A Self-restricted CRISPR System to Reduce Off-target Effects

Abstract

To the Editor: Genome editing technologies, such as clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) systems, are being widely applied in biomedical research with the potential of developing novel therapeutics.1Hsu PD Lander ES Zhang F Development and applications of CRISPR-Cas9 for genome engineering.Cell. 2016; 157: 1262-1278Abstract Full Text Full Text PDF Scopus (3606) Google Scholar,2Maeder ML Gersbach CA Genome-editing technologies for gene and cell therapy.Mol Ther. 2016; 24: 475-487Abstract Full Text Full Text PDF PubMed Scopus (405) Google Scholar To date, a variety of viral systems have been used to deliver CRISPR reagents, including lentiviruses (LVs), adenoviruses (AdVs), and adeno-associated viruses (AAVs). Although viral vectors offer high efficiency of delivery of CRISPR systems in cultured cells or local tissues in vivo, long-term constitutive expression of CRISPRs in cells and tissues for months or even longer raises the concern that any potential off-target effects could be exacerbated. Use of nonintegrating viral vectors could address this issue, but the duration of CRISPR expression via nonintegrating LVs, AdVs, or AAVs could still last for weeks to months. Delivery of CRISPRs in the format of Cas9 messenger RNA (mRNA) with guide RNA as mRNA/single guide RNA (sgRNA) complexes or Cas9 recombinant protein with guide RNA as ribonucleoproteins (RNPs) provides potential solutions to reduce off-target effects.3Kim S Kim D Cho SW Kim J Kim JS Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.Genome Res. 2014; 24: 1012-1019Crossref PubMed Scopus (1125) Google Scholar The use of engineered nanoparticles for in vivo delivery of Cas9 mRNA/sgRNA complexes or RNPs represents an important delivery strategy for potential therapeutics.4Yin H Song CQ Dorkin JR Zhu LJ Li Y Wu Q et al.Therapeutic genome editing by combined viral and non-viral delivery of CRISPR system components in vivo.Nat Biotechnol. 2016; 34: 328-333Crossref PubMed Scopus (626) Google Scholar However, the efficacy of these strategies is largely constrained by poor in vivo delivery efficiency, especially for large molecules such as Cas9 mRNA, the lack of cell/tissue specificity, and the relatively compromised stability of mRNA/sgRNA or RNP complexes after delivery. To promote the delivery efficiency and to reduce the duration of CRISPR expression via viral vector systems, we report here the development of a self-restricted CRISPR system that can be used to shorten Cas9 expression duration within a lentiviral vector format to a couple of days. Our approach contributes to a significant reduction in off-target effects compared to the standard lentiCRISPR system. In this study, we re-engineered the lentiCRISPR v2 plasmid5Sanjana NE Shalem O Zhang F Improved vectors and genome-wide libraries for CRISPR screening.Nat Methods. 2014; 11: 783-784Crossref PubMed Scopus (2688) Google Scholar by inserting a second guide RNA expression cassette using a mouse U6 promoter. From this cassette, a guide RNA targeting Cas9 itself was co-expressed with the guide RNA that recognized the target gene. Therefore, we hypothesized that the Cas9 expression cassette within the viral vector would be simultaneously targeted and destroyed along with the target gene, resulting in a much reduced expression duration of Cas9. Thus, we named this modified CRISPR system a “self-restricted CRISPR system” (Figure 1a). We first screened for an efficient guide RNA targeting Cas9 (targeting sequences: GGAAGGACTCTTCCAGTCTG + TGG), and in a proof-of-principle experiment, generated lentiviruses carrying the CRISPR targeting the P53 gene (targeting sequences: AGCACATGACGGAGGTTGTG + AGG) using both the regular lentiCRISPR and self-restricted CRISPR systems. A human hepatoma cell line Huh7 was respectively transduced with lentiCRISPR v2 viruses (without guide RNA), lentiCRISPR v2 viruses carrying guide RNA targeting P53 gene (regular lentiCRISPR), and lentiCRISPR v2 viruses carrying guide RNAs targeting both P53 and Cas9 genes (self-restricted CRISPR). Cells were harvested at the indicated days post-infection for subsequent analysis. Western blot analysis showed that Cas9 protein expression was significantly reduced in cells modified with the self-restricted CRISPR system at as early as day 2 post-infection compared to the control groups (Figure 1b). To determine the targeting efficiency at the P53 gene locus, T7E1 analysis in Huh7 cells harvested at days 4 and 8 displayed a significant and comparable genome editing activity at the P53 gene locus with specific cleavage activity at the Cas9 gene locus in the self-restricted CRISPR system (Figure 1c). In fact, we noticed a slight increase in cleavage activity at day 8 compared to day 4 at both P53 and Cas9 gene loci. We suspected that this was a result of residual Cas9 expression after 4 days in the self-restricted CRISPR system, even thou