Ionizing Radiation Promotes the Acquisition of a Senescence-Associated Secretory Phenotype and Impairs Angiogenic Capacity in Cerebromicrovascular Endothelial Cells: Role of Increased DNA Damage and Decreased DNA Repair Capacity in Microvascular Radiosensitivity
Open accessAbstract
Cerebromicrovascular rarefaction is believed to play a central role in cognitive impairment in patients receiving whole-brain irradiation therapy. To elucidate the mechanism underlying the deleterious effects of γ-irradiation on the cerebral microcirculation, rat primary cerebromicrovascular endothelial cells (CMVECs) were irradiated in vitro. We found that in CMVECs, γ-irradiation (2-8 Gy) elicited increased DNA damage, which was repaired less efficiently in CMVECs compared with neurons, microglia, and astrocytes. Increased genomic injury in CMVECs associated with increased apoptotic cell death. In the surviving cells, γ-irradiation promotes premature senescence (indicated by SA-β-galactosidase positivity and upregulation of p16 (INK4a) ), which was associated with impaired angiogenic capacity (decreased proliferation and tube-forming capacity). γ-Irradiated CMVECs acquired a senescence-associated secretory phenotype, characterized by upregulation of proinflammatory cytokines and chemokines (including IL-6, IL-1α, and MCP-1). Collectively, increased vulnerability of γ-irradiated CMVECs and their impaired angiogenic capacity likely contribute to cerebromicrovascular rarefaction and prevent regeneration of the microvasculature postirradiation. The acquisition of a senescence-associated secretory phenotype in irradiated CMVECs is biologically highly significant as changes in the cytokine microenvironment in the hippocampus may affect diverse biological processes relevant for normal neuronal function (including regulation of neurogenesis and the maintenance of the blood brain barrier).
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
Endothelial senescence is implicated in the pathogenesis of cognitive impairment associated with DNA damage-mediated accelerated microvascular aging, such as radiation therapy-induced cognitive impairment.
“Endothelial senescence has also been recently implicated in the pathogenesis of cognitive impairment associated with DNA damage-mediated accelerated microvascular aging (e.g., radiation therapy -induced cognitive impairment (Ungvari et al. 2013b; Ungvari et al. 2017b)).”
From Single-cell RNA sequencing identifies senescent cerebromicrovascular endothelial cells in the aged mouse brain (2020) · cites this paper as Ungvari et al. 2013b
Cultured cerebromicrovascular endothelial cells readily acquire senescent phenotypes in response to DNA damage.
“cultured cerebromicrovascular endothelial cells readily acquire senescent phenotypes in response to DNA damage (Ungvari et al. 2013b; Ungvari et al. 2018b)”
From Single-cell RNA sequencing identifies senescent cerebromicrovascular endothelial cells in the aged mouse brain (2020) · cites this paper as Ungvari et al. 2013b
Upon induction of cellular senescence in culture, endothelial cells undergo cell cycle arrest and acquire a senescence-associated secretory phenotype (SASP) characterized by increased secretion of pro-inflammatory mediators.
“Upon induction of cellular senescence in culture , endothelial cells undergo cell cycle arrest and acquire a senescence-associated secretory phenotype (SASP), characterized by increased secretion of pro-inflammatory mediators (Ungvari et al. 2013b).”
From Single-cell RNA sequencing identifies senescent cerebromicrovascular endothelial cells in the aged mouse brain (2020) · cites this paper as Ungvari et al. 2013b
Cites
Persistent DNA damage signalling triggers senescence-associated inflammatory cytokine secretion
Rodier, F., Coppé, J.-P., Patil, C. K., Hoeijmakers, W. A. M., Muñoz, D. P., Raza, S. R., Freund, A., Campeau, E., Davalos, A. R., & Campisi, J. (2009) · Nature Cell Biology · doi:10.1038/ncb1909 · Cited by 2,232 · see citing works
Irradiation induces neural precursor-cell dysfunction
Monje, M. L., Mizumatsu, S., Fike, J. R., & Palmer, T. D. (2002) · Nature Medicine · doi:10.1038/nm749 · Cited by 1,271 · see citing works
Senescence-messaging secretome: SMS-ing cellular stress
Kuilman, T., & Peeper, D. S. (2009) · Nature Reviews Cancer · doi:10.1038/nrc2560 · Cited by 909 · see citing works
Coppé, J.-P., Rodier, F., Patil, C. K., Freund, A., Desprez, P.-Y., & Campisi, J. (2011) · Journal of Biological Chemistry · doi:10.1074/jbc.m111.257071 · Cited by 506 · see citing works
Coppé, J.-P., Patil, C. K., Rodier, F., Sun, Y., Muñoz, D. P., Goldstein, J., Nelson, P. S., Desprez, P.-Y., & Campisi, J. (2008) · PLoS Biology · doi:10.1371/journal.pbio.0060301 · Cited by 302 · cited 7× · see citing works
“VEGF A Vascular endothelial growth factor A GCTTGTCCTGAGAAGATA GTATGTAAATGTATATTGAAACCT MCP-1 Chemokine (C–”
BackgroundInfluential
Flagged first, then by citations
Cited by
Sorted by citations
Hypertension-induced cognitive impairment: From pathophysiology to public health
Ungvari, Z., Toth, P., Tarantini, S., Prodan, C. I., Sorond, F., Merkely, B., & Csiszar, A. (2021) · Nature Reviews Nephrology · doi:10.1038/s41581-021-00430-6 · Cited by 544 · see citing works
Self-citationKiss, T., Nyúl-Tóth, Á., Balasubramanian, P., Tarantini, S., Ahire, C., DelFavero, J., Yabluchanskiy, A., Csipo, T., Farkas, E., Wiley, G., et al. (2020) · GeroScience · doi:10.1007/s11357-020-00177-1 · Cited by 203 · see citing works
Self-citationLafargue, A., Degorre, C., Corre, I., Alves-Guerra, M.-C., Gaugler, M.-H., Vallette, F., Pecqueur, C., & Paris, F. (2017) · Free Radical Biology and Medicine · doi:10.1016/j.freeradbiomed.2017.04.019 · Cited by 131 · see citing works
Ungvari, Z., Tarantini, S., Hertelendy, P., Valcarcel-Ares, M. N., Fülöp, G. A., Logan, S., Kiss, T., Farkas, E., Csiszar, A., & Yabluchanskiy, A. (2017) · GeroScience · doi:10.1007/s11357-017-9964-z · Cited by 101 · see citing works
Self-citationKiss, T., Nyúl-Tóth, Á., DelFavero, J., Balasubramanian, P., Tarantini, S., Faakye, J., Gulej, R., Ahire, C., Ungvari, A., Yabluchanskiy, A., et al. (2022) · GeroScience · doi:10.1007/s11357-022-00521-7 · Cited by 66 · see citing works
Self-citationOxidative Stress and the Kidney in the Space Environment
Pavlakou, P., Dounousi, E., Roumeliotis, S., Eleftheriadis, T., & Liakopoulos, V. (2018) · International Journal of Molecular Sciences · doi:10.3390/ijms19103176 · Cited by 52 · see citing works
- Authors
- Ungvari, Z., Podlutsky, A., Sosnowska, D., Tucsek, Z., Toth, P., Deak, F., Gautam, T., Csiszar, A., & Sonntag, W. E.
- Affiliations
- OU Health Stephenson Cancer Center (US)
- University of Alaska Fairbanks (US)
- Corresponding author
- Ungvari, Z.
- Podlutsky, A.
- Sosnowska, D.
- Venue
- The Journals of Gerontology Series A: Biological Sciences and Medical Sciences
- Publisher
- Oxford University Press (OUP)
- Published
- 2013-05-20
- Volume
- 68
- Issue
- 12
- Pages
- 1443-1457
- ISSN
- 1079-5006 (ISSN-L)
- 1758-535X
- PMC
- PMC3814240
- OpenAlex
- W2101833366
- Cited by
- 179
- References
- 5
- Citations by year
- 2026: 15 · 2025: 25 · 2024: 21 · 2023: 17 · 2022: 13 · 2021: 18 · 2020: 13 · 2019: 11 · 2018: 11 · 2017: 10 · 2016: 7 · 2015: 6 · 2014: 10 · 2013: 2
- FWCI
- 6.47
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Locations
- The Journals of Gerontology Series A (publishedVersion)
- Europe PMC (PubMed Central) (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Funders
- National Institutes of Health (5r01ag038747-05)
- National Institute on Aging (R01‐AG038747, AG038747, P01AG11370, AG031085, K08AG031085, P01AG011370)
- National Institute of Neurological Disorders and Stroke (R01NS056218, NS-056218)
- National Center for Complementary and Integrative Health (R01AT006526, AT-006526)
- Topics
- Health Sciences › Medicine › Radiology, Nuclear Medicine and Imaging › Effects of Radiation Exposure
- Health Sciences › Medicine › Physiology › Telomeres, Telomerase, and Senescence
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Angiogenesis and VEGF in Cancer
- Keywords
- gamma irradiation, radiosensitivity, premature senescence, senescence-associated secretory phenotype, DNA damage, DNA repair, angiogenic capacity, whole brain radiotherapy, cognitive impairment, p16INK4a, inflammatory cytokines, chemokines, apoptosis, hippocampus, blood-brain barrier
- MeSH terms
- Animals, beta-Galactosidase, Cell Physiological Phenomena, Cells, Cultured, DNA Damage, DNA Repair, Gamma Rays, Hippocampus, Humans, Neurons, Dementia, Vascular, Up-Regulation, Cytokines, Apoptosis, Oxidative Stress, Neovascularization, Physiologic, Genes, p16, Endothelial Cells, Rats, Secretory Pathway, Microvessels
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
