01dk098655-08)
- National Institute of Diabetes and Digestive and Kidney Diseases (R01- DK098655, R01DK038712)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Metabolism, Diabetes, and Cancer
- Health Sciences › Medicine › Endocrinology, Diabetes and Metabolism › Adipokines, Inflammation, and Metabolic Diseases
- Health Sciences › Medicine › Endocrinology, Diabetes and Metabolism › Diabetes, Cardiovascular Risks, and Lipoproteins
- Keywords
- insulin receptor substrate, IRS-1, insulin receptor substrate 2, serine/threonine phosphorylation, insulin sensitivity, insulin resistance, diabetes mellitus, insulin signaling, AMPK, glycogen synthase kinase-3, protein kinase C, Akt, mTOR, hyperinsulinemia, metabolic disorders
- MeSH terms
- Animals, Diabetes Mellitus, Humans, Insulin Resistance, Mice, Transgenic, Phosphorylation, Serine, Threonine, Signal Transduction, Mice, Knockout, Models, Animal, Mice, Insulin Receptor Substrate Proteins
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
