The m(6)A Methyltransferase METTL3 Promotes Translation in Human Cancer Cells
Open accessAbstract
METTL3 is an RNA methyltransferase implicated in mRNA biogenesis, decay, and translation control through N(6)-methyladenosine (m(6)A) modification. Here we find that METTL3 promotes translation of certain mRNAs including epidermal growth factor receptor (EGFR) and the Hippo pathway effector TAZ in human cancer cells. In contrast to current models that invoke m(6)A reader proteins downstream of nuclear METTL3, we find METTL3 associates with ribosomes and promotes translation in the cytoplasm. METTL3 depletion inhibits translation, and both wild-type and catalytically inactive METTL3 promote translation when tethered to a reporter mRNA. Mechanistically, METTL3 enhances mRNA translation through an interaction with the translation initiation machinery. METTL3 expression is elevated in lung adenocarcinoma and using both loss- and gain-of-function studies, we find that METTL3 promotes growth, survival, and invasion of human lung cancer cells. Our results uncover an important role of METTL3 in promoting translation of oncogenes in human lung cancer.
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
m6A methyltransferase activity has been detected in both nuclear and cytoplasmic fractions, including in RPCs.
“METTL3 is observed predominantly in nuclear speckles, although m6A methyltransferase activity has been detected in both nuclear and cytoplasmic fractions, including in RPCs (Lin et al., 2016).”
From METTL3 uncouples chromatin accessibility from transcription during retinal development (2025) · cites this paper as Lin et al., 2016
The Introduction (page not provided) says that m6A methyltransferase activity has been detected in both nuclear and cytoplasmic extracts. It does not say that this activity was detected in RPCs; searching the indexed copy for “RPCs” found no supporting passage. (LLM, conf=0.88)
Experimental — accuracy not yet measuredMETTL3 is observed predominantly in nuclear speckles.
“METTL3 is observed predominantly in nuclear speckles, although m6A methyltransferase activity has been detected in both nuclear and cytoplasmic fractions, including in RPCs (Lin et al., 2016).”
From METTL3 uncouples chromatin accessibility from transcription during retinal development (2025) · cites this paper as Lin et al., 2016
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Cites
N6-methyladenosine-dependent regulation of messenger RNA stability
Wang, X., Lu, Z., Gomez, A., Hon, G. C., Yue, Y., Han, D., Fu, Y., Parisien, M., Dai, Q., Jia, G., et al. (2014) · Nature · doi:10.1038/nature12730 · Cited by 4,558 · cited 8× · see citing works
“The previously confirmed siRNA targeting sequences (Liu et al., 2014; Wang et al., 2014b, 2015) used in this study are: siMETTL3: CTGCAAGTATGTTCAC TATGA; siMETTL14: AAGGATGAGTTAATAGCTAAA; siWTAP AAGCTTTG GAGGGCAAGTACA; siYTHDF1: CCGCGTCTAGTTGTTCATGAA; siYTHDF2: AAGGACGTTCCCAATAGCCAA.”
BackgroundMethodInfluentialComprehensive Analysis of mRNA Methylation Reveals Enrichment in 3′ UTRs and near Stop Codons
Meyer, K. D., Saletore, Y., Zumbo, P., Elemento, O., Mason, C. E., & Jaffrey, S. R. (2012) · Cell · doi:10.1016/j.cell.2012.05.003 · Cited by 4,223 · see citing works
N6-Methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO
Jia, G., Fu, Y., Zhao, X., Dai, Q., Zheng, G., Yang, Y., Yi, C., Lindahl, T., Pan, T., Yang, Y.-G., et al. (2011) · Nature Chemical Biology · doi:10.1038/nchembio.687 · Cited by 4,106 · see citing works
ALKBH5 Is a Mammalian RNA Demethylase that Impacts RNA Metabolism and Mouse Fertility
Zheng, G., Dahl, J. A., Niu, Y., Fedorcsak, P., Huang, C.-M., Li, C. J., Vågbø, C. B., Shi, Y., Wang, W.-L., Song, S.-H., et al. (2013) · Molecular Cell · doi:10.1016/j.molcel.2012.10.015 · Cited by 3,550 · see citing works
Flagged first, then by citations
Research works printed but not linked: 42
- Alarcon CR Goodarzi H Lee H Liu X Tavazoie S Tavazoie SF 2015a HNRNPA2B1 Is a Mediator of m(6)A-Dependent Nuclear RNA Processing Events Cell 162 1299 1308 26321680 PMC4673968
- Alarcon CR Lee H Goodarzi H Halberg N Tavazoie SF 2015b N6- methyladenosine marks primary microRNAs for processing Nature 519 482 485 25799998 PMC4475635
- Batista PJ Molinie B Wang J Qu K Zhang J Li L Bouley DM Lujan E Haddad B Daneshvar K 2014 m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells Cell Stem Cell 15 707 719 25456834 PMC4278749
- Bokar JA Shambaugh ME Polayes D Matera AG Rottman FM 1997 Purification and cDNA cloning of the AdoMet-binding subunit of the human mRNA (N6- adenosine)-methyltransferase RNA 3 1233 1247 9409616 PMC1369564
- Chang HM Martinez NJ Thornton JE Hagan JP Nguyen KD Gregory RI 2012 Trim71 cooperates with microRNAs to repress Cdkn1a expression and promote embryonic stem cell proliferation Nat Commun 3 923 22735451 PMC3518406
- Chen T Hao YJ Zhang Y Li MM Wang M Han W Wu Y Lv Y Hao J Wang L 2015 m(6)A RNA methylation is regulated by microRNAs and promotes reprogramming to pluripotency Cell Stem Cell 16 289 301 25683224
- Choe J Oh N Park S Lee YK Song OK Locker N Chi SG Kim YK 2012 Translation initiation on mRNAs bound by nuclear cap-binding protein complex CBP80/20 requires interaction between CBP80/20-dependent translation initiation factor and eukaryotic translation initiation factor 3g J Biol Chem 287 18500 18509 22493286 PMC3365721
- Desrosiers R Friderici K Rottman F 1974 Identification of methylated nucleosides in messenger RNA from Novikoff hepatoma cells Proc Natl Acad Sci U S A 71 3971 3975 4372599 PMC434308
- Dominissini D Moshitch-Moshkovitz S Salmon-Divon M Amariglio N Rechavi G 2013 Transcriptome-wide mapping of N(6)-methyladenosine by m(6)A-seq based on immunocapturing and massively parallel sequencing Nat Protoc 8 176 189 23288318
- Dominissini D Moshitch-Moshkovitz S Schwartz S Salmon-Divon M Ungar L Osenberg S Cesarkas K Jacob-Hirsch J Amariglio N Kupiec M 2012 Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq Nature 485 201 206 22575960
- Fustin JM Doi M Yamaguchi Y Hida H Nishimura S Yoshida M Isagawa T Morioka MS Kakeya H Manabe I 2013 RNA-Methylation-Dependent RNA Processing Controls the Speed of the Circadian Clock Cell 155 793 806 24209618
- Gao X Wan J Liu B Ma M Shen B Qian SB 2015 Quantitative profiling of initiating ribosomes in vivo Nature methods 12 147 153 25486063 PMC4344187
- Garcia-Closas M Couch FJ Lindstrom S Michailidou K Schmidt MK Brook MN Orr N Rhie SK Riboli E Feigelson HS 2013 Genome-wide association studies identify four ER negative-specific breast cancer risk loci Nat Genet 45 392 398 398e391 392 23535733 PMC3771695
- Geula S Moshitch-Moshkovitz S Dominissini D Mansour AA Kol N Salmon-Divon M Hershkovitz V Peer E Mor N Manor YS 2015 Stem cells. m6A mRNA methylation facilitates resolution of naive pluripotency toward differentiation Science 347 1002 1006 25569111
- Harper JE Miceli SM Roberts RJ Manley JL 1990 Sequence specificity of the human mRNA N6-adenosine methylase in vitro Nucleic Acids Res 18 5735 5741 2216767 PMC332308
- Heilman KL Leach RA Tuck MT 1996 Internal 6-methyladenine residues increase the in vitro translation efficiency of dihydrofolate reductase messenger RNA Int J Biochem Cell Biol 28 823 829 8925412
- Horowitz S Horowitz A Nilsen TW Munns TW Rottman FM 1984 Mapping of N6-methyladenosine residues in bovine prolactin mRNA Proc Natl Acad Sci U S A 81 5667 5671 6592581 PMC391771
- Iles MM Law MH Stacey SN Han J Fang S Pfeiffer R Harland M Macgregor S Taylor JC Aben KK 2013 A variant in FTO shows association with melanoma risk not due to BMI Nat Genet 45 428 432 432e421 23455637 PMC3640814
- Ke S Alemu EA Mertens C Gantman EC Fak JJ Mele A Haripal B Zucker-Scharff I Moore MJ Park CY 2015 A majority of m6A residues are in the last exons, allowing the potential for 3′ UTR regulation Genes Dev 29 2037 2053 26404942 PMC4604345
- Kim KM Cho H Choi K Kim J Kim BW Ko YG Jang SK Kim YK 2009 A new MIF4G domain-containing protein, CTIF, directs nuclear cap-binding protein CBP80/20- dependent translation Genes Dev 23 2033 2045 19648179 PMC2751978
- Li F Zhao D Wu J Shi Y 2014 Structure of the YTH domain of human YTHDF2 in complex with an m(6)A mononucleotide reveals an aromatic cage for m(6)A recognition Cell Res 24 1490 1492 25412658 PMC4260351
- Lin S Gregory RI 2014 Methyltransferases modulate RNA stability in embryonic stem cells Nature cell biology 16 129 131 24481042
- Liu J Yue Y Han D Wang X Fu Y Zhang L Jia G Yu M Lu Z Deng X 2014 A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation Nature chemical biology 10 93 95 24316715 PMC3911877
- Liu N Dai Q Zheng G He C Parisien M Pan T 2015 N(6)-methyladenosinedependent RNA structural switches regulate RNA-protein interactions Nature 518 560 564 25719671 PMC4355918
- Meyer KD Jaffrey SR 2014 The dynamic epitranscriptome: N6-methyladenosine and gene expression control Nat Rev Mol Cell Biol 15 313 326 24713629 PMC4393108
- Meyer KD Patil DP Zhou J Zinoviev A Skabkin MA Elemento O Pestova TV Qian SB Jaffrey SR 2015 5′ UTR m(6)A Promotes Cap-Independent Translation Cell 163 999 1010 26593424 PMC4695625
- Oh N Kim KM Cho H Choe J Kim YK 2007 Pioneer round of translation occurs during serum starvation Biochem Biophys Res Commun 362 145 151 17693387
- Perry RP Kelley DE Friderici K Rottman F 1975 The methylated constituents of L cell messenger RNA: evidence for an unusual cluster at the 5′ terminus Cell 4 387 394 1168101
- Ping XL Sun BF Wang L Xiao W Yang X Wang WJ Adhikari S Shi Y Lv Y Chen YS 2014 Mammalian WTAP is a regulatory subunit of the RNA N6- methyladenosine methyltransferase Cell research 24 177 189 24407421 PMC3915904
- Schwartz S Mumbach MR Jovanovic M Wang T Maciag K Bushkin GG Mertins P Ter-Ovanesyan D Habib N Cacchiarelli D 2014 Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5′ sites Cell Rep 8 284 296 24981863 PMC4142486
- Theler D Dominguez C Blatter M Boudet J Allain FH 2014 Solution structure of the YTH domain in complex with N6-methyladenosine RNA: a reader of methylated RNA Nucleic Acids Res 42 13911 13919 25389274 PMC4267619
- Tuck MT 1992 Partial purification of a 6-methyladenine mRNA methyltransferase which modifies internal adenine residues Biochem J 288 Pt 1 233 240 1445268 PMC1132103
- Tuck MT James CB Kelder B Kopchick JJ 1996 Elevation of internal 6- methyladenine mRNA methyltransferase activity after cellular transformation Cancer Lett 103 107 113 8616802
- Wang LN Wang Y Lu Y Yin ZF Zhang YH Aslanidi GV Srivastava A Ling CQ Ling C 2014a Pristimerin enhances recombinant adeno-associated virus vectormediated transgene expression in human cell lines in vitro and murine hepatocytes in vivo Journal of integrative medicine 12 20 34 24461592
- Wang X Zhao BS Roundtree IA Lu Z Han D Ma H Weng X Chen K Shi H He C 2015 N(6)-methyladenosine Modulates Messenger RNA Translation Efficiency Cell 161 1388 1399 26046440 PMC4825696
- Wang Y Li Y Toth JI Petroski MD Zhang Z Zhao JC 2014c N6- methyladenosine modification destabilizes developmental regulators in embryonic stem cells Nature cell biology 16 191 198 24394384 PMC4640932
- Xu C Wang X Liu K Roundtree IA Tempel W Li Y Lu Z He C Min J 2014 Structural basis for selective binding of m6A RNA by the YTHDC1 YTH domain Nat Chem Biol 10 927 929 25242552
- Yue Y Liu J He C 2015 RNA N6-methyladenosine methylation in posttranscriptional gene expression regulation Genes Dev 29 1343 1355 26159994 PMC4511210
- Zhang YH Wang Y Yusufali AH Ashby F Zhang D Yin ZF Aslanidi GV Srivastava A Ling CQ Ling C 2014 Cytotoxic genes from traditional Chinese medicine inhibit tumor growth both in vitro and in vivo Journal of integrative medicine 12 483 494 25412666
- Zhao X Yang Y Sun BF Shi Y Yang X Xiao W Hao YJ Ping XL Chen YS Wang WJ 2014 FTO-dependent demethylation of N6-methyladenosine regulates mRNA splicing and is required for adipogenesis Cell Res 24 1403 1419 25412662 PMC4260349
- Zhou J Wan J Gao X Zhang X Jaffrey SR Qian SB 2015 Dynamic m(6)A mRNA methylation directs translational control of heat shock response Nature 526 591 594 26458103 PMC4851248
- Zhu T Roundtree IA Wang P Wang X Wang L Sun C Tian Y Li J He C Xu Y 2014 Crystal structure of the YTH domain of YTHDF2 reveals mechanism for recognition of N6-methyladenosine Cell Res 24 1493 1496 25412661 PMC4260350
Cited by
Sorted by citations
Reading, writing and erasing mRNA methylation
Zaccara, S., Ries, R. J., & Jaffrey, S. R. (2019) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-019-0168-5 · Cited by 2,597 · see citing works
The role of m6A modification in the biological functions and diseases
Jiang, X., Liu, B., Nie, Z., Duan, L., Xiong, Q., Jin, Z., Yang, C., & Chen, Y. (2021) · Signal Transduction and Targeted Therapy · doi:10.1038/s41392-020-00450-x · Cited by 2,335 · see citing works
Functional 5′ UTR mRNA structures in eukaryotic translation regulation and how to find them
Leppek, K., Das, R., & Barna, M. (2018) · Nature Reviews Molecular Cell Biology · doi:10.1038/nrm.2017.103 · Cited by 949 · see citing works
RNA Circularization Diminishes Immunogenicity and Can Extend Translation Duration In Vivo
Wesselhoeft, R. A., Kowalski, P. S., Parker-Hale, F. C., Huang, Y., Bisaria, N., & Anderson, D. G. (2019) · Molecular Cell · doi:10.1016/j.molcel.2019.02.015 · Cited by 482 · see citing works
METTL3-mediated m6A modification is required for cerebellar development
Wang, C.-X., Cui, G.-S., Liu, X., Xu, K., Wang, M., Zhang, X.-X., Jiang, L.-Y., Li, A., Yang, Y., Lai, W.-Y., et al. (2018) · PLOS Biology · doi:10.1371/journal.pbio.2004880 · Cited by 291 · see citing works
m6A RNA Methylation Controls Neural Development and Is Involved in Human Diseases
Du, K., Zhang, L., Lee, T., & Sun, T. (2019) · Molecular Neurobiology · doi:10.1007/s12035-018-1138-1 · Cited by 153 · see citing works
The Role of Translation Control in Tumorigenesis and Its Therapeutic Implications
Xu, Y., & Ruggero, D. (2020) · Annual Review of Cancer Biology · doi:10.1146/annurev-cancerbio-030419-033420 · Cited by 67 · see citing works
Yin, H., Ju, Z., Zheng, M., Zhang, X., Zuo, W., Wang, Y., Ding, X., Zhang, X., Peng, Y., Li, J., et al. (2023) · PLOS Biology · doi:10.1371/journal.pbio.3002017 · Cited by 62 · see citing works
Xu, B., Li, Q., Wu, Y., Wang, H., Xu, J., Liu, H., & Xuan, A. (2022) · The FASEB Journal · doi:10.1096/fj.202200133rr · Cited by 35 · see citing works
METTL3 uncouples chromatin accessibility from transcription during retinal development
Xu, J., Huang, Y., Han, Z., Li, Q., Liu, J., & Rao, R. C. (2025) · Stem Cell Reports · doi:10.1016/j.stemcr.2025.102690 · Cited by 1 · see citing works
- Authors
- Lin, S., Choe, J., Du, P., Triboulet, R., & Gregory, R. I.
- Affiliations
- Boston Children's Hospital (US)
- Corresponding author
- Gregory, Richard I.
- Venue
- Molecular Cell
- Publisher
- Elsevier BV
- Published
- 2016-05
- Volume
- 62
- Issue
- 3
- Pages
- 335-345
- ISSN
- 1097-2765 (ISSN-L)
- PMC
- PMC4860043
- OpenAlex
- W2342299314
- Cited by
- 1,531
- References
- 4
- Citations by year
- 2026: 66 · 2025: 106 · 2024: 163 · 2023: 193 · 2022: 251 · 2021: 282 · 2020: 201 · 2019: 123 · 2018: 78 · 2017: 54 · 2016: 12
- FWCI
- 46.44
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- Locations
- Molecular Cell (publishedVersion)
- PubMed (publishedVersion)
- PubMed Central (acceptedVersion)
- Funders
- Damon Runyon Cancer Research Foundation
- National Institute of General Medical Sciences (P01GM099117, R01GM086386)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › RNA modifications and cancer
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › RNA and protein synthesis mechanisms
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › RNA regulation and disease
- Keywords
- METTL3, m6A RNA methylation, mRNA translation, ribosome association, EGFR, TAZ, Hippo signaling pathway, lung adenocarcinoma, tumor invasion
- MeSH terms
- A549 Cells, Adenocarcinoma of Lung, Transcriptional Coactivator with PDZ-Binding Motif Proteins, Adenocarcinoma, Cell Movement, Cell Survival, Humans, Lung Neoplasms, Methyltransferases, Neoplasm Invasiveness, Peptide Chain Initiation, Translational, Ribosomes, RNA, Messenger, Transcription Factors, Transfection, Signal Transduction, Trans-Activators, Up-Regulation, Gene Expression Regulation, Neoplastic, RNA Interference, Eukaryotic Initiation Factor-3, Intracellular Signaling Peptides and Proteins, Cell Proliferation, ErbB Receptors
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
