The DOI matches its Crossref record; 54 of the 54 references it cites were found in a registry or an index.
Accelerated MDM2 auto‐degradation induced by DNA‐damage kinases is required for p53 activation
Open accessAbstract
p53 activation prevents the proliferation of genetically unstable cells. Conversely, p53 antagonism by its transcriptional target, the E3 ubiquitin ligase MDM2, is critical for the viability of unstressed, cycling cells. We demonstrate that MDM2 induces the degradation of p53 in both the nucleus and the cytoplasm. As p53 and MDM2 accumulate in the nuclei of stressed cells, we investigated mechanisms enabling p53 activation despite the high MDM2 levels generated during a DNA-damage response. We show that DNA damage destabilized MDM2 by a mechanism involving damage-activated kinases and MDM2 auto-ubiquitination. p53 was stable and transcriptionally active when MDM2 was unstable, but became unstable and inactive as the damage response waned and MDM2 stabilized. Importantly, blocking MDM2 destabilization in DNA-damaged cells prevented p53 target gene activation. Our data reveal that controlled MDM2 degradation is an important new step in p53 regulation.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“However, in addition to degrading p53, Mdm2 also undergoes auto-degradation [12,13] and targets Mdmx for degradation [14–16], which is critical for optimal p53 activation after stress.”
From The p53 orchestra: Mdm2 and Mdmx set the tone (2010) · cites this paper as [12]
In the citing paper
“The disruption of Mdm2 oligomers might also contribute to their destabilization following DNA damage [12].”
From The p53 orchestra: Mdm2 and Mdmx set the tone (2010) · cites this paper as [12]
In the citing paper
“A recent study showed that DNA damage also accelerates MDM2 degradation through a mechanism that requires its own RING domain (Stommel and Wahl, 2004).”
From ATM and Chk2-dependent phosphorylation of MDMX contribute to p53 activation after DNA damage (2005) · cites this paper as Stommel and Wahl, 2004
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
In Vivo Activation of the p53 Pathway by Small-Molecule Antagonists of MDM2
Vassilev, L. T., Vu, B. T., Graves, B., Carvajal, D., Podlaski, F., Filipovic, Z., Kong, N., Kammlott, U., Lukacs, C., Klein, C., et al. (2004) · Science · doi:10.1126/science.1092472 · Cited by 4,661
DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation
Bakkenist, C. J., & Kastan, M. B. (2003) · Nature · doi:10.1038/nature01368 · Cited by 3,466
Momand, J., Zambetti, G. P., Olson, D. C., George, D., & Levine, A. J. (1992) · Cell · doi:10.1016/0092-8674(92)90644-r · Cited by 3,113
Oncoprotein MDM2 conceals the activation domain of tumour suppressor p53
Oliner, J. D., Pietenpol, J. A., Thiagalingam, S., Gyuris, J., Kinzler, K. W., & Vogelstein, B. (1993) · Nature · doi:10.1038/362857a0 · Cited by 1,474
Rescue of early embryonic lethality in mdm2-deficient mice by deletion of p53
de Oca Luna, R. M., Wagner, D. S., & Lozano, G. (1995) · Nature · doi:10.1038/378203a0 · Cited by 1,420 · cited 2×
“The importance of MDM2 in p53 regulation is evidenced by the embryonic lethality of MDM2 knockout mice, presumably due to unrestrained p53 activity (Jones et al, 1995; Montes de Oca Luna et al, 1995).”
BackgroundRescue of embryonic lethality in Mdm2-deficient mice by absence of p53
Jones, S. N., Roe, A. E., Donehower, L. A., & Bradley, A. (1995) · Nature · doi:10.1038/378206a0 · Cited by 1,280 · cited 4×
“The importance of MDM2 in p53 regulation is evidenced by the embryonic lethality of MDM2 knockout mice, presumably due to unrestrained p53 activity (Jones et al, 1995; Montes de Oca Luna et al, 1995).”
BackgroundInfluentialPost‐translational modifications and activation of p53 by genotoxic stresses
Appella, E., & Anderson, C. W. (2001) · European Journal of Biochemistry · doi:10.1046/j.1432-1327.2001.02225.x · Cited by 1,095
Mdm2 Is a RING Finger-dependent Ubiquitin Protein Ligase for Itself and p53
Fang, S., Jensen, J. P., Ludwig, R. L., Vousden, K. H., & Weissman, A. M. (2000) · Journal of Biological Chemistry · doi:10.1074/jbc.275.12.8945 · Cited by 1,044
The INK4a/ARF network in tumour suppression
Sherr, C. J. (2001) · Nature Reviews Molecular Cell Biology · doi:10.1038/35096061 · Cited by 1,001
The MDM2 gene amplification database
Momand, J. (1998) · Nucleic Acids Research · doi:10.1093/nar/26.15.3453 · Cited by 982
Cited by
Sorted by citations
Items 201–300 of 383
Kao, C.-L., Hsu, H., Chen, H.-W., & Cheng, T.-H. (2009) · Cancer Letters · doi:10.1016/j.canlet.2009.05.031 · Cited by 28
Pham, T.-N. D., Ma, W., Miller, D., Kazakova, L., & Benchimol, S. (2019) · Cell Death and Disease · doi:10.1038/s41419-018-1274-6 · Cited by 27
Timmerman, D. M., Remmers, T. L., Hillenius, S., & Looijenga, L. H. J. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22105377 · Cited by 26
Genetic changes and DNA damage responses in the prostate
af Hällström, T., & Laiho, M. (2008) · The Prostate · doi:10.1002/pros.20746 · Cited by 27
“Recently, it has been shown that DNA damage induces accelerated Mdm2 autodegradation and that this is required for p53 activation [149,150].”
BackgroundHSP72 depletion suppresses γH2AX activation by genotoxic stresses via p53/p21 signaling
Gabai, V. L., Sherman, M. Y., & Yaglom, J. A. (2010) · Oncogene · doi:10.1038/onc.2009.480 · Cited by 27
Dose-Response Modeling of Etoposide-Induced DNA Damage Response
Li, Z., Sun, B., Clewell, R. A., Adeleye, Y. A., Andersen, M. E., & Zhang, Q. (2013) · Toxicological Sciences · doi:10.1093/toxsci/kft259 · Cited by 28
“The rates of degradation for p53 and p53p are from published data: at basal conditions where p53 is primarily dephosphorylated, its half-life is 20 min (R24), and under stress conditions, where p53p is predominant, the half-life is 200 min (R25) (Stommel and Wahl, 2004).”
BackgroundAnalysis of a minimal model for p53 oscillations
Bottani, S., & Grammaticos, B. (2007) · Journal of Theoretical Biology · doi:10.1016/j.jtbi.2007.04.026 · Cited by 28
Calculation of hot spots for protein–protein interaction in p53/PMI‐MDM2/MDMX complexes
Huang, D., Qi, Y., Song, J., & Zhang, J. Z. H. (2018) · Journal of Computational Chemistry · doi:10.1002/jcc.25592 · Cited by 26
NEK10 tyrosine phosphorylates p53 and controls its transcriptional activity
Haider, N., Dutt, P., van de Kooij, B., Ho, J., Palomero, L., Pujana, M. Á., Yaffe, M. B., & Stambolic, V. (2020) · Oncogene · doi:10.1038/s41388-020-1361-x · Cited by 26
Zhang, Y., Gurumurthy, C. B., Kim, J., Bhat, I., Gao, Q., Dimri, G. P., Lee, S. W., Band, H., & Band, V. (2006) · Cancer Research · doi:10.1158/0008-5472.can-06-0722 · Cited by 28
Regulation of the DNA Damage Response by p53 Cofactors
Zhang, X. P., Liu, F., & Wang, W. (2012) · Biophysical Journal · doi:10.1016/j.bpj.2012.04.002 · Cited by 25
“dt 1⁄4 kasre1⁄2Rb 1⁄2E2F1 þ kdsre1⁄2RE ; (24)”
Backgroundp53 must be competent for transcriptional regulation to suppress tumor formation
Nistér, M., Tang, M., Zhang, X., Yin, C., Beeche, M., Hu, X., Enblad, G., Dyke, T. V., & Wahl, G. M. (2005) · Oncogene · doi:10.1038/sj.onc.1208354 · Cited by 26
Self-citationSILAC analysis of oxidative stress‐mediated proteins in human pneumocytes: New role for treacle
Duan, X., Kelsen, S. G., Clarkson, A. B., Ji, R., & Merali, S. (2010) · PROTEOMICS · doi:10.1002/pmic.201000020 · Cited by 25
“Under normal conditions p53 has a short half-life and is kept at basal level by HDM2-mediated proteasome processing [26, 27].”
BackgroundHuart, A.-S., MacLaine, N. J., Narayan, V., & Hupp, T. R. (2012) · PLoS ONE · doi:10.1371/journal.pone.0043391 · Cited by 27
“loop [29,30].”
Ma, F., Wang, H., Chen, B., Wang, F., & Xu, H. (2011) · Arquivos de Neuro-Psiquiatria · doi:10.1590/s0004-282x2011000100020 · Cited by 25
MDM2 Controls the Timely Expression of Cyclin A to Regulate the Cell Cycle
Frum, R. A., Ramamoorthy, M., Mohanraj, L., Deb, S., & Deb, S. P. (2009) · Molecular Cancer Research · doi:10.1158/1541-7786.mcr-08-0334 · Cited by 25
“However, the absence of MDM2 stabilizes p53 (27-29).”
BackgroundFunctional analysis and consequences of Mdm2 E3 ligase inhibition in human tumor cells
Wade, M. R., Li, Y. C., Matani, A. S., Braun, S. M. G., Milanesi, F., Rodewald, L. W., & Wahl, G. M. (2012) · Oncogene · doi:10.1038/onc.2011.625 · Cited by 25
“Immobilized recombinant protein A was used for antibody pulldown, and immunoprecipitates were washed and eluted as described (43).”
MethodSelf-citationCalheiros, J., Corbo, V., & Saraiva, L. (2023) · Biochimica et Biophysica Acta (BBA) - Reviews on Cancer · doi:10.1016/j.bbcan.2023.188914 · Cited by 26
PDCD5 functions as a regulator of p53 dynamics in the DNA damage response
Zhuge, C., Sun, X., Chen, Y., & Lei, J. (2015) · Journal of Theoretical Biology · doi:10.1016/j.jtbi.2015.09.025 · Cited by 23
“…68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 Q4 and induces the phosphorylation of p53 and Mdm2 (Bakkenist, 2003; Kitagawa and Kastan, 2005; Prives, 1998; Stommel and Wahl, 2004).”
BackgroundInfluentialMDM2 promotes the proteasomal degradation of p73 through the interaction with Itch in HeLa cells
Kubo, N., Okoshi, R., Nakashima, K., Shimozato, O., Nakagawara, A., & Ozaki, T. (2010) · Biochemical and Biophysical Research Communications · doi:10.1016/j.bbrc.2010.11.043 · Cited by 22
The phenotype of MDM2 auto-degradation after DNA damage is due to epitope masking by phosphorylation
Cheng, Q., & Chen, J. (2011) · Cell Cycle · doi:10.4161/cc.10.7.15249 · Cited by 21
Platelet factor-4 and its p17-70 peptide inhibit myeloma proliferation and angiogenesis in vivo
Yang, L.-J., Du, J., Hou, J., Jiang, H., & Zou, J. (2011) · BMC Cancer · doi:10.1186/1471-2407-11-261 · Cited by 22
“The production of PF4 and p17-70 in the U266, RPMI8226, and LP-1 cell lines, and the appropriate controls, was examined by immunoblotting studies according to a previous report [23,24], The antibodies used were anti-PF4 antibody (Cell Signaling, Danvers, MA) and anti-b-actin antibody (Santa Cruz Biotechnology, Santa C…”
MethodZajkowicz, A., & Rusin, M. (2011) · Mechanisms of Ageing and Development · doi:10.1016/j.mad.2011.09.002 · Cited by 21
“2 and 7) are consistent with the report of Stommel and Wahl (2004), who found that, after DNA damage, MDM2 was destabilized by damage-activated kinases.”
Lessons from interconnected ubiquitylation and acetylation of p53: think metastable networks
Benkirane, M., Sardet, C., & Coux, O. (2010) · Biochemical Society Transactions · doi:10.1042/bst0380098 · Cited by 24
Robust Concentration and Frequency Control in Oscillatory Homeostats
Thorsen, K., Agafonov, O., Selstø, C. H., Jolma, I. W., Ni, X. Y., Drengstig, T., & Ruoff, P. (2014) · PLoS ONE · doi:10.1371/journal.pone.0107766 · Cited by 21
“In the presence of DNA damage, p53 is upregulated by several mechanisms [90–92], and both p53 and Mdm2 have been found to oscillate [60].”
BackgroundGuo, Y., Yuan, W., Wang, L., Shang, M., & Peng, Y. (2010) · Nephrology Dialysis Transplantation · doi:10.1093/ndt/gfq521 · Cited by 21
“Cellular lysates were prepared as described [21] and resolved by SDS– PAGE.”
Methodp53 Family: Therapeutic Targets in Neuroblastoma
Wolter, J. K., Angelini, P., & Irwin, M. S. (2010) · Future Oncology · doi:10.2217/fon.09.176 · Cited by 22
RNF12 promotes p53-dependent cell growth suppression and apoptosis by targeting MDM2 for destruction
Gao, K., Wang, C., Jin, X., Xiao, J., Zhang, E., Yang, X., Wang, D., Huang, H., Yu, L., & Zhang, P. (2016) · Cancer Letters · doi:10.1016/j.canlet.2016.02.013 · Cited by 20
Mouse modelling of the MDM2/MDMX−p53 signalling axis
Tackmann, N. R., & Zhang, Y. (2017) · Journal of Molecular Cell Biology · doi:10.1093/jmcb/mjx006 · Cited by 21
“MDM2 and MDMX degradation following IR has been observed by many groups in cell culture (Kawai et al., 2003; Stommel and Wahl, 2004).”
BackgroundA systematic approach to decipher crosstalk in the p53 signaling pathway using single cell dynamics
Konrath, F., Mittermeier, A., Cristiano, E., Wolf, J., & Loewer, A. (2020) · PLoS Computational Biology · doi:10.1371/journal.pcbi.1007901 · Cited by 20
“Together, these post-translational modifications disrupt the p53-Mdm2 interaction and induce degradation of Mdm2 [10,11].”
BackgroundStructure and function of MDM2 and MDM4 in health and disease
Zhu, I. Y., Lloyd, A., Critchley, W. R., Saikia, Q., Jade, D., Divan, A., Zeqiraj, E., Harrison, M. A., Brown, C. J., & Ponnambalam, S. (2025) · Biochemical Journal · doi:10.1042/bcj20240757 · Cited by 22
“The RING domain of MDM2 also promotes autoubiquitination within the complex with conflicting evidence on the exact regulatory mechanism [65].”
Roles of cellular heterogeneity, intrinsic and extrinsic noise in variability of p53 oscillation
Wang, D.-G., Wang, S., Huang, B. Y., & Liu, F. (2019) · Scientific Reports · doi:10.1038/s41598-019-41904-9 · Cited by 20
Wergeland, L., Sjøholt, G., Haaland, I., Hovland, R., Bruserud, Ø., & Gjertsen, B. T. (2007) · Molecular Cancer · doi:10.1186/1476-4598-6-33 · Cited by 18
“Hdm2 responds to IR with protein auto-degradation [20], and it regulates endocytosis of certain receptors like the IGF 1 receptor [25].”
Makii, C., Ikeda, Y., Oda, K., Uehara, Y., Nishijima, A., Koso, T., Kawata, Y., Kashiyama, T., Miyasaka, A., Sone, K., et al. (2019) · Gynecologic Oncology · doi:10.1016/j.ygyno.2019.08.028 · Cited by 18
Assays for High‐Throughput Screening of E2 and E3 Ubiquitin Ligases
Kenten, J. H., Davydov, I. V., Safiran, Y. J., Stewart, D., Oberoi, P., & Biebuyck, H. A. (2005) · Methods in enzymology on CD-ROM/Methods in enzymology · doi:10.1016/s0076-6879(05)99045-9 · Cited by 18
El-Hamaky, A. A., El‐Hamamsy, M. H., El-Moselhy, T. F., Sharafeldin, N., & Tawfik, H. O. (2025) · European Journal of Medicinal Chemistry · doi:10.1016/j.ejmech.2025.117872 · Cited by 17
Portman, N., Chen, J., & Lim, E. (2021) · Frontiers in Oncology · doi:10.3389/fonc.2021.777867 · Cited by 17
“MDM2 autoubiquitination occurs whilst DNA damage signals persist (28), supporting the posttranslational modifications of p53 to remain active despite increased production of MDM2.”
BackgroundTau protein binds to the P53 E3 ubiquitin ligase MDM2
Sola, M., Rendon-Angel, A., Martinez, V. R., Sgrignani, J., Magrin, C., Piovesana, E., Cavalli, A., Paganetti, P., & Papin, S. (2023) · Scientific Reports · doi:10.1038/s41598-023-37046-8 · Cited by 17
“Inhibition of the proteasome was performed to stabilize MDM2 without the need of agents modifying MDM2 by e.g., antagonistic MDM2 ligands 26,27 or induction of the DNA damage response 13 .”
Discovery of Novel Proteasome Inhibitors Using a High-Content Cell-Based Screening System
Lavelin, I., Beer, A., Kam, Z., Rotter, V., Oren, M., Navon, A., & Geiger, B. (2009) · PLoS ONE · doi:10.1371/journal.pone.0008503 · Cited by 17
“Several proteins such as p53, MDM2 and b-catenin were previously reported to accumulate in the nucleus following treatment with proteasome inhibitors [32,38,39,40,41,42].”
BackgroundGenolet, R., Rahim, G., Jaquier-Gubler, P., & Curran, J. A. (2010) · Nucleic Acids Research · doi:10.1093/nar/gkq805 · Cited by 17
“MDM2 is generally considered to be an unstable protein at least in part due to its self-polyubiquitinylation (30).”
BackgroundDownregulation of Mdm2 and Mdm4 enhances viral gene expression during adenovirus infection
Yang, H., Zheng, Z., Zhao, L., Li, Q., & Liao, D. (2012) · Cell Cycle · doi:10.4161/cc.11.3.19052 · Cited by 18
Controlled Access of p53 to the Nucleus Regulates Its Proteasomal Degradation by MDM2
Davis, J. R., Mossalam, M., & Lim, C. S. (2013) · Molecular Pharmaceutics · doi:10.1021/mp300543t · Cited by 16
A plausible model for bimodal p53 switch in DNA damage response
Sun, T., & Cui, J. (2014) · FEBS Letters · doi:10.1016/j.febslet.2014.01.044 · Cited by 16
“The phosphorylated forms (MDM2p) may either undergo accelerated degradation and attenuated p53 degradation or instead promote p53 mRNA translation and p53 induction [32,36].”
BackgroundThe key vulnerabilities and therapeutic opportunities in the USP7-p53/MDM2 axis in cancer
Saha, G., & Ghosh, M. K. (2025) · Biochimica et Biophysica Acta (BBA) - Molecular Cell Research · doi:10.1016/j.bbamcr.2025.119908 · Cited by 18
Correlation between Oncogenic Mutations and Parameter Sensitivity of the Apoptosis Pathway Model
Chen, J., Yue, H., & Ouyang, Q. (2014) · PLoS Computational Biology · doi:10.1371/journal.pcbi.1003451 · Cited by 15
“DNA damage reduces the binding affinity between p53 and MDM2 by inducing phosphorylation of p53 and MDM2 [15] — phosphorylated MDM2 undergoes rapid degradation [16] and p53 is subsequently activated by phosphorylation to a ‘‘response state’’, triggering downstream events, such as apoptosis and cell-cycle arrest [17].”
BackgroundMessenger RNA fluctuations and regulatory RNAs shape the dynamics of a negative feedback loop
Martínez, M. R., Soriano, J., Tlusty, T., Pilpel, Y., & Furman, I. (2010) · Physical Review E · doi:10.1103/physreve.81.031924 · Cited by 14
Ohta, S., Tago, K., Funakoshi‐Tago, M., Matsugi, J., & Yanagisawa, K. (2016) · Cellular Signalling · doi:10.1016/j.cellsig.2016.04.013 · Cited by 14
A high-throughput integrated microfluidics method enables tyrosine autophosphorylation discovery
Nevenzal, H., Noach-Hirsh, M., Skornik-Bustan, O., Brio, L., Barbiro‐Michaely, E., Glick, Y., Avrahami, D., Lahmi, R., Tzur, A., & Gerber, D. (2019) · Communications Biology · doi:10.1038/s42003-019-0286-9 · Cited by 14
Dynamics of p53 regulatory network in DNA damage response
Gao, C., & Chen, F. (2020) · Applied Mathematical Modelling · doi:10.1016/j.apm.2020.06.057 · Cited by 14
Niu, X., Cui, H., Gu, X., Wu, T., Sun, M., Zhou, C., & Ma, M. (2022) · Frontiers in Oncology · doi:10.3389/fonc.2022.837980 · Cited by 14
“Accelerated MDM2 autodegradation induced by DNA damage is required for p53 activation (41).”
BackgroundMethodExploring a minimal two-component p53 model
Sun, T., Yuan, R., Xu, W., Zhu, F., & Shen, P. (2010) · Physical Biology · doi:10.1088/1478-3975/7/3/036008 · Cited by 14
The Yin-Yang of DNA Damage Response: Roles in Tumorigenesis and Cellular Senescence
Li, X., Xu, H., Chong-an, X., Lin, M., Song, X., Yi, F., Feng, Y., Coughlan, K. A., Cho, W., Kim, S. W., et al. (2013) · International Journal of Molecular Sciences · doi:10.3390/ijms14022431 · Cited by 18
“The stimulation of ARF relieves the inhibitory effect of MDM2 (mouse double minute 2 homolog) on p53 [25–27].”
BackgroundMDM2-C Functions as an E3 Ubiquitin Ligase
Kim, J. Y., Lee, R., Xiao, G., Forbes, D., & Bargonetti, J. (2020) · Cancer Management and Research · doi:10.2147/cmar.s260943 · Cited by 13
Heijkants, R. C., Teunisse, A. F. A. S., de Jong, D., Glinkina, K., Mei, H., Kiełbasa, S. M., Szuhai, K., & Jochemsen, A. G. (2022) · Cancers · doi:10.3390/cancers14184482 · Cited by 13
“Additionally, ATM-mediated phosphorylation on MDM2 inhibits its ubiquitin ligase activity towards p53 [25,29].”
BackgroundA Protein Turnover Signaling Motif Controls the Stimulus-Sensitivity of Stress Response Pathways
Loriaux, P. M., & Hoffmann, A. (2013) · PLoS Computational Biology · doi:10.1371/journal.pcbi.1002932 · Cited by 13
“What then is the physiological relevance of high Mdm2 flux? In the model, signal-mediated Mdm2 autoubiquitination [27] is a major contributor to Mdm2 degradation after stimulation.”
BackgroundZajkowicz, A., Krześniak, M., Matuszczyk, I., Głowala‐Kosińska, M., Butkiewicz, D., & Rusin, M. (2013) · Molecular Biology Reports · doi:10.1007/s11033-013-2602-7 · Cited by 13
“Moreover, we observed higher MDM2 expression in cells co-treated with resveratrol and nutlin-3a than in cells treated only with resveratrol (Fig.”
ResultInfluentialThe Role of Oncogenic Tyrosine Kinase NPM-ALK in Genomic Instability
Lobello, C., Bikos, V., Janíková, A., & Pospı́šilová, Š. (2018) · Cancers · doi:10.3390/cancers10030064 · Cited by 13
“Under normal conditions, p53 is negatively regulated by MDM2 or MDM4, which bind the TAD domain of p53, inducing the degradation of the protein by ubiquitination [30,31].”
BackgroundHAUSP-regulated switch from auto- to p53 ubiquitination by Mdm2 (in silico discovery)
Brazhnik, P., & Kohn, K. W. (2007) · Mathematical Biosciences · doi:10.1016/j.mbs.2007.05.005 · Cited by 13
Loss of p53 function promotes DNA damage-induced formation of nuclear actin filaments
Torii, T., Sugimoto, W., Itoh, K., Kinoshita, N., Gessho, M., Goto, T., Uehara, I., Nakajima, W., Budirahardja, Y., Miyoshi, D., et al. (2023) · Cell Death and Disease · doi:10.1038/s41419-023-06310-0 · Cited by 14
“Normally, the activity of p53 is maintained at a low level [31, 32].”
Bi, Y., Yang, Z., Zhuge, C., & Lei, J. (2015) · Chaos An Interdisciplinary Journal of Nonlinear Science · doi:10.1063/1.4934967 · Cited by 12
Meng, L., Meng, Z., Miao, Z., Veenstra, T. D., & Pommier, Y. G. (2008) · Journal of Pharmacology and Experimental Therapeutics · doi:10.1124/jpet.108.137802 · Cited by 12
“Primer and probe sequences were as follows (Stommel and Wahl, 2004): p21, GCAGACCAGCATGACAGATTTC (sense), GCGGATTAGGGCTTCCTCTT (antisense), FAM-CACTCCAAACGCCGGCTGATCTTC-TAMRA (probe); and 18S RNA, GATTAAGTCCCTGCCCTTTGTACA (sense), GATCCGAGGGCCTCACTAAAC (antisense), FAM-CGCCCGTCGCTACTACCGATTGG-TAMRA (probe).”
Phillips, A., Darley, M., & Blaydes, J. P. (2006) · Oncogene · doi:10.1038/sj.onc.1209451 · Cited by 12
“Of particular note is the stress-induced increase in Hdm2 protein turnover that contributes to the activation of p53 following DNA damage (Stommel and Wahl, 2004), the phosphorylation of Hdm2 by Akt kinase, which promotes the accumulation of Hdm2 in the nucleus and is an important component of the…”
BackgroundInfluentialPerry, J., Powles, T. B., Shamash, J., Veerupillai, A., McGrowder, E. H., Noel, E. E., Lu, Y., Oliver, R. T. D., & Joel, S. (2009) · Cancer Chemotherapy and Pharmacology · doi:10.1007/s00280-009-0944-6 · Cited by 10
“Although MDM2 may be expected to reXect the continued increase in p53 recent reports have described a marked decrease in MDM2 stability in response to DNA damage, mediated both by kinases and MDM2 auto-ubiquitination, thereby prolonging the p53 response [3, 25].”
BackgroundHainaut, P. L., Wiman, K. G., & Olivier, M. (2012) · Springer eBooks · doi:10.1007/978-1-4614-3676-8 · Cited by 10
Nechushtan, H., Hamburger, T., Mendelson, S., Kadouri, L., Sharon, N. A., Pikarsky, E., & Peretz, T. (2009) · BMC Cancer · doi:10.1186/1471-2407-9-60 · Cited by 10
“It is noteworthy that DNA damaging agents can significantly lower the levels of active MDM2 thus allowing the reactivation of p53 [21-23].”
BackgroundResveratrol prevents hypoxia-induced retinal ganglion cell death related with ErbB2
Seong, H., Ryu, J., Park, J., Han, Y., Cho, H.-K., Kim, S. J., Park, J. M., Kang, S. S., & Seo, S. W. (2022) · International Journal of Ophthalmology · doi:10.18240/ijo.2022.03.04 · Cited by 9
Dual roles of SIRT1 in the BAX switch through the P53 module: A mathematical modeling study
Liu, N., Yang, H., & Yang, L. (2021) · Computational and Structural Biotechnology Journal · doi:10.1016/j.csbj.2021.09.033 · Cited by 9
“DNA damage will accelerate the degradation rate of MDM2 in the nucleus [50], which is reflected in the first term of Eq.”
BackgroundPost-translational regulation enables robust p53 regulation
Shin, Y.-J., Chen, K., Sayed, A. H., Hencey, B., & Shen, X. (2013) · BMC Systems Biology · doi:10.1186/1752-0509-7-83 · Cited by 9
“(half-life ≈ 20 min) [25], pz = 2.”
Mdm2 Plays a Positive Role as an Effector of p53-Dependent Responses
Giono, L. E., & Manfredi, J. J. (2007) · Cell Cycle · doi:10.4161/cc.6.17.4647 · Cited by 9
Gene copy number and cell cycle arrest
Ghosh, B., & Bose, I. (2005) · Physical Biology · doi:10.1088/1478-3975/3/1/003 · Cited by 9
“There is also experimental evidence that DNA damage kinases induce an auto-degradation of the MDM2 proteins [15].”
BackgroundInfluentialEthyl acetate extract of Elephantopus mollis Kunth induces apoptosis in human gastric cancer cells
Tam, T. D. T., Ngoc, T. T. B., Nga, N. T., Trinh, N. T. M., Tran, T. L., & Thảo, Đ. T. P. (2021) · BMC Complementary Medicine and Therapies · doi:10.1186/s12906-021-03444-6 · Cited by 8
“In this case, BAK and APAF-1 genes might be transcriptionally regulated by another factor, or P53 proteins might be regulated by post-translational modifications leading to their stable presence in cells [42] then prompting transcriptional activation of BAK and APAF-1 genes.”
BackgroundSalgado, M. T. S. F., Silva, E. F. E., do Nascimento, M. A., Lopes, A. C., de Paiva, L. S., & Votto, A. P. D. S. (2023) · Nutrition and Cancer · doi:10.1080/01635581.2023.2241698 · Cited by 9
“Que increased total P53 in DB-1 melanoma cells and induced the phosphorylation at serine 15, 20, 37, and 392 of P53.”
BackgroundInfluentialModeling amplified p53 responses under DNA-PK inhibition in DNA damage response
Sun, T., Li, X., & Shen, P. (2017) · Oncotarget · doi:10.18632/oncotarget.15062 · Cited by 7
“However, ATM can further activate MDM2 at Ser395 allowing MDM2 self-degradation [21].”
BackgroundExploring the influence of microRNA miR-34 on p53 dynamics: a numerical study*
Liu, N., Yang, H., & Yang, L. (2021) · Communications in Theoretical Physics · doi:10.1088/1572-9494/abd84c · Cited by 8
A common pathway to cancer: Oncogenic mutations abolish p53 oscillations
Xiong, L., & Garfinkel, A. (2022) · Progress in Biophysics and Molecular Biology · doi:10.1016/j.pbiomolbio.2022.06.002 · Cited by 9
Chen, Y., Chen, J., Hai, W., Gao, P., Wang, J., Zheng, Z., & Gu, J. (2011) · Microbial Pathogenesis · doi:10.1016/j.micpath.2011.05.003 · Cited by 8
Sun, T., Mu, D., & Cui, J. (2018) · Cell Cycle · doi:10.1080/15384101.2018.1553342 · Cited by 8
“MDM2 undergoes phosphorylation and accelerated degradation in DNA damage response and we therefore assigned a roughly 10-fold increase in MDM2p degradation rate (k19) [41].”
BackgroundGatekeepers of the Guardian: p53 Regulation by Post-Translational Modification, MDM2 and MDMX
Wahl, G. M., Stommel, J. M., Krummel, K. A., & Wade, M. R. (2005) · Springer eBooks · doi:10.1007/978-1-4020-2922-6_4 · Cited by 9
“, 2001) that can reduce MDM2 stability (Stommel and Wahl, 2004), which also impedes MDM2-p53 interaction.”
BackgroundResultInfluentialSelf-citationMancilla, I. A., Coatti, G. C., Biazi, B. I., Zanetti, T. A., Baranoski, A., Marques, L. A., Corveloni, A. C., Lepri, S. R., & Mantovani, M. S. (2019) · Molecular Biology Reports · doi:10.1007/s11033-019-05042-9 · Cited by 7
Dynamic Behavior of p53 Driven by Delay and a Microrna-34a-Mediated Feedback Loop
Gao, C., Liu, H., & Yan, F. (2020) · International Journal of Molecular Sciences · doi:10.3390/ijms21041271 · Cited by 7
“Specifically, as a sensitive and reliable detector of DNA damage [26,27], ATM* induces reaction of p53 from the inactive state to the active state (p53*) by post-translational modifications, such as phosphorylation, methylation and acetylation, on multiple different sites [28].”
BackgroundPotential dynamic analysis of tumor suppressor p53 regulated by Wip1 protein*
Liu, N., Wang, D., Liu, H., Yang, H., & Yang, L. (2020) · Chinese Physics B · doi:10.1088/1674-1056/ab84d1 · Cited by 7
The birhythmicity increases the diversity of p53 oscillation induced by DNA damage
Wang, D.-G., Zhou, C.-H., & Zhang, X. (2017) · Chinese Physics B · doi:10.1088/1674-1056/26/12/128709 · Cited by 7
Nica, I. C., Stan, M. S., Popescu, R. G., Nicula, N.-O., Ducu, R., Diamandescu, L., & Dinischiotu, A. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22179627 · Cited by 6
“In fact, even its intrinsic E3 ubiquitin ligase activity leads to its own ubiquitin labeling [57].”
BackgroundA simple model of genetic oscillations through regulated degradation
Bottani, S., & Grammaticos, B. (2008) · Chaos Solitons & Fractals · doi:10.1016/j.chaos.2008.03.010 · Cited by 6
Positive effect of Mdm2 on p53 expression explains excitability of p53 in response to DNA damage
Eliaš, J. (2017) · Journal of Theoretical Biology · doi:10.1016/j.jtbi.2017.01.038 · Cited by 6
Kumbale, C. M., Voit, E. O., & Zhang, Q. (2021) · Biomolecules · doi:10.3390/biom11111741 · Cited by 5
“ATM during the DNA damage response leads to its stabilization [1].”
BackgroundInfluence of parameter values on the oscillation sensitivities of two p53–Mdm2 models
Samaniego, C. C., Valle, A. R., Ayala‐Charca, G., Villota, E., & Coronado, A. M. (2015) · Systems and Synthetic Biology · doi:10.1007/s11693-015-9173-y · Cited by 5
“In this model ATMp is also maintained at a constant level once DNA damage happens, but performs two tasks, promotion of p53 activation (Prives 1998) and Mdm2nuc degradation (Stommel and Wahl 2004).”
BackgroundCommunicating oscillatory networks: frequency domain analysis
Ihekwaba, A., & Sedwards, S. (2011) · BMC Systems Biology · doi:10.1186/1752-0509-5-203 · Cited by 5
“This assumption was inspired by the observation that phosphorylated ATM, an upstream regulator of p53 [47], responded to double-stranded DNA breaks (DSBs), showing a pulse of activity [48,49].”
BackgroundGlobal dynamics and stability of p53-Mdm2 oscillator mediated by Mdm2 production rate
Yuan-hong, B., Yang, Z., & Xiao-Yan, H. (2016) · Acta Physica Sinica · doi:10.7498/aps.65.028701 · Cited by 5
Modeling and Simulation of p53-Mdm2 Protein Pathway in Normal Cells
Patra, T., Chatterjee, S., Pandit, S., & Barman, S. (2021) · Lecture notes in networks and systems · doi:10.1007/978-981-15-8366-7_10 · Cited by 5
Oscillatory Behaviors of Delayed p53 Regulatory Network with microRNA 192 in DNA Damage Response
Gao, C., & Chen, F. (2021) · International Journal of Bifurcation and Chaos · doi:10.1142/s0218127421500206 · Cited by 5
Oscillation induced by Hopf bifurcation in the p53–Mdm2 feedback module
Gao, C., Ji, J., Yan, F., & Liu, H. (2019) · IET Systems Biology · doi:10.1049/iet-syb.2018.5092 · Cited by 5
Therapeutic considerations for Mdm2: not just a one trick pony
Lehman, J. A., Eitel, J. A., Batuello, C. N., & Mayo, L. D. (2008) · Expert Opinion on Drug Discovery · doi:10.1517/17460441.3.11.1309 · Cited by 6
“The question remains how Mdm2 can possess its reported auto-ubiquitylation activity, as well as targeting Mdmx for degradation [47,48] .”
BackgroundCoronin 2B deficiency induces nucleolar stress and neuronal apoptosis
Wu, H., Yang, Y., Yi, W., Qiu, Y., Ma, S., Xu, J., Fan, Y., Chen, Y., & Chen, Y. (2024) · Cell Death and Disease · doi:10.1038/s41419-024-06852-x · Cited by 4
“The progressive degeneration or apoptosis of speci fi c neurons in the central or peripheral nervous system contributes to neurodegenerative diseases, including Alzheimer ’ s disease, Parkinson ’ s disease, and amyotrophic lateral sclerosis (ALS).”
BackgroundInfluentialSu, H., Ye, C., Sands, J. M., & Zhang, C. (2019) · American Journal of Physiology-Renal Physiology · doi:10.1152/ajprenal.00316.2019 · Cited by 4
Elucidating the Implications of Diverse Dynamical Responses in p53 Protein
Charan, K., Giri, A., & Kar, S. (2022) · ChemPhysChem · doi:10.1002/cphc.202200537 · Cited by 3
Splicing DNA Damage Adaptations for the Management of Cancer Cells
Singh, A. K., Yadav, D., & Malviya, R. (2023) · Current Gene Therapy · doi:10.2174/0115665232258528231018113410 · Cited by 4
MDM2 provides TOP2 poison resistance by promoting proteolysis of TOP2βcc in a p53-independent manner
Shu, J., Jiang, J., Wang, X., Yang, X., Zhao, G., & Cai, T. (2024) · Cell Death and Disease · doi:10.1038/s41419-024-06474-3 · Cited by 4
“We found that endogenous TOP2 β copreci-pitated with endogenous MDM2 from H1299 and A549 cell lysates but not with control IgG (Fig.”
Ryu, S., Nakashima, H., Tanaka, Y., Mukai, R., Ishihara, Y., Tominaga, T., & Ohshima, T. (2024) · Biomolecules · doi:10.3390/biom14080885 · Cited by 4
“cell extracts were then immunoprecipitated with anti-FLAG antibody and immunoblotted with anti-Myc antibody.”
BackgroundMethodPlausible, robust biological oscillations through allelic buffering
Hsieh, F., Nguyen, D. P. M., Heltberg, M. L., Wu, C., Lee, Y.-C., Jensen, M. H., & Chen, S. (2024) · Cell Systems · doi:10.1016/j.cels.2024.10.002 · Cited by 3
Metadata
- Authors
- Stommel, J. M., & Wahl, G. M.
- Affiliations
- Salk Institute for Biological Studies (US)
- Corresponding author
- Wahl, Geoffrey M
- Venue
- The EMBO Journal
- Published
- 2004-03-18
- Volume
- 23
- Issue
- 7
- Pages
- 1547-1556
- ISSN
- 0261-4189 (ISSN-L)
- 1460-2075
- PMC
- PMC391059
- OpenAlex
- W2091818021
- Cited by
- 386
- References
- 54
- Citations by year
- 2026: 3 · 2025: 7 · 2024: 9 · 2023: 13 · 2022: 10 · 2021: 16 · 2020: 13 · 2019: 19 · 2018: 10 · 2017: 9 · 2016: 8 · 2015: 15 · 2014: 21 · 2013: 13 · 2012: 24
- FWCI
- 11.03
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- Locations
- The EMBO Journal (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Funders
- National Science Foundation
- National Institutes of Health
- National Cancer Institute (CA61449, R01CA061449)
- Topics
- Health Sciences › Medicine › Oncology › Cancer-related Molecular Pathways
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Ubiquitin and proteasome pathways
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Heat shock proteins research
- Keywords
- MDM2, p53 activation, DNA damage response, E3 ubiquitin ligase, p53 stabilization, cell cycle arrest
- MeSH terms
- Animals, Cell Line, Cell Nucleus, Cytoplasm, DNA Damage, Gene Expression Regulation, Humans, Nuclear Proteins, Proto-Oncogene Proteins, Transcription, Genetic, Transcriptional Activation, Tumor Suppressor Protein p53, Phosphatidylinositol 3-Kinases, Active Transport, Cell Nucleus, Proteasome Endopeptidase Complex, Mice, Proto-Oncogene Proteins c-mdm2, Proteasome Inhibitors
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
