The DOI matches its Crossref record; 33 of the 33 references it cites were found in a registry or an index.
Human Werner Syndrome DNA Helicase Unwinds Tetrahelical Structures of the Fragile X Syndrome Repeat Sequence d(CGG)
Open accessAbstract
Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
Molecular Cloning: A Laboratory Manual
Sambrook, J., Fritsch, E., & Maniatis, T. (1989) · UCLA - Biblioteca de Ciencias de la Salud · Cited by 133,589
Verkerk, A. J. M. H., Pieretti, M., Sutcliffe, J. S., Fu, Y.-H., Kuhl, D. P. A., Pizzuti, A., Reiner, O., Richards, S., Victoria, M. F., Zhang, F., et al. (1991) · Cell · doi:10.1016/0092-8674(91)90397-h · Cited by 3,481
Fu, Y.-H., Kuhl, D. P. A., Pizzuti, A., Pieretti, M., Sutcliffe, J. S., Richards, S., Verkert, A. J. M. H., Holden, J. J. A., Fenwick, R. G., Warren, S. T., et al. (1991) · Cell · doi:10.1016/0092-8674(91)90283-5 · Cited by 2,080
Sen, D., & Gilbert, W. (1988) · Nature · doi:10.1038/334364a0 · Cited by 1,836
Instability of a 550-Base Pair DNA Segment and Abnormal Methylation in Fragile X Syndrome
Oberlé, I., Rousseau, F., Heitz, D., Kretz, C., Devys, D., Hanauer, A., Boué, J., Bertheas, M. F., & Mandel, J. L. (1991) · Science · doi:10.1126/science.252.5009.1097 · Cited by 1,499
The Bloom's syndrome gene product is homologous to RecQ helicases
Ellis, N. A., Groden, J., Ye, T.-Z., Straughen, J., Lennon, D. J., Ciocci, S., Proytcheva, M., & German, J. (1995) · Cell · doi:10.1016/0092-8674(95)90105-1 · Cited by 1,403
Monovalent cation-induced structure of telomeric DNA: The G-quartet model
Williamson, J. R., Raghuraman, M. K., & Cech, T. R. (1989) · Cell · doi:10.1016/0092-8674(89)90610-7 · Cited by 1,225
A sodium-potassium switch in the formation of four-stranded G4-DNA
Sen, D., & Gilbert, W. (1990) · Nature · doi:10.1038/344410a0 · Cited by 812
The Werner syndrome protein is a DNA helicase
Gray, M. D., Shen, J.-C., Kamath-Loeb, A. S., Blank, A., Sopher, B. L., Martin, G. M., Oshima, J., & Loeb, L. A. (1997) · Nature Genetics · doi:10.1038/ng0997-100 · Cited by 603
Self-citationBloom Syndrome: A Mendelian Prototype of Somatic Mutational Disease
German, J. (1993) · Medicine · doi:10.1097/00005792-199311000-00003 · Cited by 593
Cited by
Prevalence of quadruplexes in the human genome
Huppert, J. L., & Balasubramanian, S. (2005) · Nucleic Acids Research · doi:10.1093/nar/gki609 · Cited by 1,741
Fragile X mental retardation protein targets G quartet mRNAs important for neuronal function
Darnell, J. C., Jensen, K. B., Jin, P., Brown, V., Warren, S. T., & Darnell, R. B. (2001) · Cell · doi:10.1016/s0092-8674(01)00566-9 · Cited by 952
G-quadruplex structures: in vivo evidence and function
Lipps, H. J., & Rhodes, D. (2009) · Trends in Cell Biology · doi:10.1016/j.tcb.2009.05.002 · Cited by 831
Small-molecule–induced DNA damage identifies alternative DNA structures in human genes
Rodriguez, R., Miller, K. M., Forment, J. V., Bradshaw, C. R., Nikan, M., Britton, S., Oelschlaegel, T., Xhemalce, B., Balasubramanian, S., & Jackson, S. P. (2012) · Nature Chemical Biology · doi:10.1038/nchembio.780 · Cited by 741
Targeting telomeres and telomerase
De Cian, A., Lacroix, L., Douarre, C., Temime-Smaali, N., Trentesaux, C., Riou, J.-F., & Mergny, J.-L. (2008) · Biochimie · doi:10.1016/j.biochi.2007.07.011 · Cited by 572
Metadata
- Authors
- Fry, M., & Loeb, L. A.
- Venue
- Journal of Biological Chemistry
- Publisher
- Elsevier BV
- Published
- 1999-04
- Volume
- 274
- Issue
- 18
- Pages
- 12797-12802
- ISSN
- 0021-9258 (ISSN-L)
- OpenAlex
- W2132070326
- Cited by
- 371
- References
- 33
- FWCI
- 6.85
- Type
- journal article
- Language
- en
- Open access
- hybrid
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
How to cite
Cite CoChat for the checks on this page, and the paper for its own findings.
- This page
- CoChat. (2026). Citation check: Human Werner Syndrome DNA Helicase Unwinds Tetrahelical Structures of the Fragile X Syndrome Repeat Sequence d(CGG). https://app.cochat.ai/papers/10.1074/jbc.274.18.12797
- The paper
- Fry, M., & Loeb, L. A. (1999). Human Werner Syndrome DNA Helicase Unwinds Tetrahelical Structures of the Fragile X Syndrome Repeat Sequence d(CGG). Journal of Biological Chemistry. https://doi.org/10.1074/jbc.274.18.12797
Data sources
Bibliographic data: Semantic Scholar, OpenAlex, Crossref.
Contains information from the Semantic Scholar Academic Graph Datasets, made available under the ODC Attribution License (ODC-BY 1.0).
Semantic Scholar’s data is described in: Kinney, R., et al. (2023). The Semantic Scholar Open Data Platform. arXiv:2301.10140.
