Evolution of the cytochromeb gene of mammals

“…(Adkins & Honeycutt 1994) H8320 COII CTCTTTAATCTTTAACTTAAAAG (Adkins & Honeycutt 1994) L14724 Cytochrome b CGAAGCTTGATATGAAAAACCATCGTTG (Irwin et al. 1991) L15171 Cytochrome b CATGAGGACAAATATCATTCTGAGG (Yoder et al. 1996b) H15506 Cytochrome b AGTGGRTTRGCTGGTGTRTARTTGTC (Yoder et al.…”

“…correlation between log relative-rates (RR) distance and log generation time was robust to removal ofLoxodontia/Dugongcomparison, a pair for which the genetic distance is particularly high due to the curiously divergent elephant cytb gene (Irwin et al. 1991; Ma et al. 1993; Irwin and Arnason 1994).”

“The choice of weights was entirely exploratory, but logical given the nature of the genetic code (Irwin et al., 1991; Li and Graur, 1991; Nei, 1978).”

“Cyt b L 14841 AAA AAG CTT CCA TCC AAC ATC TCA GCA TGA TGA AA Kocher et al. (1989) Cyt b H 15915 AAC TGC CAG TCA TCT CCG GTT TAC AAG AC Irwing et al.”

“Unexpectedly, this is not so. Although the A + T% in the cyt b gene of T. rufoniger is generally as high (Table 3) as those reported for the CO-II genes of other insects (Table 4), and it has the generally observed bias against G in the third codon position (Brown 1985; Crozier 1990; Irwin et al. 1991; Liu and Beckenb…”

“3, 4). We think that cyt b, though widely used as a phylogenetic marker (Meyer and Wilson 1990; Irwin et al. 1991 ), does not seem, in fish, suitable to draw phylogenetic inferences at higher taxonomic levels, e.g., between families or orders.”

“OSU L15684, H15760 Cytb 116 Mammals excluding humans Irwin et al. (1991) Cow, pig OSU 12S01, 12S03 12S 137 Phasianinae subfamily Shanks et al. (2005) Chicken MPI Primer 1, Primer 2 12S 137 Sus scrofa (pig) This report Pig MPI 12S a0, 12S o 12S w150a”

“…or downgrading of some putatively relatively less informative characters to emphasize the contribution of those characters thought to possess stronger phylogenetic signal (Edwards et al., 1991; Irwin et al., 1991; Bull et al., 1993; Kornegay et al., 1993; Swofford et al., 1996; Bowie et al., 2005).”

“For some of the hair and blood samples that were too degraded for the amplification of the entire cytochrome b gene, we performed partial amplifications using L14724 and H15149 (480 bp) (Irwin et al., 1991), and a set of newly designed primers CYTB FAR-L 50-CCATGAGGACAAATATCATTCTGAT-30 and CYTB FAR-H 50-TCCAATAGTAATAA…”

“The structure of the cyt b protein has been well characterized (Howell, 1989), and variation of evolutionary rates across functional domains has been analyzed for birds and mammals (Griffiths, 1997; Irwin et al., 1991).”

“We also have found a general correlation between the results of the analytical software programs TreeSAAP (which implements the MM01 model) and CDM (which implements the codon-degeneracy model).”

“Feces extracts that did not amplify nDNA when initially tested with Ggu14 were sequenced for a 330 bp cytochrome b (cyt b) fragment from mitochondrial DNA (Irwin et al. 1991).”

“As substitution frequencies diVer starkly between Wrst, second and third positions in Cytb ( Irwin et al., 1991 ), each codon position was treated separately (substitution rate partitioning) (charset 1st_ pos D 1-1140E3; charset 2nd_pos D 2-1140E3; charset 3rd_pos D 3-1140E3; partition bycodon D 3: 1st_pos; 2nd_pos; 3…”

“0/18 6, 9 Nyctalus plancyi Chinese noctule 0/1 6 Pipistrellus abramus Japanese pipistrelle 15/75 (20) 4, 6, 7, 8, 9, 10, 11 Pipistrellus minus Lesser pipistrelle 1/7 (15) 6, 8, 11 Pipistrellus pipistrellus Common pipistrelle 6/42 (14) 4, 6, 9, 10, 11 Pipistrellus spp.”

“The primer pair L14724 (Irwin et al., 1991) and MVZ-16 (Smith and Patton, 1993) was used to amplify over 800 bp of the cytochrome b gene (cyt_b).”

“Coincidently, it was also the case just in consideration of the third codon of the cytb gene in the bear species, which had been previously reported by Talbot and Shields (1996a,b) [6% Myr of ursids vs 10% Myr of other mammalian species ( Irwin et al., 1991 )].”

“…downweighting), or a posteriori constraints (successive reweighting by rescaled consistency index [RC]) following recommendations in the literature (e.g., Barker and Lanyon 2000; Farias et al. 2001; Farris 1969; Honeycutt et al. 1995; Horovitz and Meyer 1995; Huchon et al. 2002; Irwin et al. 1991).”

“A few samples needed to be re-amplified with nested primers (MVZ16, L15162; Irwin et al., 1991, and Smith and Patton, 1991; BSves268H see Stadelmann et al., 2004).”

“The entire cytochrome b gene (1.1 kb) was PCR ampliWed with primers GLuDG.L-TGA CTT GAA RAA CCA YCG TTG (Palumbi et al., 1991) and H15915-AAC TGC CAG TCA TCT CCG GGT TAC AAG AC ( Irwin et al., 1991 ).”

“Primarily this has been attempted to try to link diseases to specific mitochondrial defects [8-11] and also, because of the maternal inheritance exhibited, to trace the phylogenetic history of the human population and examine population structuring [5, 7, 12-31 ].”

“For instance, the index of compositional bias of Irwin et al. (1991) , which measures deviation from an equal (25%) frequency of each nucleotide, was highest at the third codon position and lowest at the first, an observation identical to that seen for the mitochondrial cytochrome b gene in mammals (Irwin et al. 1991).”

“To mimic a typical mammalian evolutionary study, we amplified the mitochondrial cytochrome-b gene using the universal primers L14724/H15915 (Irwin et al. 1991).”

“The ranking position of the cytochrome b gene, frequently used in phylogenetic comparisons among mammals (Irwin et al. 1991; Irwin and Arnason 1994; Ma et al. 1993; Arnason et al. 1995; Arnason and Gullberg 1994, 1996), is very similar in the four modes of comparisons, supporting the versatility of this gene in phylog…”

“For the purpose, the target gene was amplified and sequenced using the conserved flanking primers L-14724, H-15915 and internal primers L-15162, L-15513 and H-15149 (Irwin et al. 1991).”

“Sequence data for this portion of mammalian cytochrome b can determine the species of origin (Irwin et al. 1991).”

“The D-loop region and cytochrome b gene were amplified using PCR with primers constructed from the published goat and bovine DNA sequences (Anderson et al., 1982; Irwin et al., 1991; Takada et al., 1997).”

“We amplified an ≈800-bp fragment of mitochondrial cytochrome b using primers cytb-L14724 (forward) and cytb-H15506 (reverse) (11,39,40).”

“the primer pairs L14724/H15149 and C3/H15915 (Irwin et al., 1991; Dubey et al., 2006), and that of the 16S ribosomal sequence”

“Among the various mtDNA genes, the cytochrome b gene appeared as the most suitable marker for vertebrate identification, particularly in such degraded samples, because it exhibits both large regions of interspecies sequence diversity with low or no intraspecific variation, and several conserved regions allowing the am…”

“Initially, the universal primers L14724 and H15915 (Irwin et al., 1991) were used to amplify the entire cytochrome b gene by PCR (Saiki et al.”

“This gene, which has been broadly applied to vertebrates (GriYths, 1997; Irwin et al., 1991; Janczewski et al., 1995; Kocher et al., 1989; Ledje and Arnasson, 1996), has seldom been used in insects phylogenetics (Simmons and Weller, 2001).”

“Saturation analyses (Brown et al., 1982; Griffths, 1997; Irwin et al., 1991 ) were conducted in order to determine whether excessive homoplasy resulting from multiple hits was likely to cause divergence dates to be underestimated.”

“The cytochrome b region of mtDNA was amplified by the polymerase chain reaction (PCR) on samples using a pair of L14724B and H15915R primers described by Irwin et al. (1991) .”

“We assessed species limits using a broad geographic sample of DNA sequences from the mitochondrial gene cytochrome b in conjunction with morphological character analysis, and we inferred phylogenetic relationships among species using the cytochrome-b dataset in addition to sequences from the mitochondrial genes cytoch…”

“In order to obtain the complete sequence of cyt b gene, an approximately 800bp region of the cyt b gene was also amplified using internal primer L15162 (Irwin et al., 1991) and H15915.”

“As previously observed (e.g., Hassanin and Douzery, 1999; Irwin et al., 1991), the highest levels of homoplasy and saturation are observed at third codon positions, for which almost all Ti and most Tv are synonymous.”

“A 604-base pair (bp) fragment of the mitochondrial Cytb gene was amplified and sequenced in representative accessions or voucher specimens of 33 Miniopterus and 2 outgroup taxa (Appendix I) using primers L14724 and H15275 (Irwin et al. 1991).”

“1997) and a universal heavy STRAND primer (H15915, Irwin et al. 1991) in a 50- µ L PCR including 0.5 U Ampli Taq Gold (PerkinElmer), 2.5 m m MgCl 2 , 1 × reaction buffer (PerkinElmer) 200 µ m each dNTP, 1.0 mg/mL Fraction-V BSA, and 1 µ m each primer.”

“a Fumagalli et al. (1996) . b Kocher et al. (1989) . d Irwin et al. (1991) . e Matsubara et al. (2001) . f Hellborg and Ellegren (2003) . Locus Size Accession Forward primer Reverse primer T”

“The entire mitochondrial cytb gene was amplified and sequenced using universal primers L14724 and H15915 (Irwin et al., 1991) and L14841 and H15149 (Kocher et al., 1989).”

“[21].”

“Complete cytochrome b gene (cytb) was amplified by the polymerase chain reaction (PCR) using universal primers L14724 and H15915 (Irwin et al., 1991) or their slightly modified versions L14724ag and H15915ag (Guillén-Servent and Francis, 2006).”

“Light strand internal primers used included 700L (5-CCC AGC ACA TAT TAA ACC AGA AT-3) (Peppers and Bradley, 2000), F1 (5-TGA GGA CAR ATA TCH TTY TGR GG) (Whiting et al., 2003), L15162 (5TCG YCT YCC ATG AGG RCA TAT ATC-3) ( Irwin et al., 1991 ), MVZ 45 (5-GTH ATA GCH ACA GCA TTY ATA GG-3) (Smith and Patton, 1993), MVZ…”

“Thus, we used a polymerase chain reaction (PCR) to amplify the whole cyt b gene using universal primers H15149 and L15146 ( Kocher et al. , 1989 ), H15915 and L14724 ( Irwin et al.”

“Cyt b was amplified using the primer pairs L16457 (50-TGTACCTCTTCTCGCTCCGGG-30) and H16781 (50-TTATGTCCTGTG-ACCATTGACTG A-30) and L14724 (50-GATATGAAAACCCATCGTT G-30; Irwin et al., 1991) and H15149 (50-CTCAGAATG ATATTTGTCCTCA-30; Kocher et al.”

“Application of a third codon higher vertebrate clock calibration of 10% divergence per million years ( Irwin et al. 1991 ) suggests 0.2–0.3 My isolation (Grant et al. 1998), while the calibrations of Martin et al. (1992) and Bermingham et al. (1997) suggest divergence 0.6–1.3 Mya.”

“A fragment containing complete region (c. 1141 bp) of mitochondrial cytochrome b gene (cyt b) was amplified using Gludg-L (5¢-TGACTTGAARAACCAYCGTTG-3¢) (Palumbi et al. 1991) and H15915 (5¢-AACTGCAGTCATCTCCGGTTTACAAGAC-3¢) (Irwin et al. 1991).”

“The strong genetic divergence (d = 8.4%) between the two oldest ridges – Lake Wales Ridge (E. e. lividus) and Mt. Dora Ridge (E. e. onocrepis) – suggests a separation of approximately 4 MY based on conventional estimates of molecular evolutionary rates for cytochrome b ( Irwin et al. 1991 ), a time frame that overlaps…”

“A 604-base pari (bp) fragment of the mitochondrial Cytb gene was amplified using primers L14724 and H15275 (Irwin et al. 1991).”

“Amplification was carried out using the universal primers CB2H (Kocher et al. 1989) and L14724 (Irwin et al. 1991).”

“To investigate the relationships among wild and domestic goats, we chose the mitochondrial cytochrome b gene ( Irwin et al., 1991 ) and the mitochondrial displacement loop (D-loop) region as phylogenetic probes, because the complete sequences from other ungulates are now fully available.”

“The primers described by Irwin et al. (1991) amplify the entire cyt b but were tested in a limited set of mammalian species.”

“There is a range of universal primer sets for mammalian species, such that a sample from any mammalian species will generate the same size product after amplification using the polymerase chain reaction (PCR) [62, 63, 71, 79, 81–83].”

“DNA was extracted by phenol–chloroform and concentrated in Centricons as in Leonard et al. (2005) or by DNeasy animal tissue and blood extraction kit (Qiagen, Hilden, Germany) following the animal tissue protocol.”

“Starting parameters (base frequency A, 0.29; C, 0.26; G, 0.12; T, 0.33; substitution model Ti/Tv ¼ 10.22, Gamma ¼ 0.3791) are typical for mammalian Cytb (Irwin et al. 1991).”

“A cytochrome b fragment was amplified using DNA isolated from Apodemus rodents using the primers L 14771 (5¢-CA ACATTCGTAAAACCCACC-3¢) and H 15149 (5¢-AAACTG CAGCCCCTCAGAATGATATTTGTCCTCA-3¢) (Irwin et al. 1991).”

“For the majority of the samples, the cytochrome b gene was PCR-amplified (Saiki et al., 1988) as two overlapping double-stranded fragments using the following primer pairs: L 14723 (5’-ACC AATGCAATGAAAAATCATCGTT-3’) and H 15553 (5’- TAGGCAAATAGGAAATATCATTCTGGT-3’); L15146 (5’- CATGAGGACAAATATCATTCTGAG-3’) and H15915 (…”

“%) de todos los taxa, concordando con lo observado en otros mamíferos (Irwin et al. 1991).”

“L-TGA CTT GAA RAA CCA YCG TTG (Palumbi et al. 1991) and H15915-AAC TGC CAG TCA TCT CCG GGT TAC AAG AC (Irwin et al. 1991).”

“The cyt-b gene was amplified and sequenced using the primers L14724 and H15915 (Irwin et al. 1991).”