The DOI matches its Crossref record; 36 of the 36 references it cites were found in a registry or an index.
Selection and evaluation of clinically relevant AAV variants in a xenograft liver model
Open accessAbstract
Recombinant adeno-associated viral (rAAV) vectors have shown early promise in clinical trials. The therapeutic transgene cassette can be packaged in different AAV capsid pseudotypes, each having a unique transduction profile. At present, rAAV capsid serotype selection for a specific clinical trial is based on effectiveness in animal models. However, preclinical animal studies are not always predictive of human outcome. Here, in an attempt to further our understanding of these discrepancies, we used a chimaeric human-murine liver model to compare directly the relative efficiency of rAAV transduction in human versus mouse hepatocytes in vivo. As predicted from preclinical and clinical studies, rAAV2 vectors functionally transduced mouse and human hepatocytes at equivalent but relatively low levels. However, rAAV8 vectors, which are very effective in many animal models, transduced human hepatocytes rather poorly-approximately 20 times less efficiently than mouse hepatocytes. In light of the limitations of the rAAV vectors currently used in clinical studies, we used the same murine chimaeric liver model to perform serial selection using a human-specific replication-competent viral library composed of DNA-shuffled AAV capsids. One chimaeric capsid composed of five different parental AAV capsids was found to transduce human primary hepatocytes at high efficiency in vitro and in vivo, and provided species-selected transduction in primary liver, cultured cells and a hepatocellular carcinoma xenograft model. This vector is an ideal clinical candidate and a reagent for gene modification of human xenotransplants in mouse models of human diseases. More importantly, our results suggest that humanized murine models may represent a more precise approach for both selecting and evaluating clinically relevant rAAV serotypes for gene therapeutic applications.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“AAV-NP59 also elicited reduced anti-AAV IgG than AAV-LK03 (119) and AAV8, but not as good as previously discovered engineer capsid AAV-DJ.”
From A versatile toolkit for overcoming AAV immunity (2022) · cites this paper as [119]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
Organoid Models and Applications in Biomedical Research
Xinaris, C., Brizi, V., & Remuzzi, G. (2015) · The Nephron journals/Nephron journals · doi:10.1159/000433566 · Cited by 3,519
Manno, C. S., Pierce, G. F., Arruda, V. R., Glader, B., Ragni, M., Rasko, J. J. E., Ozelo, M. C., Hoots, K., Blatt, P., Konkle, B., et al. (2006) · Nature Medicine · doi:10.1038/nm1358 · Cited by 2,163
Self-citationEffect of gene therapy on visual function in Leber’s congenital amaurosis
Bainbridge, J. W. B., Smith, A. J., Barker, S. S., Robbie, S., Henderson, R., Balaggan, K., Viswanathan, A., Holder, G. E., Stockman, A., Tyler, N., et al. (2008) · New England Journal of Medicine · doi:10.1056/nejmoa0802268 · Cited by 1,924
Adenovirus-Associated Virus Vector–Mediated Gene Transfer in Hemophilia B
Nathwani, A. C., Tuddenham, E. G. D., Rangarajan, S., Rosales, C., McIntosh, J., Linch, D. C., Chowdary, P., Riddell, A., Pie, A. J., Harrington, C., et al. (2011) · New England Journal of Medicine · doi:10.1056/nejmoa1108046 · Cited by 1,864
Self-citationKay, M. A., Manno, C. S., Ragni, M. V., Larson, P. J., Couto, L. B., McClelland, A., Glader, B. E., Chew, A. K., Tai, S. J., Herzog, R. W., et al. (2000) · Nature Genetics · doi:10.1038/73464 · Cited by 1,019
Self-citationBoutin, S., Monteilhet, V., Veron, P., Leborgne, C., Benveniste, O., Montus, M. F., & Masurier, C. (2010) · Human Gene Therapy · doi:10.1089/hum.2009.182 · Cited by 970
Robust expansion of human hepatocytes in Fah−/−/Rag2−/−/Il2rg−/− mice
Azuma, H., Paulk, N., Ranade, A., Dorrell, C., Al-Dhalimy, M., Ellis, E., Strom, S., Kay, M. A., Finegold, M., & Grompe, M. (2007) · Nature Biotechnology · doi:10.1038/nbt1326 · Cited by 835
Self-citationWorldwide epidemiology of neutralizing antibodies to adeno-associated viruses
Calcedo, R., Vandenberghe, L. H., Gao, G., Lin, J., & Wilson, J. M. (2009) · The Journal of Infectious Diseases · doi:10.1086/595830 · Cited by 808
Grimm, D., Lee, J. S., Wang, L., Desai, T., Akache, B., Storm, T. A., & Kay, M. A. (2008) · Journal of Virology · doi:10.1128/jvi.00254-08 · Cited by 696
Self-citationDirected evolution of adeno-associated virus yields enhanced gene delivery vectors
Maheshri, N., Koerber, J. T., Kaspar, B. K., & Schaffer, D. V. (2006) · Nature Biotechnology · doi:10.1038/nbt1182 · Cited by 538
Cited by
Sorted by citations
Items 301–400 of 453
Thorne, B., Takeya, R. K., Vitelli, F., & Swanson, X. (2017) · Advances in biochemical engineering, biotechnology · doi:10.1007/10_2016_53 · Cited by 11
“Most of the early rAVV vectors used in the clinic were derived from AAV2, but many of the products currently under development use a wide range of human or primate capsids adapted or engineered for specific tissue tropism or to avoid pre-existing neutralizing antibodies present in the population [12, 13].”
BackgroundGeranylgeranyl isoprenoids and hepatic Rap1a regulate basal and statin-induced expression of PCSK9
Wang, Y., Tinsley, B., Spolitu, S., Zadroga, J. A., Agarwal, H., Sarecha, A. K., & Özcan, L. (2024) · Journal of Lipid Research · doi:10.1016/j.jlr.2024.100515 · Cited by 10
“AAV8-shRNA targeting murine Pggt1b was made by annealing complementary oligonucleotides 5 ′ -CACCAAAGCCATCAGCTACATTAGAAGAA GTCAAGAGCTTCTTCTAATGTAGCTGATGGCTT -3 ′ , which were then ligated into the self-complementary AAV8-RSV-GFP-H1 vector as described previously (39).”
MethodPekrun, K., Stephens, C. J., Gonzalez‐Sandoval, A., Goswami, A., Zhang, F., Tarantal, A. F., Blouse, G. E., & Kay, M. A. (2024) · Molecular Therapy · doi:10.1016/j.ymthe.2024.05.005 · Cited by 10
Self-citationLi, Y., & Zhou, L. (2021) · BioEssays · doi:10.1002/bies.202100086 · Cited by 11
Novel AAV variants with improved tropism for human Schwann cells
Drouyer, M., Chu, T., Labit, E., Haase, F., Navarro, R. G., Nazareth, D., Rosin, N. L., Merjane, J., Scott, S., Cabanes‐Creus, M., et al. (2024) · Molecular Therapy — Methods & Clinical Development · doi:10.1016/j.omtm.2024.101234 · Cited by 10
“18 However, the success of such strategies depends on the interplay of three critical elements: the starting AAV library, the selection strategy or platform, and the preclinical model on which the selection and subsequent validation of AAV variants are performed.”
BackgroundSelf-citationDagur, R. S., Branch-Woods, A., Mathews, S., Joshi, P. S., Quadros, R. M., Harms, D. W., Cheng, Y., Miles, S. M., Pirruccello, S. J., Gurumurthy, C. B., et al. (2019) · BMC Immunology · doi:10.1186/s12865-018-0279-3 · Cited by 10
“Biodistribution and expression levels of recombinant adeno-associated virus (rAAV) 296 vector delivered genes could be affected by sialylation of host receptors [5, 10, 43].”
BackgroundSystematic multi-trait AAV capsid engineering for efficient gene deliveryPreprint
Eid, F.-E., Chen, A. T., Chan, K. Y., Huang, Q., Zheng, Q., Tobey, I. G., Pacouret, S., Brauer, P. P., Keyes, C., Powell, M. M., et al. (2022) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2022.12.22.521680 · Cited by 10
Basic and Clinical Application of Adeno-Associated Virus–Mediated Genome Editing
He, X., Xie, H., Liu, X., & Gu, F. (2018) · Human Gene Therapy · doi:10.1089/hum.2018.190 · Cited by 7
Challenges in Retinal Circuit Regeneration
Osakada, F., & Takahashi, M. (2015) · Biological and Pharmaceutical Bulletin · doi:10.1248/bpb.b14-00771 · Cited by 9
Zhang, X., Chai, Z., Samulski, R. J., & Li, C. (2020) · Human Gene Therapy · doi:10.1089/hum.2020.193 · Cited by 9
Qu, W., Zhao, J., Wu, Y., Xu, R., & Liu, S. (2020) · Current Gene Therapy · doi:10.2174/1566523220999201111194257 · Cited by 9
Logan, G. J., de Alencastro, G., Alexander, I. E., & Yeoh, G. C. (2014) · The International Journal of Biochemistry & Cell Biology · doi:10.1016/j.biocel.2014.10.023 · Cited by 9
Self-citationYuan, L., Ling, C., Shoti, J., Yang, H., Nath, A., Keeler, G. D., Qing, K., & Srivastava, A. (2024) · Molecular Therapy — Nucleic Acids · doi:10.1016/j.omtn.2024.102196 · Cited by 9
iPSC-hepatocyte organoids as a novel platform to predict AAV gene therapy efficacy
Berreur, E., Lazzaroni, G., Roth, C., Zihlmann, M., Stirn, M., Matheis, R., Xicluna, R., Breous-Nystrom, E., & Roth, A. B. (2025) · Molecular Therapy — Methods & Clinical Development · doi:10.1016/j.omtm.2025.101467 · Cited by 10
“22–24 Another study confirmed species differences in the transduction efficiency of several AAV serotypes in murine, hamster, and monkey immortalized cell lines.”
Construction and Cloning of Minigenes for in vivo Analysis of Potential Splice Mutations
Riedmayr, L. M., Böhm, S., Michalakis, S., & Bećirović, E. (2018) · BIO-PROTOCOL · doi:10.21769/bioprotoc.2760 · Cited by 8
Gene transfer and genome editing for familial hypercholesterolemia
Canepari, C., & Cantore, A. (2023) · Frontiers in Molecular Medicine · doi:10.3389/fmmed.2023.1140997 · Cited by 11
Colón-Thillet, R., Stone, D., Loprieno, M. A., Klouser, L. M., Roychoudhury, P., Santo, T. K., Xie, H. J., Stensland, L., Upham, S. L., Pepper, G., et al. (2023) · Microbiology Spectrum · doi:10.1128/spectrum.05176-22 · Cited by 8
Tang, Y., Li, J., Zhang, T., Chen, H., Qin, M., Chen, H., Huang, J., Miao, Z., Cai, R., Yang, Y., et al. (2024) · Artificial Organs · doi:10.1111/aor.14748 · Cited by 8
Gene Therapy for Hemophilia A: Where We Stand
Zhou, M., Hu, Z., Zhang, C., Wu, L., Li, Z., & Liang, D. (2020) · Current Gene Therapy · doi:10.2174/1566523220666200806110849 · Cited by 8
Zhang, S., Bastille, A., Gordo, S., Ramesh, N., Vora, J., McCarthy, E., Zhang, X., Frank, D., Ko, C., Wu, C., et al. (2022) · PLoS ONE · doi:10.1371/journal.pone.0274774 · Cited by 9
The Potential of AAV-Mediated Gene Targeting for Gene and Cell Therapy Applications
Alexander, I. E., & Russell, D. W. (2015) · Current Stem Cell Reports · doi:10.1007/s40778-014-0001-1 · Cited by 8
Self-citationSelection of a novel AAV2/TNFAIP3 vector for local suppression of islet xenograft inflammation
Zammit, N. W., Seeberger, K. L., Zamerli, J., Walters, S. N., Lisowski, L., Korbutt, G. S., & Grey, S. T. (2020) · Xenotransplantation · doi:10.1111/xen.12669 · Cited by 8
Self-citationAdvances in designing Adeno-associated viral vectors for development of anti-HBV gene therapeutics
Mnyandu, N., Limani, S. W., Arbuthnot, P. B., & Maepa, M. B. (2021) · Virology Journal · doi:10.1186/s12985-021-01715-9 · Cited by 9
Targeting AAV vectors to the CNS via de novo engineered capsid-receptor interactionsPreprint
Huang, Q., Chen, A. T., Chan, K. Y., Sorensen, H., Barry, A. J., Azari, B., Beddow, T., Zheng, Q., Zhao, B., Tobey, I. G., et al. (2022) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2022.10.31.514553 · Cited by 8
“…et al., 2016; Krolak et al., 2022), retrograde transduction in the CNS (Tervo et al., 2016), transduction of human hepatocytes in a xenograft system (Lisowski et al.,2013), photoreceptor transduction (Dalkara et al., 2013), and muscle transduction (Tabebordbar et al., 2021; Weinmann et al., 2020).”
BackgroundVoznesenskaya, A., Berggren, P., & Ilegems, E. (2023) · Frontiers in Bioengineering and Biotechnology · doi:10.3389/fbioe.2023.1147244 · Cited by 7
“AAV transduction ef fi cacy towards the same cell type often varies from species to species (Loiler et al., 2003; Asokan et al., 2012; Lisowski et al., 2014) and can thus differ between human and mouse islet cells.”
In vivo selection of hepatocytes
Vonada, A., & Grompe, M. (2024) · Hepatology · doi:10.1097/hep.0000000000001143 · Cited by 8
Self-citationMice Engrafted with Human Liver Cells
de Jong, Y. P. (2024) · Seminars in Liver Disease · doi:10.1055/s-0044-1790601 · Cited by 9
“77 86 Similar to drug metabolism by nonhuman cells in hepatocyte chime-ras, 75 some AAV serotypes can transduce both human and mouse hepatocytes which could be overcome by germline removal of an AAV receptor.”
Genome editing in the human liver: Progress and translational considerations
Ginn, S. L., Christina, S., & Alexander, I. E. (2021) · Progress in molecular biology and translational science · doi:10.1016/bs.pmbts.2021.01.030 · Cited by 7
Self-citationAhmad, A., Mandwie, M., Dreismann, A. K., Smyth, C. M., Doyle, H. J., Malik, T. H., Pickering, M. C., Lachmann, P. J., Alexander, I. E., & Logan, G. J. (2021) · Human Gene Therapy · doi:10.1089/hum.2021.022 · Cited by 7
Self-citationWeinmann, J., Söllner, J. F., Abele, S., Zimmermann, G., Zuckschwerdt, K., Mayer, C. A., Danner-Liskus, J., Peltzer, A., Schuler, M. J., Lamla, T., et al. (2022) · Human Gene Therapy · doi:10.1089/hum.2022.109 · Cited by 8
“(15) AAV2-retro Peptide insertion 67 (40) AAV-Anc80L65 In silico design 52”
BackgroundRana, J., Marsic, D., Zou, C., Muñoz-Melero, M., Li, X., Kondratov, O., Li, N., de Jong, Y. P., Zolotukhin, S., & Biswas, M. (2023) · Human Gene Therapy · doi:10.1089/hum.2022.176 · Cited by 7
“38 This can result in an entirely new recombinant capsid carrying components of the parental capsids 34,39,40 or can result in the incorporation of modified amino acid sequences into the parent serotype.”
Gene Therapy for Paediatric Homozygous Familial Hypercholesterolaemia
Graves, L. E., Horton, A., Alexander, I. E., & Srinivasan, S. (2023) · Heart Lung and Circulation · doi:10.1016/j.hlc.2023.01.017 · Cited by 7
Self-citationRen, B., Tao, C., Swan, M. A., Joachim, N., Martiniello‐Wilks, R., Nassif, N. T., O’Brien, B. A., & Simpson, A. M. (2016) · International Journal of Molecular Sciences · doi:10.3390/ijms17040534 · Cited by 7
Adeno-associated virus vectors for human gene therapy
Chen, H. (2015) · World Journal of Medical Genetics · doi:10.5496/wjmg.v5.i3.28 · Cited by 8
Isolating Natural Adeno-Associated Viruses from Primate Tissues with a High-Fidelity Polymerase
Wang, Q., Nambiar, K., & Wilson, J. M. (2021) · Human Gene Therapy · doi:10.1089/hum.2021.055 · Cited by 8
“27,28 After triple transfection and vector harvesting, equal volumes of each vector lysate were serially diluted with fresh complete medium and then used to transduce Huh7 cells (University of Pennsylvania Gene Therapy Program Immunology Core, Philadelphia, PA), which were seeded at 1 · 10 5…”
A Mechanistic Approach to the Development of Gene Therapy for Chronic Pain
Kibaly, C., Loh, H. H., & Law, P. (2016) · International review of cytology · doi:10.1016/bs.ircmb.2016.06.002 · Cited by 7
Gene Therapy with Adeno-associated Virus for Cystic Fibrosis
Karda, R., Buckley, S. M. K., & Waddington, S. N. (2016) · American Journal of Respiratory and Critical Care Medicine · doi:10.1164/rccm.201510-2024ed · Cited by 7
Developing Humanized Animal Models with Transplantable Human iPSC-Derived Cells
Ma, M., Ge, J.-Y., Nie, Y., Li, Y., & Zheng, Y. (2024) · Frontiers in Bioscience-Landmark · doi:10.31083/j.fbl2901034 · Cited by 6
Breaking Boundaries in the Brain—Advances in Editing Tools for Neurogenetic Disorders
Coorey, B., & Gold, W. A. (2021) · Frontiers in Genome Editing · doi:10.3389/fgeed.2021.623519 · Cited by 7
Daniel, H. D. J., Kumar, S., Kannangai, R., Farzana, J., Joel, J. N., Abraham, A., Lakshmi, K. M., Agbandje‐McKenna, M., Coleman, K. E., Srivastava, A., et al. (2022) · Journal of Medical Virology · doi:10.1002/jmv.27859 · Cited by 6
“2022;94:4542–4547.wileyonlinelibrary.com/journal/jmv4542 | © 2022 Wiley Periodicals LLC. vivo, compared to other AAV serotypes.7 Also, AAV‐LK03, which is a novel synthetic liver tropic vector used for hemophilia A gene therapy, shares 97.9% of the capsid gene sequence and 98.9% of the amino acid sequence with AAV3B.8…”
BackgroundInfluentialZou, P. (2022) · British Journal of Clinical Pharmacology · doi:10.1111/bcp.15597 · Cited by 6
Jakobsen, M., Askou, A. L., Stenderup, K., Rosada, C., Dagnæs‐Hansen, F., Jensen, T. G., Corydon, T. J., Mikkelsen, J. G., & Aagaard, L. (2015) · Human Gene Therapy Methods · doi:10.1089/hgtb.2014.135 · Cited by 6
Gene Therapy in Pediatric Liver Disease
Muro, A. F., D’Antiga, L., & Mingozzi, F. (2019) · Springer eBooks · doi:10.1007/978-3-319-96400-3_44 · Cited by 6
Grueso, E., Sánchez-Martı́nez, C., Calvo-López, T., de Miguel, F. J., Blanco-Menéndez, N., Fernandez-Estévez, M., Elizalde, M., Sanchez, J., Kourani, O., Martin, D. L., et al. (2019) · Journal of Virology · doi:10.1128/jvi.00798-19 · Cited by 6
Rossiaud, L., Fragner, P., Barbon, E., Gardin, A., Benabidès, M., Pellier, E., Cosette, J., Kassar, L. E., Giraud-Triboult, K., Nissan, X., et al. (2023) · Frontiers in Cell and Developmental Biology · doi:10.3389/fcell.2023.1163427 · Cited by 6
Rap1 Activation Protects Against Fatty Liver and Non-Alcoholic Steatohepatitis DevelopmentPreprint
Agarwal, H., Wang, Y., & Özcan, L. (2023) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2023.10.24.563728 · Cited by 10
“41 The resultant construct were amplified by Salk Institute Gene Transfer, Targeting, and Therapeutics Core.”
MethodDevelopment of Inorganic and Hybrid Nanosystems for Delivery of CRISPR-Based Gene Editors
Spataru, I. A., Mahoro, F., & Badea, I. (2025) · Molecular Pharmaceutics · doi:10.1021/acs.molpharmaceut.5c00251 · Cited by 6
Dai, M., Yang, N., Xu, K., Zhang, J., Li, X., Zhang, Y., & Li, W. (2023) · Cell Proliferation · doi:10.1111/cpr.13565 · Cited by 4
“Thus, our results, together with those of previous studies, 39,52 bridge the gap in our knowledge of AAV capsid engineering in animal models and clinical trials, contributing to gene and cell therapy, cell fate determination, reversing senility and regenerative medicine research.”
MethodResultSelf-citationAAV Vector-Based Gene Therapy, Progress and Current Challenges
Kuranda, K., & Mingozzi, F. (2017) · Springer eBooks · doi:10.1007/978-3-319-53457-2_5 · Cited by 5
Al-Allaf, F. A., Abduljaleel, Z., Taher, M. M., Abdellatif, A. A. H., Athar, M., Bogari, N. M., Al‐Ahdal, M. N., Al-Mohanna, F. A., Al‐Hassnan, Z. N., Alzabeedi, K. H. Y., et al. (2019) · Viruses · doi:10.3390/v11111063 · Cited by 5
“As mentioned in a previous study [27], the AAV capsid used for gene therapy significantly affects the transduction efficiency.”
BackgroundMultistage Carcinogenesis: Cell and Animal Models
Kulesz-Martin, M. F., Ouyang, X., Barling, A. N., Gallegos, J. R., Liu, Y., & Medler, T. R. (2015) · Elsevier eBooks · doi:10.1016/b978-0-12-801238-3.02218-2 · Cited by 5
Moving Forward Toward a Cure for Hemophilia B
VandenDriessche, T., & Chuah, M. (2015) · Molecular Therapy · doi:10.1038/mt.2015.56 · Cited by 5
Rajapaksha, I. G., Angus, P., & Herath, C. B. (2019) · IntechOpen eBooks · doi:10.5772/intechopen.80317 · Cited by 5
“Although the AAV vectors employed for preclinical studies may be effective in human liver, it is important to select an AAV vector specific for human hepatocytes with enhanced transduction efficiency [6, 55].”
BackgroundResultInfluentialKok, C., Alexander, I. E., Lisowski, L., & Kizana, E. (2018) · Heart Lung and Circulation · doi:10.1016/j.hlc.2018.08.014 · Cited by 5
Self-citationmGem: AAV, from almost a virus to an awesome vector—or is it?
Srivastava, A. (2026) · mBio · doi:10.1128/mbio.02957-25 · Cited by 5
Advancing Gene Therapy for Pancreatitis: From Genetic Insights to Clinical Translation
Zheng, Y.-Z., Wang, Y., Qi, H.-M., Gao, J., Li, Z., Liao, Z., & Zou, W. (2026) · Research · doi:10.34133/research.1154 · Cited by 4
“Pioneering work in liver gene therapy illustrates this potential: Humanized liver chimeras facilitated the clinical translation of AAV-LK03, an engineered vector with enhanced tropism for human hepatocytes [ 160 , 161 ].”
Hemophilia – Impact of Recent Advances on Management
Puthenveetil, G., & Nugent, D. J. (2019) · The Indian Journal of Pediatrics · doi:10.1007/s12098-019-03062-8 · Cited by 4
Liver targeting with rAAV7: balancing tropism with immune profiles
Flotte, T. R. (2021) · Gene Therapy · doi:10.1038/s41434-021-00230-4 · Cited by 4
Shao, W., Sun, J., Chen, X., Dobbins, A. L., Merricks, E. P., Samulski, R. J., Nichols, T. C., & Li, C. (2022) · Frontiers in Pharmacology · doi:10.3389/fphar.2022.815317 · Cited by 4
Adeno-associated Virus as a Mammalian DNA Vector
Salganik, M., Hirsch, M. L., & Samulski, R. J. (2015) · ASM Press eBooks · doi:10.1128/9781555819217.ch37 · Cited by 5
Ahmad, A., Mandwie, M., O’Sullivan, K. M., Smyth, C. M., York, J., Doyle, H. J., Holdsworth, S. R., Pickering, M. C., Lachmann, P. J., Alexander, I. E., et al. (2022) · Human Gene Therapy · doi:10.1089/hum.2021.264 · Cited by 3
“To this end, improvement in the utility of AAV vectors will come from the ongoing discovery of AAV capsids that more effi-ciently transduce human hepatocytes, 10–13 as well as the development of drug-inducible genetic switches for regulated transgene expression.”
Self-citationCunningham, S. C., van Dijk, E. B., Zhu, E., Sugden, M. C., Mandwie, M., Siew, S., Devanapalli, B., Tolun, A. A., Klein, A. H., Wilson, L., et al. (2023) · Human Gene Therapy · doi:10.1089/hum.2023.011 · Cited by 4
“…not only showed marked elevation of urinary orotate but also showed complete normalization of this biomarker when engrafted mice were treated using a conventional gene addition strategy with an AAV vector encoding human OTC pseudo-serotyped with the human liver tropic LK03 capsid 8 (Fig.”
Self-citationMezler, M., Jones, R. S., Sangaraju, D., Goldman, D. C., Hoffmann, M., Heikkinen, A. T., Mannila, J., Chang, J. H., Foquet, L., Pusalkar, S., et al. (2023) · Drug Metabolism and Disposition · doi:10.1124/dmd.123.001398 · Cited by 4
“…potential applications, for example in studies of human-liver infectious diseases (Dandri et al., 2001; Mercer et al., 2001; Kosaka et al., 2013; Sayed et al., 2017; Tyagi et al., 2018), the testing of gene therapy vectors (Kakuni et al., 2013; Lisowski et al., 2014) or of other therapeutic agents.”
BackgroundViral Vectors for Delivery of Antiviral Sequences
Arbuthnot, P. B. (2015) · Elsevier eBooks · doi:10.1016/b978-0-12-410518-8.00004-1 · Cited by 4
Cell and gene therapeutic approaches in non-alcoholic fatty liver disease
Poudineh, M., Mohammadyari, F., Parsamanesh, N., Jamialahmadi, T., Kesharwani, P., & Sahebkar, A. (2025) · Gene · doi:10.1016/j.gene.2025.149466 · Cited by 3
AAV for ovarian cancer gene therapy
Yoo, H. C., Lee, S.-K., Park, J. Y., & Lee, E. (2025) · Cancer Gene Therapy · doi:10.1038/s41417-025-00926-4 · Cited by 4
“As a result, AAVs have been developed that can cross the human blood-brain barrier (BBB) for CNS transduction [25], target human hepatocytes [26, 27], and transduce human cancer cells more ef fi ciently than wild-type AAV [28].”
Li, M., Zubair, A., Wdidi, S., & He, S. (2026) · Journal of Cellular and Molecular Medicine · doi:10.1111/jcmm.70986 · Cited by 4
Bedoyan, J. K., Morgan, T., Sun, A., Li, H., Gruskin, D. J., Payton, M., Chereau, F., Swenson, E. S., Lin, Q., Kay, M. A., et al. (2026) · Gene Therapy · doi:10.1038/s41434-026-00609-1 · Cited by 3
“1) [12].”
Self-citationAAV vectors for long-term gene therapy of hemophilia B: Are we there yet?
Srivastava, A. (2024) · Molecular Therapy · doi:10.1016/j.ymthe.2024.06.009 · Cited by 3
Scott, S., Westhaus, A., Nazareth, D., Cabanes‐Creus, M., Navarro, R. G., Chandra, D., Zhu, E., Venkateswaran, A., Alexander, I. E., Bauer, D. C., et al. (2024) · Molecular Therapy — Methods & Clinical Development · doi:10.1016/j.omtm.2024.101351 · Cited by 4
Self-citationZhu, L., Xu, K., Ding, Y., Liu, K., Liu, J., Hou, Z., Niu, R., Yang, N., Qin, H., Hu, B., et al. (2025) · Cell Proliferation · doi:10.1111/cpr.70127 · Cited by 3
“While current AAV capsid engineering strategies such as directed evolution [7–12, 39 ] and rational design Pre-existing NAbs against AAV capsids, prevalent in human populations, pose a major clinical barrier to systemic AAV therapy by impairing transduction efficacy, as evidenced by pre-clinical…”
Self-citationHitting the Target Without Pulling the Trigger
VandenDriessche, T., & Chuah, M. (2015) · Molecular Therapy · doi:10.1038/mt.2014.230 · Cited by 3
AAV shuffles to the liver: commentary on Lisowski et al.
Schaffer, D. V. (2014) · Molecular Therapy — Methods & Clinical Development · doi:10.1038/mtm.2014.6 · Cited by 3
Therapeutic Gene Editing in Muscles and Muscle Stem Cells
Tabebordbar, M., Cheng, J. K. W., & Wagers, A. J. (2017) · Research and perspectives in neurosciences · doi:10.1007/978-3-319-60192-2_10 · Cited by 3
“Directed evolution and in vivo selection have been used recently to engineer novel AAV capsids with high tropism for tissues that are difficult to transduce with naturally occurring AAVs, such as human hepatocytes in a xenograft liver model (Lisowski et al. 2014) and the outer retina after injection into the eye’s vit…”
BackgroundGene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders
Odiba, A. S., Okoro, N. O., Durojaye, O. A., & Wu, Y. (2021) · Open Life Sciences · doi:10.1515/biol-2021-0033 · Cited by 3
Pahelkar, A. R., Sharma, D., Vohra, P., & Sawant, S. (2024) · European Journal Of Haematology · doi:10.1111/ejh.14319 · Cited by 4
“Whole-genome sequencing (WGS) and targeted sequencing of the alpha-globin gene cluster are employed to detect deletions, point mutations, and copy number variations that contribute to the disease [37].”
Diabetes reversal via gene transfer: building on successes in animal models
Simpson, A. M., Gerace, D., & Martiniello‐Wilks, R. (2015) · Research and Reports in Endocrine Disorders · doi:10.2147/rred.s51644 · Cited by 3
Do we need marker gene studies in humans to improve clinical AAV gene therapy?
Weber, T. (2017) · Gene Therapy · doi:10.1038/gt.2016.84 · Cited by 3
Ko, H., Li, Y.-Y., Simanjuntak, Y., Yu, H.-P., Chiang, M., Lee, C.-Y., Liang, J., Lee, Y.-L., Sun, C., Wang, P.-S., et al. (2025) · Molecular Therapy · doi:10.1016/j.ymthe.2025.09.007 · Cited by 2
Exploration of the potential of genomic editing in the treatment of congenital adrenal hyperplasia
Graves, L. E., Christina, S., Mullany, K., Alexander, I. E., & Falhammar, H. (2025) · Frontiers in Endocrinology · doi:10.3389/fendo.2025.1719376 · Cited by 2
Self-citationTissue‐specific gene delivery approaches
Nasr, S. S., Cheema, Y., Stern, A., Tabah, O., Poore, S., & Duncan, G. A. (2026) · Bioengineering & Translational Medicine · doi:10.1002/btm2.70125 · Cited by 3
“180,181 AAV vectors obtained from screening in non-human primates typically yield vectors that are effective in humans 182 but broad screening of AAV in non-human primates requires significant expense.”
Mao, J., Wang, Y., Zhang, W., Shen, Y., Zhang, G., Xi, W., Wang, Q., Ruan, Z., Wang, J., & Xi, X. (2022) · Frontiers of Medicine · doi:10.1007/s11684-021-0844-7 · Cited by 2
“A similar phenomenon was also observed in previous studies [9,10,26,37].”
BackgroundMethodResultTransgene Expression in Cultured Cells Using Unpurified Recombinant Adeno-Associated Viral Vectors
Benyamini, B., Esbin, M. N., Whitney, O. N., Walther, N., & Maurer, A. C. (2023) · Journal of Visualized Experiments · doi:10.3791/65572 · Cited by 2
AAV Vector-Mediated Liver Gene Therapy and Its Implementation for Hemophilia
Mizukami, H., Mimuro, J., Ohmori, T., Sakata, Y., & Ozawa, K. (2015) · Springer eBooks · doi:10.1007/978-4-431-55666-4_6 · Cited by 3
Gene Therapy for Liver Disease
Aravalli, R. N. (2017) · Elsevier eBooks · doi:10.1016/b978-0-12-804274-8.00060-6 · Cited by 2
Development of Next-Generation Muscle Gene Therapy AAV Vectors
Nance, M. E., & Duan, D. (2019) · Springer eBooks · doi:10.1007/978-3-030-03095-7_11 · Cited by 2
Stone, D., Meumann, N., Kuhlmann, A.-S., Peterson, C. W., Xie, H. J., Roychoudhury, P., Loprieno, M. A., Vu, X., Strongin, D. E., Kenkel, E. J., et al. (2023) · Hepatology Communications · doi:10.1097/hc9.0000000000000009 · Cited by 2
Moroncini, G., Svegliati, S., Grieco, A., Cuccioloni, M., Mozzicafreddo, M., Paolini, C., Agarbati, S., Spadoni, T., Amoresano, A., Pinto, G., et al. (2023) · Arthritis & Rheumatology · doi:10.1002/art.42746 · Cited by 3
“27 AAVs gain access to speci fi c cell surface receptors after attaching to glycans or glycoconjugates on the cell membrane.”
BackgroundColón-Thillet, R., Stone, D., Loprieno, M. A., Klouser, L. M., Roychoudhury, P., Santo, T. K., Xie, H. J., Stensland, L., Upham, S. L., Pepper, G., et al. (2022) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2022.05.17.492375 · Cited by 2
The Establishment of Diseased Human Whole Organ Model by Normothermic Machine Perfusion TechniquePreprint
Tang, Y., Li, J., Zhang, T., Chen, H., Qin, M., Chen, H., Huang, J., Miao, Z., Cai, R., Yang, Y., et al. (2023) · Preprints.org · doi:10.20944/preprints202308.0967.v1 · Cited by 2
Parambathu, A. V., Kumar, V., Khanal, O., & Lenhoff, A. M. (2025) · Molecular Therapy Advances · doi:10.1016/j.omta.2025.201656 · Cited by 2
“The predicted structure for the VP2u part is an open chain, and VP1u is predicted to have structured α -helices, consistent with published predictions for AAV6 28 and other AlphaFold predictions for all the constituent natural serotypes of AAV-LK03, i.e., AAV3B, AAV2, AAV4, and AAV8 (Figure 2B).”
Epstein, B. E., Soden, G. M., Incao, A. A., Mylvara, A. V., Flynn, J. R., Ozsolak, F., & Pavan, W. J. (2026) · PLoS ONE · doi:10.1371/journal.pone.0331275 · Cited by 2
“While capsid engineering is one way to improve efficiency to a target tissue relative to other tissues [40–46], this suggests that timing with respect to developmental stage can also directly improve efficiency.”
Scott, S., Hallwirth, C. V., Sasaki, N., Cunningham, S. C., Zhu, E., Khandekar, N., Kizana, E., Baruteau, J., Gissen, P., Perocheau, D. P. B., et al. (2026) · Molecular Therapy · doi:10.1016/j.ymthe.2026.07.039 · Cited by 1
Self-citationA David promoter with Goliath strength
Markusic, D. M., & Herzog, R. W. (2014) · Blood · doi:10.1182/blood-2014-04-565507 · Cited by 1
“So far, this approach has not translated from mice to humans, but it has prompted studies on selection of capsids with superior transduction of human hepatocytes in vivo using mice with humanized livers.(3) In the meantime, research has focused mainly on these 3 approaches: (1) developing AAV vectors with stealthier c…”
MethodHentzschel, F., Herrmann, A.-K., Mueller, A., & Grimm, D. (2016) · FEBS Letters · doi:10.1002/1873-3468.12187 · Cited by 1
Gerace, D., Martiniello‐Wilks, R., & Simpson, A. M. (2016) · Stem cell biology and regenerative medicine · doi:10.1007/978-3-319-45307-1_10 · Cited by 1
Viral Vectors for Muscle Gene Therapy
Wang, D., Brown, A., & Gao, G. (2019) · Springer eBooks · doi:10.1007/978-3-030-03095-7_10 · Cited by 1
Worgall, S., & Crystal, R. G. (2020) · Elsevier eBooks · doi:10.1016/b978-0-12-818422-6.00029-0 · Cited by 1
Viral vectors for gene therapy
Tsai, A., Suzuki‐Hatano, S., & Pacak, C. A. (2024) · Elsevier eBooks · doi:10.1016/b978-0-12-818619-0.00019-8 · Cited by 2
Lengler, J., Weiller, M., Horling, F., Mayrhofer, J., Schuster, M., Falkner, F. G., Gil-Fariña, I., Klugmann, M., Scheiflinger, F., Hoellriegl, W., et al. (2025) · Molecular Therapy — Methods & Clinical Development · doi:10.1016/j.omtm.2025.101424 · Cited by 1
“35 This correlation factor needs to be considered when it comes to the deduction of a clinical starting dose from the nonclinical data package.”
Metadata
- Authors
- Lisowski, L., Dane, A. P., Chu, K., Zhang, Y., Cunningham, S. C., Wilson, E. M., Nygaard, S., Grompe, M., Alexander, I. E., & Kay, M. A.
- Affiliations
- Salk Institute for Biological Studies (US)
- Stanford Medicine (US)
- Children's Medical Research Institute (AU)
- Yecuris (United States) (US)
- Oregon Health & Science University (US)
- The University of Sydney (AU)
- Corresponding author
- Kay, Mark A.
- ORCID
- Venue
- Nature
- Published
- 2013-12-25
- Volume
- 506
- Issue
- 7488
- Pages
- 382-386
- ISSN
- 0028-0836 (ISSN-L)
- 1476-4687
- PMC
- PMC3939040
- OpenAlex
- W1981950767
- Cited by
- 450
- References
- 36
- Citations by year
- 2026: 20 · 2025: 28 · 2024: 36 · 2023: 39 · 2022: 45 · 2021: 34 · 2020: 42 · 2019: 36 · 2018: 32 · 2017: 41 · 2016: 35 · 2015: 46 · 2014: 14 · 2013: 1
- FWCI
- 21.18
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Licence
- www.springer.com/tdm (tdm)
- Locations
- Nature (publishedVersion)
- PubMed (publishedVersion)
- Europe PMC (PubMed Central) (acceptedVersion)
- PubMed Central (acceptedVersion)
- RePEc: Research Papers in Economics (submittedVersion)
- Funders
- National Heart, Lung, and Blood Institute (HL064274, HL092096, R01HL092096, R01HL064274)
- National Institute of Diabetes and Digestive and Kidney Diseases (R01DK048252, DK048252)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Virus-based gene therapy research
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › RNA Interference and Gene Delivery
- Life Sciences › Neuroscience › Neurology › Barrier Structure and Function Studies
- Keywords
- recombinant adeno-associated virus, AAV serotype 2, xenotransplantation, DNA shuffling, gene therapy vectors
- MeSH terms
- Dependovirus, Animals, Capsid, Cells, Cultured, Chimera, Clinical Trials as Topic, Disease Models, Animal, Female, Genetic Vectors, Carcinoma, Hepatocellular, Humans, Liver, Male, Species Specificity, Transduction, Genetic, Genetic Therapy, Transgenes, Hepatocytes, Capsid Proteins, Cell Line, Tumor, Mice, Heterografts
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
