Structural mechanism of mRNA decoding by mammalian GTPase GTPBP1
Open accessPublished version of a preprint
Abstract
GTP-binding protein 1 (GTPBP1) is a widespread translational GTPase closely related to elongation factor eEF1A. The loss of GTPBP1 leads to errors in neuronal development in animals and is associated with neurodegenerative disorders in humans. Although linked to translation and quality control mechanisms, GTPBP1 functions remain largely obscure. Similarly to eEF1A, GTPBP1 delivers cognate aminoacyl-tRNA to the ribosomal A site in a GTP-dependent manner, but GTP hydrolysis is not followed by rapid peptide bond formation, and GTPBP1-mediated elongation is slow. To establish the basis for GTPBP1 function, we determined cryo-EM structures of 80S ribosomal complexes bound to GTPBP1•aa-tRNA with GTP or the non-hydrolysable analog GDPCP. They revealed that the unique GTPBP1 architecture, including the additional eIF1/IF3-like N-terminal domain and the shoulder-interacting H-loop in place of the α2 helix of canonical GTPases, is responsible for establishing GTPBP1-specific interactions with tRNA and the ribosome, leading to slow GTPBP1 dissociation after GTP hydrolysis and thus delayed tRNA accommodation. Slow dissociation correlates with an extended proofreading stage resulting in higher accuracy of GTPBP1-mediated decoding and potentially allows GTPBP1 to elicit its putative quality control functions. GTPBP1 visualization provides the foundation for mapping and elucidating GTPBP1 mutations associated with human diseases.
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Cites
van der Togt, H. (2003) · Journal of Network and Computer Applications · doi:10.1016/s1084-8045(02)00061-9 · Cited by 302,548
Basic local alignment search tool
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990) · Journal of Molecular Biology · doi:10.1006/jmbi.1990.9999 · Cited by 98,669 · see citing works
MUSCLE: multiple sequence alignment with high accuracy and high throughput
Edgar, R. C. (2004) · Nucleic Acids Research · doi:10.1093/nar/gkh340 · Cited by 44,662 · see citing works
Highly accurate protein structure prediction with AlphaFold
Jumper, J., Evans, R., Pritzel, A., Green, T., Figurnov, M., Ronneberger, O., Tunyasuvunakool, K., Bates, R., Žídek, A., Potapenko, A., et al. (2021) · Nature · doi:10.1038/s41586-021-03819-2 · Cited by 43,764 · see citing works
Touw, W. G., & Vriend, G. (n.d.) · doi:10.1107/s09074449 · Cited by 18,392
MotionCor2 - anisotropic correction of beam-induced motion for improved cryo-electron microscopy
Zheng, S., Palovcak, E. J., Armache, J., Verba, K., Cheng, Y.-F., & Agard, D. (2017) · Nature Methods · doi:10.1038/nmeth.4193 · Cited by 7,678 · see citing works
UniProt: the Universal Protein Knowledgebase in 2023
The UniProt Consortium, Bateman, A., Martin, M.-J., Orchard, S., Magrane, M., Ahmad, S., Alpi, E., Bowler-Barnett, E. H., Britto, R., Bye-A-Jee, H., et al. (2023) · Nucleic Acids Research · doi:10.1093/nar/gkac1052 · Cited by 7,210 · cited 1× · see citing works
“GTPBP2 sequences wereretrieved from Uniprot 109 using “ [the species names from the GTPBP1 sequences list] AND GTPBP2 ” as a query, which yielded 15 GTPBP2 sequences.”
Liebschner, D. C., Afonine, P. V., Baker, M. L., Bunkòczi, G., Chen, V. B., Croll, T. I., Hintze, B. J., Hung, L., Jain, S., McCoy, A. J., et al. (2019) · Acta Crystallographica Section D Structural Biology · doi:10.1107/s2059798319011471 · Cited by 6,709 · see citing works
Computer visualization of three-dimensional image data using IMOD.
Kremer, J. R., Mastronarde, D., & Mcintosh, J. (1996) · Journal of Structural Biology · doi:10.1006/jsbi.1996.0013 · Cited by 5,770 · see citing works
RELION: Implementation of a Bayesian approach to cryo-EM structure determination
Scheres, S. H. W. (2012) · Journal of Structural Biology · doi:10.1016/j.jsb.2012.09.006 · Cited by 5,446 · see citing works
Automated electron microscope tomography using robust prediction of specimen movements.
Mastronarde, D. (2005) · Journal of Structural Biology · doi:10.1016/j.jsb.2005.07.007 · Cited by 5,446 · see citing works
UCSF ChimeraX : Tools for structure building and analysis
Meng, E. C., Goddard, T. D., Pettersen, E. F., Couch, G. S., Pearson, Z., Morris, J. H., & Ferrin, T. E. (2023) · Protein Science · doi:10.1002/pro.4792 · Cited by 4,575 · cited 5× · see citing works
“The structures were assembled in ChimeraX 105 , modelled and re fi ned in Isolde 106 , followed by B-factor and global minimization re fi ne-ments in Phenix 107 .”
InfluentialVaradi, M., Bertoni, D., Magana, P., Paramval, U., Pidruchna, I., Radhakrishnan, M., Tsenkov, M., Nair, S., Mirdita, M., Yeo, J., et al. (2024) · Nucleic Acids Research · doi:10.1093/nar/gkad1011 · Cited by 2,052 · cited 4× · see citing works
“AlphaFold 103 model of the human GTPBP1 protein (AF-O00178-F1-model_v4 104 ) was used as a starting model for GTPBP1.”
InfluentialCroll, T. (2018) · Acta Crystallographica Section D: Structural Biology · doi:10.1107/s2059798318002425 · Cited by 1,934 · see citing works
The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024
Madeira, F., Madhusoodanan, N., Lee, J., Eusebi, A., Niewielska, A., Tivey, A., Lopez, R., & Butcher, S. (2024) · Nucleic Acids Research · doi:10.1093/nar/gkae241 · Cited by 1,666 · cited 1× · see citing works
“GTPBP1 and GTPBP1/ 2 sequence sets were aligned using MUSCLE 110 at the EMBL-EBI server 111 , and the alignments were visualized in Jalview 2.11.3.3 112 .”
InfluentialHopfield, J. J. (1974) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.71.10.4135 · Cited by 1,594 · cited 1× · see citing works
“The high fi delity of mRNA decoding is ensured by kinetic proof-reading, a key multi-step discriminatory process of aa-tRNA delivery 51 – 53 .”
SPHIRE-crYOLO is a fast and accurate fully automated particle picker for cryo-EM
Wagner, T., Merino, F., Stabrin, M., Moriya, T., Antoni, C., Apelbaum, A., Hagel, P., Sitsel, O., Raisch, T., Prumbaum, D., et al. (2019) · Communications Biology · doi:10.1038/s42003-019-0437-z · Cited by 1,217 · see citing works
Classification and evolution of P-loop GTPases and related ATPases
Leipe, D. D., Wolf, Y. I., Koonin, E. V., & Aravind, L. (2002) · Journal of Molecular Biology · doi:10.1006/jmbi.2001.5378 · Cited by 1,148 · cited 1× · see citing works
“The base of GDPCP interacts with the guanine recognition motif [NT]KxD (where x is any amino acid), which in GTPBP1 is represented by 308 TKID 311 , in contrast to most other translational GTPases featuring NKxD 38 .”
Rational design and characterization of a Rac GTPase-specific small molecule inhibitor
Gao, Y., Dickerson, J. B., Guo, F., Zheng, J., & Zheng, Y. (2004) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0307512101 · Cited by 1,091 · see citing works
New tools for automated cryo-EM single-particle analysis in RELION-4.0
Kimanius, D., Dong, L., Sharov, G., Nakane, T., & Scheres, S. (2021) · bioRxiv · doi:10.1101/2021.09.30.462538 · Cited by 941
cisTEM: User-friendly software for single-particle image processing
Grant, T., Rohou, A., & Grigorieff, N. (2017) · bioRxiv · doi:10.1101/257618 · Cited by 735
DALI and the persistence of protein shape
Holm, L. (2019) · Protein Science · doi:10.1002/pro.3749 · Cited by 664 · see citing works
Wang, M., Herrmann, C. J., Simonovic, M., Szklarczyk, D., & von Mering, C. (2015) · Proteomics · doi:10.1002/pmic.201400441 · Cited by 543 · cited 1× · see citing works
“GTPBP1 is unlikely to compete with thelarge excess of eEF1A (~100x accordingto PaxDb 67,68 ) under normal growth conditions, but its elongation function may become more signi fi cant under stress or other conditions that impair eEF1A activity, such as eEF1A phosphorylation at Ser300, which inhibits…”
Pestova, T., Hellen, C., & Shatsky, I. (1996) · Molecular and Cellular Biology · doi:10.1128/mcb.16.12.6859 · Cited by 535 · cited 1× · see citing works
“Vectors for bacterial expression of His 6 -tagged eIF1, eIF1A 81 , eIF4A, eIF4B 82 , eIF4G 736-1600 and eIF4G 736-1115 83 , eIF5 84 , Escherichia coli methionyl-tRNA synthetase 85 and GTPBP1 19 DNA): GGCAACAACAACAACACTTGCTTTTGACACAACTGTGTTTACT TGCAATCCCCCAAAACAGACAGAATGTCCCACCTTTAATGTGTGGAG…”
Self-citationAL2CO: calculation of positional conservation in a protein sequence alignment
Pei, J.-M., & Grishin, N. (2001) · Bioinform. · doi:10.1093/bioinformatics/17.8.700 · Cited by 518 · cited 2× · see citing works
“E Coloring GTPBP1 according to sequence conservation 113 (sequence alignment is shown in Supplementary Fig.”
Horowitz, A. (2004) · doi:10.1007/3-540-29835-5_2259 · Cited by 460 · cited 1×
“…Dgp-1 is upregulated in response to over-expression of the endoplasmic reticulum (ER) stress-induced dPERK kinase 23 , and loss-of-function alleles of Drosophila Dgp-1 reduce the viability of Parkin null mutants de fi cient in Parkin E3 ubiquitin ligase that targets proteins for degradation 24 .”
Ribosome stalling induced by mutation of a CNS-specific tRNA causes neurodegeneration
Ishimura, R., Nagy, G., Dotu, I., Zhou, H., Yang, X.-L., Schimmel, P., Senju, S., Nishimura, Y., Chuang, J. H., & Ackerman, S. L. (2014) · Science · doi:10.1126/science.1249749 · Cited by 455 · see citing works
Eukaryotic ribosomes require initiation factors 1 and 1A to locate initiation codons
Pestova, T., Borukhov, S., & Hellen, C. (1998) · Nature · doi:10.1038/29703 · Cited by 450 · see citing works
Self-citationThe joining of ribosomal subunits in eukaryotes requires eIF5B
Pestova, T., Lomakin, I., Lee, J.-H., Choi, S. K., Dever, T., & Hellen, C. (2000) · Nature · doi:10.1038/35002118 · Cited by 433 · cited 1× · see citing works
“Vectors for bacterial expression of His 6 -tagged eIF1, eIF1A 81 , eIF4A, eIF4B 82 , eIF4G 736-1600 and eIF4G 736-1115 83 , eIF5 84 , Escherichia coli methionyl-tRNA synthetase 85 and GTPBP1 19 DNA): GGCAACAACAACAACACTTGCTTTTGACACAACTGTGTTTACT TGCAATCCCCCAAAACAGACAGAATGTCCCACCTTTAATGTGTGGAG…”
Self-citationFidelity at the Molecular Level: Lessons from Protein Synthesis
Zaher, H. S., & Green, R. (2009) · Cell · doi:10.1016/j.cell.2009.01.036 · Cited by 381 · cited 3× · see citing works
“The high fi delity of mRNA decoding is ensured by kinetic proof-reading, a key multi-step discriminatory process of aa-tRNA delivery 51 – 53 .”
Kinetic determinants of high-fidelity tRNA discrimination on the ribosome.
Gromadski, K. B., & Rodnina, M. (2004) · Molecules and Cells · doi:10.1016/s1097-2765(04)00005-x · Cited by 377 · cited 2× · see citing works
“…elongation, the initial thermodynamic selection of the cognate EF • aa-tRNA • GTP complex on the ribosome is followed by the irreversible step of GTP hydrolysis on the EF in complexes with cognate and, less effectively, with near-cognate tRNAs (i.e., with a mismatched anticodon nucleotide) 34,55 .”
The Mechanism for Activation of GTP Hydrolysis on the Ribosome
Voorhees, R. M., Schmeing, T. M., Kelley, A. C., & Ramakrishnan, V. (2010) · Science · doi:10.1126/science.1194460 · Cited by 366 · cited 1× · see citing works
“To visualize the dynamics of GTPBP1 on the ribosome prior to GTP hydrolysis, we took advantage of the non-hydrolysable GTP analog GDPCP (5 ′ -guanosyl- β , γ -methy- lene-triphosphate), which had allowed visualization of other translational GTPases on the ribosome 28 – 30 .”
Induced fit in initial selection and proofreading of aminoacyl‐tRNA on the ribosome
Pape, T., Wintermeyer, W., & Rodnina, M. (1999) · EMBO Journal · doi:10.1093/emboj/18.13.3800 · Cited by 341 · cited 1× · see citing works
“By contrast, elevated Mg 2+ concentrations, which stabilize ribosome-tRNA interactions, decrease the fi delity of mRNA decoding 58,61 .”
Role of Na+ and K+ in enzyme function.
Page, M. J., & Cera, E. D. (2006) · Physiological Reviews · doi:10.1152/physrev.00008.2006 · Cited by 319 · cited 1× · see citing works
“This suggests a possibility of the regulation of the NTD association through cation binding 65 .”
CheckMyMetal: a macromolecular metal-binding validation tool
Zheng, H.-P., Cooper, D., Porebski, P., Shabalin, I., Handing, K., & Minor, W. (2017) · Acta Crystallographica Section D: Structural Biology · doi:10.1107/s2059798317001061 · Cited by 290 · cited 1× · see citing works
“Given the characteristic coordination distances of ~2.8 Å and an octahedral coordination pattern 39 – 41 , the density likely corresponds to a potassium ion (Fig.”
InfluentialLikelihood-based classification of cryo-EM images using FREALIGN
Lyumkis, D., Brilot, A., Theobald, D., & Grigorieff, N. (2013) · Journal of Structural Biology · doi:10.1016/j.jsb.2013.07.005 · Cited by 290 · cited 3× · see citing works
“The shiny stacks were exported to Frealign 9.11 98,99 and subjected to 3D classi fi cations without alignments with a 3D mask around GTPBP1.”
InfluentialPestova, T., & Hellen, C. (2003) · Genes & Development · doi:10.1101/gad.1040803 · Cited by 253 · cited 1× · see citing works
“88,89.”
Self-citationDecoding Mammalian Ribosome-mRNA States by Translational GTPase Complexes
Shao, S., Murray, J., Brown, A., Taunton, J., Ramakrishnan, V., & Hegde, R. S. (2016) · Cell · doi:10.1016/j.cell.2016.10.046 · Cited by 239 · cited 10× · see citing works
“The catalytic His256, conserved in translational GTPases (His95 in eEF1A and His300 in eRF3) and required for GTP hydrolysis 28,34 , is placed at the backbone phosphate of A4607 (A2662 in E. coli ) of the SRL (Fig.”
InfluentialLomakin, I. B., Hellen, C. U. T., & Pestova, T. V. (2000) · Molecular and Cellular Biology · doi:10.1128/mcb.20.16.6019-6029.2000 · Cited by 194 · cited 1× · see citing works
“Vectors for bacterial expression of His 6 -tagged eIF1, eIF1A 81 , eIF4A, eIF4B 82 , eIF4G 736-1600 and eIF4G 736-1115 83 , eIF5 84 , Escherichia coli methionyl-tRNA synthetase 85 and GTPBP1 19 DNA): GGCAACAACAACAACACTTGCTTTTGACACAACTGTGTTTACT TGCAATCCCCCAAAACAGACAGAATGTCCCACCTTTAATGTGTGGAG…”
Self-citationEnsemble cryo-EM elucidates the mechanism of translation fidelity
Loveland, A. B., Demo, G., Grigorieff, N., & Korostelev, A. A. (2017) · Nature · doi:10.1038/nature22397 · Cited by 190 · cited 6× · see citing works
“4j) 29 .”
InfluentialSelf-citationDrugging Ras GTPase: a comprehensive mechanistic and signaling structural view
Lu, S., Jang, H., Gu, S., Zhang, J., & Nussinov, R. (2016) · Chemical Society Reviews · doi:10.1039/c5cs00911a · Cited by 188 · cited 12× · see citing works
“Like all other translational GTPases, GTPBP1/GTPBP2 contain three conserved domains — a GTPase (G) domain and two β -barrel domains — but they also have long N-terminal and C-terminal extensions that are the most divergent elements in theseproteins 1 – 4 .”
InfluentialRozov, A., Khusainov, I., El Omari, K., Duman, R., Mykhaylyk, V., Yusupov, M., Westhof, E., Wagner, A., & Yusupova, G. (2019) · Nature Communications · doi:10.1038/s41467-019-10409-4 · Cited by 179 · cited 1× · see citing works
“4c, f) 40 .”
Visualization of translation and protein biogenesis at the ER membrane
Gemmer, M., Chaillet, M. L., van Loenhout, J., Arenas, R. C., Vismpas, D., Gröllers‐Mulderij, M., Koh, F., Albanese, P., Scheltema, R. A., Howes, S. C., et al. (2023) · Nature · doi:10.1038/s41586-022-05638-5 · Cited by 176 · cited 1× · see citing works
“Similarly, GTPBP1 is not compatible with the recently observed extended conformation of eEF1A bound to the fully accommodated aa-tRNA 35 , closelyresembling a GDP-bound eEF1A 43 .”
Ribosome-associated quality-control mechanisms from bacteria to humans
Filbeck, S., Cerullo, F., Pfeffer, S., & Joazeiro, C. A. P. (2022) · Molecular Cell · doi:10.1016/j.molcel.2022.03.038 · Cited by 175 · cited 1× · see citing works
“…the ribosome (small subunit cyan; large subunit yellow) and aa-tRNA (green) during initial selection and proofreading. unclaimed (e.g., “ rare ” ) codon to prevent the formation of ribosomes with a vacant A site that may induce ribosome disassembly 72,73 and/or the integrated stress response 14 .”
The functional organization of axonal mRNA transport and translation
Costa, I. D., Buchanan, C. N., Zdradzinski, M. D., Sahoo, P. K., Smith, T. P., Thames, E., Kar, A. N., & Twiss, J. (2020) · Nature Reviews Neuroscience · doi:10.1038/s41583-020-00407-7 · Cited by 156 · cited 1× · see citing works
“GTPBP1-bound ribosomes might also correspond to a temporary stalling state, e.g., to enable the dendritic transport of polysomes, in keeping with their stalled or slowed translation 74,75 .”
Biou, V., Shu, F., & Ramakrishnan, V. (1995) · EMBO Journal · doi:10.1002/j.1460-2075.1995.tb00077.x · Cited by 152 · see citing works
Structure and interactions of the translation initiation factor eIF1
Fletcher, C., Pestova, T., Hellen, C., & Wagner, G. (1999) · EMBO Journal · doi:10.1093/emboj/18.9.2631 · Cited by 150 · cited 2× · see citing works
“Despite the lack of sequence similarity, this domain structurally resembles archaeal/eukaryotic initiation factors e/aIF1 and the C-terminal domain of bacterial initiation factor IF3 31,32 , according to the DALI fold comparisons 33 .”
Self-citationAssembly and analysis of eukaryotic translation initiation complexes.
Pisarev, A., Unbehaun, A., Hellen, C., & Pestova, T. (2007) · Methods in Enzymology · doi:10.1016/s0076-6879(07)30007-4 · Cited by 141 · cited 3× · see citing works
“…RNA polymerase(ThermoScienti fi c) and puri fi ed by FPLC using a Superdex 75 Increase 10/300 GL column. tRNA Phe -GAA and tRNA Ser -AGA were aminoacylated using puri fi ed native aminoacyl-tRNA synthetases 88 , whiletRNA i Met wasaminoacylated using recombinant E. coli methionyl-tRNA synthetase 85 .”
Self-citationStructures of translationally inactive mammalian ribosomes
Brown, A., Baird, M. R., Yip, M.-C.-J., Murray, J., & Shao, S. (2018) · eLife · doi:10.7554/elife.40486 · Cited by 138 · see citing works
PaxDb 5.0: Curated Protein Quantification Data Suggests Adaptive Proteome Changes in Yeasts
Huang, Q. D., Szklarczyk, D., Wang, M., Simonovic, M., & von Mering, C. (2023) · Molecular & Cellular Proteomics · doi:10.1016/j.mcpro.2023.100640 · Cited by 132 · cited 2× · see citing works
“GTPBP1 is unlikely to compete with thelarge excess of eEF1A (~100x accordingto PaxDb 67,68 ) under normal growth conditions, but its elongation function may become more signi fi cant under stress or other conditions that impair eEF1A activity, such as eEF1A phosphorylation at Ser300, which inhibits…”
The fidelity of translation initiation: reciprocal activities of eIF1, IF3 and YciH
Lomakin, I., Shirokikh, N. E., Yusupov, M., Hellen, C., & Pestova, T. (2006) · EMBO Journal · doi:10.1038/sj.emboj.7600904 · Cited by 126 · cited 2× · see citing works
“…RNA polymerase(ThermoScienti fi c) and puri fi ed by FPLC using a Superdex 75 Increase 10/300 GL column. tRNA Phe -GAA and tRNA Ser -AGA were aminoacylated using puri fi ed native aminoacyl-tRNA synthetases 88 , whiletRNA i Met wasaminoacylated using recombinant E. coli methionyl-tRNA synthetase 85 .”
Self-citationCryo-EM of elongating ribosome with EF-Tu•GTP elucidates tRNA proofreading
Loveland, A. B., Demo, G., & Korostelev, A. A. (2020) · Nature · doi:10.1038/s41586-020-2447-x · Cited by 124 · see citing works
Self-citationTuning the affinity of aminoacyl-tRNA to elongation factor Tu for optimal decoding
Schrader, J. M., Chapman, S. J., & Uhlenbeck, O. C. (2011) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1102128108 · Cited by 109 · cited 2× · see citing works
“Likewise, slowing the dissociation of EF-Tu • GDP from aa-tRNA linearly slows the accommodation of tRNA and peptide bond formation 60 , resulting in increased proofreading 58 .”
Thompson, R. C., & Karim, A. M. (1982) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.79.16.4922 · Cited by 102 · see citing works
mRNA decoding in human is kinetically and structurally distinct from bacteria
Holm, M., Natchiar, S. K., Rundlet, E. J., Myasnikov, A. G., Watson, Z. L., Altman, R. B., Wang, H., Taunton, J., & Blanchard, S. C. (2023) · Nature · doi:10.1038/s41586-023-05908-w · Cited by 101 · cited 10× · see citing works
“The catalytic His256, conserved in translational GTPases (His95 in eEF1A and His300 in eRF3) and required for GTP hydrolysis 28,34 , is placed at the backbone phosphate of A4607 (A2662 in E. coli ) of the SRL (Fig.”
InfluentialtRNA Translocation by the Eukaryotic 80S Ribosome and the Impact of GTP Hydrolysis
Flis, J., Holm, M., Rundlet, E. J., Loerke, J., Hilal, T., Dabrowski, M., Bürger, J., Mielke, T., Blanchard, S. C., Spahn, C. M. T., et al. (2018) · Cell Reports · doi:10.1016/j.celrep.2018.11.040 · Cited by 95 · cited 1× · see citing works
“GTPase activation (Structure III) appears to require the additional slight ( 1°) forward rotation of the small ribosomal subunit, which is substantially smaller than the ~8° rotation observed during tRNA-mRNA translocation 64 .”
Time-resolved cryo-EM visualizes ribosomal translocation with EF-G and GTP
Carbone, C. E., Loveland, A. B., Gamper, H., Hou, Y., Demo, G., & Korostelev, A. A. (2021) · Nature Communications · doi:10.1038/s41467-021-27415-0 · Cited by 94 · cited 2× · see citing works
“By contrast, time-resolved cryo-EM showed rapid depletion of ribosome-bound EF-Tu or EF-G over time 36,37 .”
Self-citationIdentification of Genes That Promote or Inhibit Olfactory Memory Formation in Drosophila
Walkinshaw, E., Gai, Y., Farkas, C., Richter, D., Nicholas, E. P., Keleman, K., & Davis, R. L. (2015) · Genetics · doi:10.1534/genetics.114.173575 · Cited by 83 · see citing works
Dreher, T., Uhlenbeck, O., & Browning, K. (1999) · Journal of Biological Chemistry · doi:10.1074/jbc.274.2.666 · Cited by 82 · cited 1×
“By contrast, eEF1A • GTP strongly prefers aa-tRNA (~1 – 5nM) over deacylated tRNA (up to 10 µ M) 42 .”
Multiple mechanisms of reinitiation on bicistronic calicivirus mRNAs
Zinoviev, A., Hellen, C., & Pestova, T. (2015) · Molecules and Cells · doi:10.1016/j.molcel.2015.01.039 · Cited by 74 · cited 1×
“Transcription vectors for tRNA Phe -GAA 19 , tRNA Ser -AGA 86 , and tRNA i Met87 have been described.”
Self-citationMechanisms of Translation-coupled Quality Control
Inada, T., & Beckmann, R. (2024) · Journal of Molecular Biology · doi:10.1016/j.jmb.2024.168496 · Cited by 72 · cited 1× · see citing works
“…the ribosome (small subunit cyan; large subunit yellow) and aa-tRNA (green) during initial selection and proofreading. unclaimed (e.g., “ rare ” ) codon to prevent the formation of ribosomes with a vacant A site that may induce ribosome disassembly 72,73 and/or the integrated stress response 14 .”
Gruenewald, C., Botella, J. A., Bayersdorfer, F., Navarro, J. A., & Schneuwly, S. (2009) · Free Radical Biology & Medicine · doi:10.1016/j.freeradbiomed.2009.03.025 · Cited by 67 · cited 1× · see citing works
“In Drosophila , Dgp-1 is upregulated in response to stresses, including oxidative stress 5 , thermal stress 21 , and hyperoxia 22 .”
Pestova, T., & Hellen, C. (2001) · RNA: A publication of the RNA Society · doi:10.1017/s135583820101038x · Cited by 66
Self-citationCrépin, T., Shalak, V., Yaremchuk, A., Vlasenko, D., McCarthy, A., Negrutskii, B., Tukalo, M. A., & El'skaya, A. (2014) · Nucleic Acids Research · doi:10.1093/nar/gku974 · Cited by 60 · cited 3×
“Furthermore, the acceptorstem of tRNA atpairs1:72 and 2:71 is held by a short loop-helix structure (aa 199 – 205) of the switch 1 region, which must rearrange upon GTP hydrolysis to release a translational GTPase from the ribosome 43 .”
The Structural Dynamics of Translation
Korostelev, A. A. (2022) · Annual Review of Biochemistry · doi:10.1146/annurev-biochem-071921-122857 · Cited by 60 · see citing works
Self-citationDeterminants of the rate of mRNA translocation in bacterial protein synthesis.
Borg, A., & Ehrenberg, M. (2015) · Journal of Molecular Biology · doi:10.1016/j.jmb.2014.10.027 · Cited by 59 · cited 1× · see citing works
“5B, lanes 6,7,11, and 12), likely due to the inhibition of eEF2-dependent translocation 63 .”
Mitotic Modulation of Translation Elongation Factor 1 Leads to Hindered tRNA Delivery to Ribosomes*
Sivan, G., Aviner, R., & Elroy-Stein, O. (2011) · Journal of Biological Chemistry · doi:10.1074/jbc.m111.255810 · Cited by 59 · cited 1× · see citing works
“…but its elongation function may become more signi fi cant under stress or other conditions that impair eEF1A activity, such as eEF1A phosphorylation at Ser300, which inhibits binding of eEF1A to aa-tRNA 69 , or phosphorylation of eEF1B δ at Ser133, which slows nucleotide exchange on eEF1A 70 .”
Phosphorylation of eEF1A1 at Ser300 by TβR-I results in inhibition of mRNA translation.
Lin, K., Yakymovych, I., Jia, M., Yakymovych, M., & Souchelnytskyi, S. (2010) · Current Biology · doi:10.1016/j.cub.2010.08.017 · Cited by 59 · cited 1× · see citing works
“…but its elongation function may become more signi fi cant under stress or other conditions that impair eEF1A activity, such as eEF1A phosphorylation at Ser300, which inhibits binding of eEF1A to aa-tRNA 69 , or phosphorylation of eEF1B δ at Ser133, which slows nucleotide exchange on eEF1A 70 .”
Accuracy of initial codon selection by aminoacyl-tRNAs on the mRNA-programmed bacterial ribosome
Zhang, J., Ieong, K.-W., Johansson, M., & Ehrenberg, M. (2015) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1506823112 · Cited by 58 · cited 1× · see citing works
“Indeed, near-cognate tRNA was shown to dissociate either alone during accommodation 36,55,56 or together with EF • GDP 55,57,58 .”
Two proofreading steps amplify the accuracy of genetic code translation
Ieong, K.-W., Uzun, Ü., Selmer, M., & Ehrenberg, M. (2016) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1610917113 · Cited by 57 · cited 4× · see citing works
“By contrast, elevated Mg 2+ concentrations, which stabilize ribosome-tRNA interactions, decrease the fi delity of mRNA decoding 58,61 .”
InfluentialJaberi, E., Rohani, M., Shahidi, G., Nafissi, S., Arefian, E., Soleimani, M., Rasooli, P., Ahmadieh, H., Daftarian, N., KaramiNejadRanjbar, M., et al. (2016) · Neurobiology of Aging · doi:10.1016/j.neurobiolaging.2015.10.034 · Cited by 55 · see citing works
Decoding and Recoding of mRNA Sequences by the Ribosome
Rodnina, M. V. (2023) · Annual Review of Biophysics · doi:10.1146/annurev-biophys-101922-072452 · Cited by 54 · see citing works
Morse, J. C., Girodat, D. J., Burnett, B. J., Holm, M., Altman, R. B., Sanbonmatsu, K. Y., Wieden, H., & Blanchard, S. C. (2020) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1904469117 · Cited by 52 · cited 1× · see citing works
“36,58 – 60,66, the delayed EF dissociation appears to underlie the moreprecise aa-tRNA deliveryby GTPBP1than by eEF1A(Figs.5and6).”
Atkinson, G. (2015) · BMC Genomics · doi:10.1186/s12864-015-1289-7 · Cited by 51 · cited 3× · see citing works
“For GTPBP1 sequence alignments, we used a set of sequences identi-fi ed previously to include a broad range of organisms 1 .”
Dou, T., Lian, T., Shu, S., He, Y., & Jiang, J. (2023) · Nature Structural & Molecular Biology · doi:10.1038/s41594-023-01123-3 · Cited by 44
Molecular insights into the interaction of the ribosomal stalk protein with elongation factor 1α
Ito, K., Honda, T., Suzuki, T., Miyoshi, T., Murakami, R., Yao, M., & Uchiumi, T. (2014) · Nucleic Acids Research · doi:10.1093/nar/gku1248 · Cited by 42 · cited 1×
“4E), and similar rearrangements were implicated from the comparison of GTP-and GDP-bound isolated structures of eEF1A 36,43,46,47 and eRF3 48 .”
GTPBP1 resolves paused ribosomes to maintain neuronal homeostasis
Terrey, M., Adamson, S. I., Gibson, A. L., Deng, T. Z., Ishimura, R., Chuang, J. H., & Ackerman, S. (2020) · bioRxiv · doi:10.1101/2020.09.03.281675 · Cited by 41 · cited 9×
“The loss of either GTPBP1 or GTPBP2 causes neurodegeneration and/or neurodevelopmental disorders in humans 8 – 12 and in mice that are de fi cient in the main central nervous system (CNS) Arg-tRNA isodecoder 13,14 .”
InfluentialElongation factor Tu can reduce translation errors in poly(U)-directed cell-free systems
Gavrilova, L. P., Perminova, I. N., & Spirin, A. S. (1981) · Journal of Molecular Biology · doi:10.1016/0022-2836(81)90260-6 · Cited by 40 · see citing works
Fislage, M., Zhang, J., Brown, Z. P., Mandava, C. S., Sanyal, S., Ehrenberg, M., & Frank, J. (2018) · Nucleic Acids Research · doi:10.1093/nar/gky346 · Cited by 38 · cited 1×
“This range of movement is also observed inbacterial ribosomes with EF-Tu, albeit the overall shoulder movement in the 80S ribosome is less pronounced 29,45 .”
Juette, M. F., Carelli, J. D., Rundlet, E. J., Brown, A., Shao, S., Ferguson, A., Wasserman, M. R., Holm, M., Taunton, J., & Blanchard, S. C. (2022) · eLife · doi:10.7554/elife.81608 · Cited by 33 · cited 3× · see citing works
“Antibiotics kirromycin (for EF-Tu 44 ), and didem-ninB,plitidepsinandternatin-4(foreEF1A 28,34,49 )traptheseGTPaseson the ribosome in the GDP-bound state by binding at the interface between the G domain and second β -barrel, blocking the protein interdomain rearrangements 28,44 .”
Telonis‐Scott, M., van Heerwaarden, B., Johnson, T. K., Hoffmann, A. A., & Sgrò, C. M. (2013) · Genetics · doi:10.1534/genetics.113.156224 · Cited by 31 · cited 1× · see citing works
“In Drosophila , Dgp-1 is upregulated in response to stresses, including oxidative stress 5 , thermal stress 21 , and hyperoxia 22 .”
Boeger, H. (2022) · Annual Review of Biochemistry · doi:10.1146/annurev-biochem-040320-103630 · Cited by 31 · cited 1× · see citing works
“In kinetic proofreading, two selection steps are separated by an irreversible step that strongly increases the speci fi city of selection compared to that achieved by just the thermodynamic ( i.e ., free energy) differences between cognate and near-cognate substrates 54 .”
Immunocytochemical Analyses and Targeted Gene Disruption of GTPBP1
Senju, S., Iyama, K., Kudo, H., Aizawa, S., & Nishimura, Y. (2000) · Molecular and Cellular Biology · doi:10.1128/mcb.20.17.6195-6200.2000 · Cited by 29
Deflating the RNA Mg <sup>2+</sup> bubble: stereochemistry to the rescue!
Auffinger, P., Ennifar, E., & D'Ascenzo, L. (2021) · RNA · doi:10.1261/rna.076067.120 · Cited by 29 · cited 1× · see citing works
“Given the characteristic coordination distances of ~2.8 Å and an octahedral coordination pattern 39 – 41 , the density likely corresponds to a potassium ion (Fig.”
InfluentialFunctions of unconventional mammalian translational GTPases GTPBP1 and GTPBP2Preprint
Zinoviev, A., Goyal, A., Jindal, S., LaCava, J., Komar, A., Rodnina, M., Hellen, C., & Pestova, T. (2018) · Genes & Development · doi:10.1101/gad.314724.118 · Cited by 28 · cited 10× · see citing works
“We incubated GTPBP1 • Phe-tRNA GAA • GDPCP with the 80S ribosomes puri fi ed from rabbit reticulocyte lysates and programmed with a derivative of β -globin mRNA and containing initiator Met-tRNA i Met bound to the AUG start codon in the P site and the UUC Phe codon in the A-site 19 .”
InfluentialSelf-citationBertoli-Avella, A., García-Aznar, J. M., Brandau, O., Al-Hakami, F., Yüksel, Z., Marais, A., Grüning, N.-M., Abbasi-Moheb, L., Paknia, O., Alshaikh, N. M., et al. (2018) · European Journal of Human Genetics · doi:10.1038/s41431-018-0097-3 · Cited by 28 · see citing works
Woo, K.-C., Kim, T., Lee, K., Kim, D.-Y., Kim, S., Lee, H.-R., Kang, H., Chung, S. J., Senju, S., Nishimura, Y., et al. (2011) · The FASEB Journal · doi:10.1096/fj.10-178715 · Cited by 28 · cited 3× · see citing works
“GTPBP1 was also proposed to recruit the exo-some to promote mRNA degradation in the stalled ribosomal complexes 19,20 .”
The eEF1 family of mammalian translation elongation factors.
Negrutskii, B., Shalak, V., Novosylna, O., Porubleva, L., Lozhko, D., & El'skaya, A. (2023) · BBA Advances · doi:10.1016/j.bbadva.2022.100067 · Cited by 28 · cited 1×
“6; eEF1H complex includes eEF1A and its GDP/GTP exchange factor, which is not directly involved in decoding 62 ).”
Single-Molecule Fluorescence Applied to TranslationPreprint
Prabhakar, A., Puglisi, E. V., & Puglisi, J. D. (2018) · Cold Spring Harbor Perspectives in Biology · doi:10.1101/cshperspect.a032714 · Cited by 28 · see citing works
Genome wide analysis of common and specific stress responses in adult drosophila melanogaster
Girardot, F., Monnier, V., & Tricoire, H. (2004) · BMC Genomics · doi:10.1186/1471-2164-5-74 · Cited by 27 · see citing works
Mouse and human GTPBP2, newly identified members of the GP-1 family of GTPase.
Kudo, H., Senju, S., Mitsuya, H., & Nishimura, Y. (2000) · Biochemical and Biophysical Research Communications - BBRC · doi:10.1006/bbrc.2000.2763 · Cited by 24 · see citing works
Langille, J. J., Ginzberg, K., & Sossin, W. (2019) · Learning & memory (Cold Spring Harbor, N.Y.) · doi:10.1101/lm.049965.119 · Cited by 21 · cited 1× · see citing works
“GTPBP1-bound ribosomes might also correspond to a temporary stalling state, e.g., to enable the dendritic transport of polysomes, in keeping with their stalled or slowed translation 74,75 .”
Maruyama, K., Imai, H., Kawamura, M., Ishino, S., Ishino, Y., Ito, K. R., & Uchiumi, T. (2019) · Scientific Reports · doi:10.1038/s41598-019-51266-x · Cited by 19 · cited 1× · see citing works
“4E), and similar rearrangements were implicated from the comparison of GTP-and GDP-bound isolated structures of eEF1A 36,43,46,47 and eRF3 48 .”
Carter, M., Venkateswaran, S., Shapira-Zaltsberg, G., Davila, J., Humphreys, P., Kernohan, K., & Boycott, K. (2019) · Clinical Genetics · doi:10.1111/cge.13523 · Cited by 18 · see citing works
Watanabe, M., Yoshida, K.-I., Hida, M., Kato, H., Uchida, K., Yamaguchi, R., Tateyama, S., & Sugano, S. (2000) · Gene · doi:10.1016/s0378-1119(00)00346-2 · Cited by 18 · cited 1× · see citing works
“Like all other translational GTPases, GTPBP1/GTPBP2 contain three conserved domains — a GTPase (G) domain and two β -barrel domains — but they also have long N-terminal and C-terminal extensions that are the most divergent elements in theseproteins 1 – 4 .”
Identification of human and mouse GP-1, a putative member of a novel G-protein family.
Senju, S., & Nishimura, Y. (1997) · Biochemical and Biophysical Research Communications - BBRC · doi:10.1006/bbrc.1997.6103 · Cited by 17 · cited 1×
“GTPBP1 might be required for accurate protein expression at certain stages of cell development or in different cell types, consistent with the differential expression of GTPBP1 in mammalian tissues 2,7,14 .”
Activation of Rho Family GTPases by Small Molecules
Palsuledesai, C., Surviladze, Z., Waller, A., Miscioscia, T. F., Guo, Y.-N., Wu, Y., Strouse, J., Romero, E. G., Salas, V. M., Curpan, R., et al. (2018) · ACS Chemical Biology · doi:10.1021/acschembio.8b00038 · Cited by 16 · see citing works
Anticancer Small-Molecule Agents Targeting Eukaryotic Elongation Factor 1A: State of the Art
Zhang, H., Cai, J., Yu, S., Sun, B., & Zhang, W. (2023) · International Journal of Molecular Sciences · doi:10.3390/ijms24065184 · Cited by 15
Human Tissues Exhibit Diverse Composition of Translation Machinery
Anisimova, A., Kolyupanova, N. M., Makarova, N. E., Egorov, A., Kulakovskiy, I., & Dmitriev, S. (2023) · bioRxiv · doi:10.3390/ijms24098361 · Cited by 14 · cited 2× · see citing works
“GTPBP1 might be required for accurate protein expression at certain stages of cell development or in different cell types, consistent with the differential expression of GTPBP1 in mammalian tissues 2,7,14 .”
Two classes of EF1-family translational GTPases encoded by giant viruses
Zinoviev, A., Kuroha, K., Pestova, T., & Hellen, C. (2019) · Nucleic Acids Research · doi:10.1093/nar/gkz296 · Cited by 14 · cited 3×
“Furthermore, viral GTPBP1-like proteins without the NTD and H-helix-loop drive elongation at rates similar to that of eEF1A 50 (Supplementary Fig.5).”
Self-citationFedotov, S. A., Bragina, J. V., Besedina, N. G., Danilenkova, L. V., Kamysheva, E. A., Panova, A., & Kamyshev, N. (2014) · Fly · doi:10.4161/19336934.2014.983389 · Cited by 13 · cited 1×
“In Drosophila, reduced expression of the GTPBP1/GTPBP2 orthologs Dgp-1 and CG2017 leads to locomotor function defects 12,16,17 and neuron-speci fi c repression of Dgp-1 expression results in olfactory learning defects 18 .”
Combined Transcriptomic and Proteomic Analysis of Perk Toxicity Pathways
Popovic, R., Celardo, I., Yu, Y.-Z., Costa, A. C., Loh, S. H., & Martins, L. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22094598 · Cited by 12 · cited 1× · see citing works
“Furthermore, Dgp-1 is upregulated in response to over-expression of the endoplasmic reticulum (ER) stress-induced dPERK kinase 23 , and loss-of-function alleles of Drosophila Dgp-1 reduce the viability of Parkin null mutants de fi cient in Parkin E3 ubiquitin ligase that targets proteins for…”
Pan-cancer analysis revealed the significance of the GTPBP family in cancer
Hu, Y.-M., Chen, L., Tang, Q.-K., Wei, W., Cao, Y., Xie, J., & Ji, J. (2022) · Aging · doi:10.18632/aging.203952 · Cited by 8 · cited 1×
“Similar to studies of other GTPases 76 – 78 , structures of GTPBP1 may help to develop potential therapies for diseases caused by dysregulation of GTPBP1 function, such as in cancers with altered GTPBP1 expression 79 .”
Salpietro, V., Maroofian, R., Zaki, M., Wangen, J., Ciolfi, A., Barresi, S., Efthymiou, S., Lamaze, A., Aughey, G., Mutairi, F. A., et al. (2023) · American Journal of Human Genetics · doi:10.1016/j.ajhg.2023.11.012 · Cited by 7 · cited 7× · see citing works
“The loss of either GTPBP1 or GTPBP2 causes neurodegeneration and/or neurodevelopmental disorders in humans 8 – 12 and in mice that are de fi cient in the main central nervous system (CNS) Arg-tRNA isodecoder 13,14 .”
InfluentialZinoviev, A., Hellen, C., & Pestova, T. (2020) · Methods in molecular biology · doi:10.1007/978-1-4939-9822-7_16 · Cited by 7 · cited 1×
“Although GTPBP1 was implicated in the recruitment of the exosome to promote mRNA degradation that could help resolve stalled ribosomes 19,20,71 , a strong correlation between mRNA abundance and ribosome pausing in the murine Gtpbp1 − / − cerebellum was not established 14 .”
Self-citationGTP-Binding Protein 1-Like (GTPBP1l) Regulates Vascular Patterning during Zebrafish Development
Lo, Y.-H., Huang, Y.-S., Chang, Y.-C., Hung, P.-Y., Wang, W.-D., Liu, W., Urade, R., Wen, Z., & Wu, C.-Y. (2022) · Biomedicines · doi:10.3390/biomedicines10123208 · Cited by 3 · cited 2× · see citing works
“The loss of GTPBP1 also disrupts vascular patterning in zebra fi sh 15 .”
Jaberi-Elahi Syndrome: Exploring a Novel GTPBP2 Mutation and a Literature Review.
Manoochehri, J., Shiri, A., Khoddam, S., Aghasipour, M., Kamal, N., Khamirani, H. J., Dastgheib, S., Dianatpour, M., & Tabei, S. (2024) · European Journal of Medical Genetics · doi:10.1016/j.ejmg.2024.104953 · Cited by 2 · see citing works
Fedotov, S. A., Besedina, N. G., Bragina, J. V., Danilenkova, L. V., Kamysheva, E. A., & Kamyshev, N. (2019) · Journal of Comparative Physiology · doi:10.1007/s00359-019-01378-6 · Cited by 2 · cited 1×
“In Drosophila, reduced expression of the GTPBP1/GTPBP2 orthologs Dgp-1 and CG2017 leads to locomotor function defects 12,16,17 and neuron-speci fi c repression of Dgp-1 expression results in olfactory learning defects 18 .”
Flagged first, then by citations
11 of the 119 references couldn’t be matched to a known paper.
Cited by
Sorted by citations
Kamoshita, N. (2026) · Viruses · doi:10.3390/v18080893 · Cited by 1 · see citing works
- Authors
- Susorov, D., Miścicka, A., Golovenko, D., Loveland, A. B., Zinoviev, A., Pestova, T. V., & Korostelev, A. A.
- Affiliations
- University of Massachusetts Chan Medical School (US)
- SUNY Downstate Health Sciences University (US)
- Eli Lilly (United States) (US)
- Corresponding author
- Pestova, Tatyana V.
- Korostelev, Andrei A.
- ORCID
- Venue
- Nature Communications
- Published
- 2025-12-05
- Volume
- 17
- Issue
- 1
- Pages
- 148-148
- ISSN
- 2041-1723 (ISSN-L)
- PMC
- PMC12485741
- OpenAlex
- W4417031311
- Cited by
- 1
- References
- 119
- Citations by year
- 2026: 1
- FWCI
- 0.30
- Type
- journal article
- Language
- en
- Open access
- gold
- doi.org
- Licence
- Locations
- Nature Communications (publishedVersion, cc-by-nc-nd)
- bioRxiv (Cold Spring Harbor Laboratory) (acceptedVersion, cc-by-nc)
- PubMed (publishedVersion)
- PubMed Central (publishedVersion, cc-by-nc)
- PubMed Central (publishedVersion, cc-by-nc-nd)
- Europe PMC (PubMed Central) (submittedVersion, cc-by-nc)
- DOAJ (DOAJ: Directory of Open Access Journals) (submittedVersion, cc-by-sa)
- Funders
- U.S. Department of Health & Human Services | National Institutes of Health (R35GM127094)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › RNA and protein synthesis mechanisms
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › RNA modifications and cancer
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › PI3K/AKT/mTOR signaling in cancer
- Keywords
- mRNA decoding, translational GTPases, elongation factor 1-alpha, 80S ribosome, aminoacyl-tRNA, proofreading, GTP hydrolysis, translation elongation, ribosome-associated quality control, neurodevelopmental disorders, neurodegenerative diseases, cryo-EM structure
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
