Cited by 732Genetic Associations and EpidemiologyGenetics and Physical PerformanceNutrition, Genetics, and Disease

The DOI matches its Crossref record; 32 of the 32 references it cites were found in a registry or an index.

A common genetic variant is associated with adult and childhood obesity.

Herbert, Alan, Gerry, Norman P., McQueen, Matthew B., Heid, Iris M., Pfeufer, Arne, Illig, Thomas, Wichmann, H.-Erich, Meitinger, Thomas, Hunter, David, Hu, Frank B., Colditz, Graham, Hinney, Anke, Hebebrand, Johannes, Koberwitz, Kerstin, Zhu, Xiaofeng, Cooper, Richard, Ardlie, Kristin, Lyon, Helen, Hirschhorn, Joel N., Laird, Nan M., Lenburg, Marc E., Lange, Christoph, Christman, Michael F.·2006·Science

DOI 10.1126/science.1124779

Open this paper in CoChat — free account

Abstract

Obesity is a heritable trait and a risk factor for many common diseases such as type 2 diabetes, heart disease, and hypertension. We used a dense whole-genome scan of DNA samples from the Framingham Heart Study participants to identify a common genetic variant near the INSIG2 gene associated with obesity. We have replicated the finding in four separate samples composed of individuals of Western European ancestry, African Americans, and children. The obesity-predisposing genotype is present in 10% of individuals. Our study suggests that common genetic polymorphisms are important determinants of obesity.

Integrity signals

Registry

Crossref · 10.1126/science.1124779

Cites

32 of 32 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

This paper’s full text isn’t openly available, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Haploview: analysis and visualization of LD and haplotype maps
Barrett, J. C., Fry, B., Maller, J., & Daly, M. J. (2004) · Bioinformatics · doi:10.1093/bioinformatics/bth457 · Cited by 14,551
The International HapMap Project
†The International HapMap Consortium, Genotyping centres: Baylor College of Medicine and ParAllele BioScience, Gibbs, R. A., Belmont, J. W., Hardenbol, P., Willis, T. D., Yu, F., Chinese HapMap Consortium, Yang, H., Ch'ang, L.-Y., et al. (2003) · Nature · doi:10.1038/nature02168 · Cited by 6,057
Prevalence of overweight and obesity among US children, adolescents, and adults, 1999-2002.
Hedley, A. A., Ogden, C., Johnson, C. L., Carroll, M., Curtin, L. R., & Flegal, K. (2004) · Journal of the American Medical Association (JAMA) · doi:10.1001/jama.291.23.2847 · Cited by 4,670
Transmission test for linkage disequilibrium: the insulin gene region and insulin-dependent diabetes mellitus (IDDM).
Spielman, R. S., McGinnis, R. E., & Ewens, W. J. (1993) · PubMed · Cited by 3,679
Body Weight and Mortality among Women
Manson, J. E., Willett, W. C., Stampfer, M. J., Colditz, G. A., Hunter, D. J., Hankinson, S. E., Hennekens, C. H., & Speizer, F. E. (1995) · New England Journal of Medicine · doi:10.1056/nejm199509143331101 · Cited by 2,005
Meta-analysis of genetic association studies supports a contribution of common variants to susceptibility to common disease
Lohmueller, K. E., Pearce, C. L., Pike, M., Lander, E. S., & Hirschhorn, J. N. (2003) · Nature Genetics · doi:10.1038/ng1071 · Cited by 1,900
A comprehensive review of genetic association studies
Hirschhorn, J. N., Lohmueller, K., Byrne, E., & Hirschhorn, K. (2002) · Genetics in Medicine · doi:10.1097/00125817-200203000-00002 · Cited by 1,674
On the allelic spectrum of human disease
Reich, D. E., & Lander, E. S. (2001) · Trends in Genetics · doi:10.1016/s0168-9525(01)02410-6 · Cited by 1,185
The family based association test method: strategies for studying general genotype–phenotype associations
Horvath, S., Xu, X. P., & Laird, N. M. (2001) · European Journal of Human Genetics · doi:10.1038/sj.ejhg.5200625 · Cited by 739
The genetics of human obesity
Bell, C. G., Walley, A. J., & Froguel, P. (2005) · Nature Reviews Genetics · doi:10.1038/nrg1556 · Cited by 677

Flagged first, then by citations

Show all 32 references

Research works printed but not linked: 3

C. G. Bell, A. J. Walley, P. Froguel, Nat. Rev. Genet.6, 221 (2005).
R. S. Spielman, R. E. McGinnis, W. J. Ewens, Am. J. Hum. Genet.52, 506 (1993).
H. E. Wichmann, C. Gieger, T. Illig, Das GesundheitwesenSpecial Issue 1, S26 (2005).

Sorted by citations

Items 501–600 of 732

In Silico Gene Discovery
Yu, B. (2008) · Methods in molecular medicine · doi:10.1007/978-1-60327-148-6_1 · Cited by 6
The impact of insulin resistance, gender, genes, glucocorticoids and ethnicity on body fat distribution
Crowther, N. J., & Ferris, W. F. (2010) · Journal of Endocrinology Metabolism and Diabetes of South Africa · doi:10.1080/22201009.2010.10872241 · Cited by 6
Associations of the SREBF2 Gene and INSIG2 Polymorphisms with Obesity and Dyslipidemia in Thai Psychotic Disorder Patients Treated with Risperidone
Vanwong, N., Sukasem, C., Unaharassamee, W., Jiratjintana, N., Nakorn, C. N., Hongkaew, Y., & Puangpetch, A. (2021) · Journal of Personalized Medicine · doi:10.3390/jpm11100943 · Cited by 6
Genome-wide analysis of copy number variations reveals that aging processes influence body fat distribution in Korea Associated Resource (KARE) cohorts
Lee, B., Shin, D. H., Cho, S., Seo, K.-S., & Kim, H. (2012) · Human Genetics · doi:10.1007/s00439-012-1203-1 · Cited by 6
“We identified 20 genes (SOCS1, MTM49, DLK1, CNR1, TBC1D1, SH2BI, BCDIN3D, POMC KLF7, TMEM18, SLC6A14, ADIPOQ, SLC6A4, GPRC5B, ZNF608, FAIM2, NFE2L3, LY86, CPEB4, and LIN7C) that had been reported in previous obesity studies using SNP variants near each gene (Table 3) (Benzinou et al. 2008; Bouatia-Naji et al. 2006; Fo…”
Influential
Combining genetic association study designs: a GWAS case study
Estus, J. L. (2013) · Frontiers in Genetics · doi:10.3389/fgene.2013.00186 · Cited by 6
“By limiting testing to the conventionally-used top 10 highest ranked markers (Herbert et al., 2006), two SNPs reached genome-wide significance.”
Method
FTO and INSIG2 Genotyping Combined with Metabolic and Anthropometric Phenotyping of Morbidly Obese Patients
Burgdörfer, E., Korenkov, M., Jonas, D., Weise, D., Haaf, T., Zechner, U., & Bartsch, O. (2013) · Molecular Syndromology · doi:10.1159/000353563 · Cited by 6
“The association had been first reported by a GWAS for body weight that analyzed 694 individuals of 288 families from the Framingham Heart Study offspring cohort [Herbert et al., 2006].”
BackgroundResultInfluential
CChi: An efficient cloud epistasis test model in human genome wide association studies
Zhou, Z., Liu, G., Su, L., Yan, L., & Han, L. (2013) · International Conference on Biomedical Engineering and Informatics (BMEI) · doi:10.1109/bmei.2013.6747047 · Cited by 6
“INTRODUCTION The recent achievements of high-throughput genotyping technologies have made it possible for researchers to study genetic variation of mammalians at genome-wide scale [5, 8].”
Background
School‐wide healthy weight behaviors: Promoting Universal Longevity via School–family Ecologies (PULSE)
Anderson, L. M., & Phelps, L. (2009) · Psychology in the Schools · doi:10.1002/pits.20413 · Cited by 6
INSIG2 G-102A Promoter Variant Exhibits Context-Dependent Effect on HDL-Cholesterol Levels but Not on BMI in Caucasians
Hubacek, J. A., Suchánek, P., Lánská, V., Pitha, J. V., & Adámková, V. (2011) · Folia Biologica · doi:10.14712/fb2011057040170 · Cited by 6
“Originally, a variant (rs7566605) within the insulininduced gene 2 (INSIG2) was associated with increased risk of obesity in some but not all studies (Herbert et al., 2006; Lyon et al., 2007; Smith et al., 2007; Hubáček et al., 2010).”
Background
Epidemiology in Germany—general development and personal experience
Wichmann, H. ‐. (2017) · European Journal of Epidemiology · doi:10.1007/s10654-017-0290-7 · Cited by 6
Association of PCSK1 gene polymorphisms with abdominal fat content in broilers
Zhou, J., Yang, L., Yu, J., Zhang, K., Xu, Z., Cao, Z., Luan, P., Li, H., & Zhang, H. (2020) · Animal Science Journal · doi:10.1111/asj.13371 · Cited by 6
Biobanken
Wichmann, H. ‐., & Gieger, C. (2007) · Bundesgesundheitsblatt - Gesundheitsforschung - Gesundheitsschutz · doi:10.1007/s00103-007-0140-y · Cited by 6
Genetics of Childhood Obesity
Zhao, J., & Grant, S. F. A. (2013) · Apple Academic Press eBooks · doi:10.1201/b16340-3 · Cited by 7
Etiopatogenia de la obesidad
Fernando Carrasco, N., & Galgani, J. E. (2012) · Revista Médica Clínica Las Condes · doi:10.1016/s0716-8640(12)70289-4 · Cited by 11
Ethnicity, Body Mass, and Genome-Wide Data
Boardman, J. D., Blalock, C. L., Corley, R. P., Stallings, M. C., Domingue, B. W., McQueen, M. B., Crowley, T. J., Hewitt, J. K., Lu, Y., & Field, S. (2010) · Biodemography and Social Biology · doi:10.1080/19485565.2010.524589 · Cited by 6
“Linkage studies (Yang, Kelly, and He 2007) and genome-wide association studies have built on these twin and sibling studies by identifying specific locations on the human genome that are linked to BMI and waist circumference (Herbert et al. 2006; Fox et al. 2007; Frayling et al. 2007).”
Background
The population structure of pathogenic bacteria
Dykhuizen, D. E., & Kalia, A. (2007) · Oxford University Press eBooks · doi:10.1093/acprof:oso/9780199207466.003.0014 · Cited by 7
Two-Stage Testing Strategies for Genome-Wide Association Studies in Family-Based Designs
Murphy, A., Weiss, S. T., & Lange, C. (2009) · Methods in molecular biology · doi:10.1007/978-1-60761-580-4_17 · Cited by 6
Gene–Nutrient Interactions in Obesity: COBLL1 Genetic Variants Interact with Dietary Fat Intake to Modulate the Incidence of Obesity
Kwak, J., & Shin, D. (2023) · International Journal of Molecular Sciences · doi:10.3390/ijms24043758 · Cited by 6
Genome-Wide Linkage and Association Scans for Quantitative Trait Loci of Serum Lactate Dehydrogenase—The Framingham Heart Study
Lin, J., Zheng, G., Joo, J., & Cupples, L. A. (2010) · Human Genomics and Proteomics · doi:10.4061/2010/905237 · Cited by 5
“For the Affymetrix 100 K SNPs genotyping, the details are provided in [10].”
Method
Obesity – Are we continuing to play the genetic “blame game”?
Radha, V., & Mohan, V. (2016) · Advances in Genomics and Genetics · doi:10.2147/agg.s52018 · Cited by 7
“72 However, subsequent studies could not replicate these findings.”
Epistasis detection using a permutation-based Gradient Boosting Machine
Che, K., Liu, X., Guo, M., Zhang, J., Wang, L., & Zhang⋆, Y. (2016) · IEEE International Conference on Bioinformatics and Biomedicine (BIBM) · doi:10.1109/bibm.2016.7822697 · Cited by 5
The 100 top-cited articles on childhood obesity: a bibliometric analysis
Kawuki, J., Musa, T. H., Ghimire, U., Obore, N., & Papabathini, S. S. (2022) · Global Health Journal · doi:10.1016/j.glohj.2022.07.003 · Cited by 8
Genetics and Nutrigenomics of Obesity
Palou, A., Bonet, M. L., Serra, F. A., & Picó, C. (2010) · Springer eBooks · doi:10.1007/978-1-4419-6039-9_15 · Cited by 5
Obesity. The food research agenda
Donnelly, W. J., Fenelon, M. A., Giblin, L. M., & Stanton, C. (2008) · International Journal of Dairy Technology · doi:10.1111/j.1471-0307.2008.00369.x · Cited by 5
One-stage design is empirically more powerful than two-stage design for family-based genome-wide association studies
Rohlfs, R. V., Taylor, C. A., Mirea, L., Bull, S. B., Corey, M. L., & Anderson, A. D. (2007) · BMC Proceedings · doi:10.1186/1753-6561-1-s1-s137 · Cited by 5
“Under this decomposition, expected children's genotypes given parental genotypes can be used in an association test, while actual children's genotypes can be used independently in a transmission test [2-5], leading naturally to a two-stage design.”
Influential
On family-based genome-wide association studies with large pedigrees: observations and recommendations
Fardo, D. W., Zhang, X., Ding, L., He, H., Kurowski, B. G., Alexander, E. S., Baye, T. M., Pilipenko, V. V., Kottyan, L. C., Nandakumar, K., et al. (2014) · BMC Proceedings · doi:10.1186/1753-6561-8-s1-s26 · Cited by 5
“Extensions of this have been proposed [20]; here, for simplicity of exposition, we use the simple top 10 approach, as done in Herbert et al [21], of testing only the top 10 variants based on conditional power using a Bonferroni-corrected significance threshold of 0.”
Influential
Cancer: evolutionary origins of vulnerability
Greaves, M. F. (2007) · Oxford University Press eBooks · doi:10.1093/acprof:oso/9780199207466.003.0021 · Cited by 5
The evolutionary context of human aging and degenerative disease
Austad, S. N., & Finch, C. E. (2007) · Oxford University Press eBooks · doi:10.1093/acprof:oso/9780199207466.003.0023 · Cited by 6
Genetics of obesity in Hispanic children1,2
Fisler, J. S., & Warden, C. H. (2006) · American Journal of Clinical Nutrition · doi:10.1093/ajcn/84.3.473 · Cited by 5
Genetic contribution to obesity: a literature review
van den Berg, S. W., Met, D., Jma, B., Cvg, & Gbo (2008) · Rivm Repository (Netherlands National Institute for Public Health and the Environment) · Cited by 5
The genetics of obesity: aetiology, prevention and therapy
Bonnefond, A., Bruner, W. S., Grant, S. F. A., Morandi, A., & Froguel, P. (2026) · Nature Metabolism · doi:10.1038/s42255-026-01497-w · Cited by 5
“The insulin induced gene 2 ( INSIG2 ) locus was first reported by this method as associated with BMI 41 .”
Association of CNR1 and INSIG2 polymorphisms with antipsychotics-induced weight gain: a prospective nested case–control study
Bulnes, N. J., Velasco, V., Fierro, I., Duran, M., & Carvajal, A. (2021) · Scientific Reports · doi:10.1038/s41598-021-94700-9 · Cited by 4
A Review of Genes Associated with Obesity Susceptibility: Findings from Association Studies
Veerabathiran, R., Sivakumar, S., Kalarani, I. B., & Mohammed, V. (2023) · Journal of Health Science and Medical Research · doi:10.31584/jhsmr.2023959 · Cited by 4
Overview of paediatric obesity for the paediatric mental health provider
Scheimann, A. O. (2012) · International Review of Psychiatry · doi:10.3109/09540261.2012.678816 · Cited by 4
“Analyses of families participating in the Framingham study identified a common polymorphism in the insulin induced gene 2 (iNSiG2) associated with the development of obesity (Herbert et al., 2006); studies are underway to confirm these findings.”
Background
Systems genetics: challenges and developing strategies
Li, H., & Zhang, P. (2012) · Biologia · doi:10.2478/s11756-012-0026-9 · Cited by 5
Testing for direct genetic effects using a screening step in family-based association studies
Lutz, S. M., Vansteelandt, S., & Lange, C. (2013) · Frontiers in Genetics · doi:10.3389/fgene.2013.00243 · Cited by 4
“We evaluated the practical relevance of the proposed adjustment principle by an application to the Framingham Heart Study with 1400 probands (Herbert et al., 2006).”
The role of modifiable, self-empowerment-oriented variables to promote health-related quality of life among inadequately insured Americans
Wippold, G. M., & Frary, S. G. (2021) · The Journal of prevention · doi:10.1007/s10935-021-00652-1 · Cited by 4
“…(Hekler et al., 2020), insofar as health behaviors and environmental factors predict 70% of an individual’s variability in health, with the remaining 30% explained by biological factors (Gakidou et al., 2017; Hekler et al., 2020; Herbert et al., 2006; McGinnis, Williams-Russo & Knickman, 2002).”
Background
Polycystic ovary syndrome is linked with the fat mass obesity (FTO) gene variants rs17817449 and rs1421085 in western Saudi Arabia
Bakhashab, S. (2021) · Bioinformation · doi:10.6026/97320630017904 · Cited by 4
Processing Large-Scale, High-Dimension Genetic and Gene Expression Data
Molony, C. M., Sieberts, S. K., & Schadt, E. E. (2009) · Springer eBooks · doi:10.1007/978-3-540-69264-5_11 · Cited by 4
“The availability of low-cost, high-throughput technologies for genotyping hundreds of thousands of DNA markers has led to a number of successes in identifying associations between these markers and complex traits like age-related macular degeneration [1‐3], diabetes [4, 5], and obesity [ 6 ], validating the GWAS appro…”
Background
A Novel Approach to Latent Class Modelling: Identifying the Various Types of Body Mass Index Individuals
Brown, S., Greene, W. H., & Harris, M. N. (2020) · Journal of the Royal Statistical Society Series A (Statistics in Society) · doi:10.1111/rssa.12552 · Cited by 4
Functional Genomics and Its Implications for Molecular Medicine
Broeckel, U., Maresso, K. C., & Kugathasan, S. (2006) · Pediatric Clinics of North America · doi:10.1016/j.pcl.2006.08.007 · Cited by 4
Ovine insulin induced-gene-2: molecular characterization, polymorphisms and association with milk traits
Luridiana, S., Mura, M. C., Cosso, G., Daga, C., Bodano, S., Diaz, M. L., Bini, P. P., & Carcangiu, V. (2014) · Molecular Biology Reports · doi:10.1007/s11033-014-3353-9 · Cited by 4
“In human, several studies found that INSIG-2 genetic polymorphisms are associated with weight gain, obesity and hypercholesterolemia [10].”
Background
Association between intramuscular fat in the arm following arm training and INSIG2
Popadić-Gaćeša, J., Secher, N. H., Momcilovic, M., & Grujic, N. G. (2013) · Scandinavian Journal of Medicine and Science in Sports · doi:10.1111/sms.12102 · Cited by 4
Understanding type 1 diabetes genetics - approaches for identification of susceptibility genes in multi-factorial diseases.
Bergholdt, R. (2009) · PubMed · Cited by 4
MOLECULAR GENETIC STUDIES OF MELANOCORTIN RECEPTORS IN MORBID OBESITY
Valli‐Jaakola, K. (2007) · Työväentutkimus Vuosikirja · Cited by 4
Optimization Methods for Genotype Data Analysis in Epidemiological Studies
Brinza, D., He, J., & Zelikovsky, A. (2007) · doi:10.1002/9780470253441.ch18 · Cited by 4
Discrete Methods for Association Search and Status Prediction in Genotype Case-Control Studies
Brinza, D., & Zelikovsky, A. (2007) · IEEE International Conference on Bioinformatics and Bioengineering (BIBE) · doi:10.1109/bibe.2007.4375576 · Cited by 4
“searches for disease-associated gene variations have been recently reported [12], [18].”
Background
Postharvest Changes in Ammonium, Glutamine Synthetase and Glutamate Dehydrogenase in Asparagus Spears during Storage at 20°C
Enriquez, F. G., Matsui, T., Bhowmik, P., & Kawada, K. (2001) · Pakistan Journal of Biological Sciences · doi:10.3923/pjbs.2001.293.297 · Cited by 4
Discrete algorithms for analysis of genotype data
Zelikovsky, A., & Brinza, D. (2007) · Cited by 3
Ancestral susceptibility to colorectal cancer
Huhn, S., Pardini, B., Naccarati, A., Vodička, P., Hemminki, K., & Försti, A. (2012) · Mutagenesis · doi:10.1093/mutage/ger061 · Cited by 3
Obesity and Neuroinflammation
Kaur, G., Sharma, A., Gupta, M., & Kaur, T. (2016) · Springer eBooks · doi:10.1007/978-981-10-1711-7_12 · Cited by 3
Suchtaspekte bei Adipositas
Kiefer, F., & Grosshans, M. (2014) · Springer eBooks · doi:10.1007/978-3-642-38364-9_6 · Cited by 3
Association of a genetic polymorphism in ectonucleotide pyrophosphatase/phosphodiesterase 1 with hepatitis C virus infection and hepatitis C virus core antigen levels in subjects in a hyperendemic area of Japan
Takahama, Y., Uto, H., Kanmura, S., Oketani, M., Ido, A., Kusumoto, K., Hasuike, S., Nagata, K., Hayashi, K., Stuver, S. O., et al. (2008) · Journal of Gastroenterology · doi:10.1007/s00535-008-2256-8 · Cited by 3
“We also evaluated the rs7566605 genotype located near the INSIG2 gene.(12) Genotyping of the G→C SNP (rs7566605) was performed with the primers rs7566605-F (AGTAGGGTGAGGAAACCAAATTCTC) and rs7566605-R (CATGACCCCTACCGTCTCTATTTT), and the probes rs7566605-VIC (ACAGAGATGTTA CATCAC labeled with the dye VIC) and rs7566605FA…”
BackgroundMethod
Genomewide Association Studies
Bracken, M. B., DeWan, A. T., & Hoh, J. J. (2008) · CRC Press eBooks · doi:10.3109/9781420052923-16 · Cited by 3
Impact of Population Stratification on Family-Based Association Tests with Longitudinal Measurements
Ding, X. X., Weiss, S. T., Raby, B. A., Lange, C., & Laird, N. M. (2009) · Statistical Applications in Genetics and Molecular Biology · doi:10.2202/1544-6115.1398 · Cited by 3
Discovering the genetic determinants of complex diseases
Padmanabhan, S., Menni, C., Prabhakaran, D., & Dominiczak, A. F. (2009) · Research Portal (King's College London) · Cited by 3
Genética de la obesidad
Tejero, M. E. (2008) · Boletín Médico del Hospital Infantil de México · Cited by 3
Statistical challenges for genome-wide association studies of suicidality using family data
Lasky-Su, J. A., & Lange, C. (2010) · European Psychiatry · doi:10.1016/j.eurpsy.2009.12.019 · Cited by 3
“There are two distinctly different designs for genetic studies: the family-based study design and designs that use unrelated individuals, both of which have their strength and weaknesses with regard to genome-wide association studies (GWAS).”
BackgroundMethodInfluential
A three-stage approach for genome-wide association studies with family data for quantitative traits
Chen, M., Larson, M. G., Hsu, Y., Peloso, G. M., Guo, C., Fox, C. S., Atwood, L. D., & Yang, Q. (2010) · BMC Genetics · doi:10.1186/1471-2156-11-40 · Cited by 3
“[18] presents an application of the two-stage FBAT approach of [17].”
Method
Primäre Prävention der Adipositas bei Erwachsenen
Hilbert, A., Ried, J., Schneider, D., Juttner, C., Sosna, M., Dabrock, P., Lingenfelder, M., Voit, W., Rief, W., & Hebebrand, J. (2007) · Herz · doi:10.1007/s00059-007-3011-2 · Cited by 3
Using the longest significance run to estimate region-specific p-values in genetic association mapping studies
Lian, I., Lin, Y.-H., Lin, Y.-C., Yang, H., Chang, C., & Fann, C. S. J. (2008) · BMC Bioinformatics · doi:10.1186/1471-2105-9-246 · Cited by 3
“Optimal study design in whole genome association remains unresolved although the two-stage association test design has gained popularity [5,6].”
Background
Family-Based Association Tests with Longitudinal Measurements: Handling Missing Data
Ding, X. X., & Laird, N. M. (2009) · Human Heredity · doi:10.1159/000212502 · Cited by 3
Association of an INSIG2 obesity allele with cardiovascular phenotypes is gender and age dependent
Skelding, K. A., Gerhard, G. S., Vlachos, H., Selzer, F., Kelsey, S. F., Chu, X., Erdman, R., Williams, D. O., & Kip, K. E. (2010) · BMC Cardiovascular Disorders · doi:10.1186/1471-2261-10-46 · Cited by 3
“In addition, a common single nucleotide polymorphism (SNP rs7566605) near the INSIG2 gene was found to be associated with BMI in a genome-wide association study from the Framingham Heart Study offspring cohort [5].”
Background
Genetics of Type 2 Diabetes
Grant, S. F. A. (2015) · Springer eBooks · doi:10.1007/978-3-319-12125-3_11-1 · Cited by 3
Perspectives on human health and disease from evolutionary and behavioral ecology
Strassmann, B. I., & Mace, R. H. (2007) · Oxford University Press eBooks · doi:10.1093/acprof:oso/9780199207466.003.0009 · Cited by 3
An Improved Markov Blanket Approach to Detect SNPs-Disease Associations in Case-Control Studies
-, L. Y., & Luo, J. (2012) · International Journal of Digital Content Technology and its Applications · doi:10.4156/jdcta.vol6.issue15.32 · Cited by 3
Linkage disequilibrium in wild mice
Laurie, C. C., Nickerson, D. A., Anderson, A. D., Weir, B. S., Livingston, R. J., Dean, M. D., Smith, K. L., Schadt, E. E., & Nachman, M. W. (2005) · PLoS Genetics · doi:10.1371/journal.pgen.0030144.eor · Cited by 3
On the parsing of statistical information in family-based association testing
McQueen, M. B., Weiss, S. T., Laird, N. M., & Lange, C. (2007) · Nature Genetics · doi:10.1038/ng0307-281 · Cited by 3
Analysis of Quantitative Trait Loci
Falchi, M. (2008) · Methods in molecular biology · doi:10.1007/978-1-60327-429-6_16 · Cited by 3
Basic Molecular Techniques for the Detection of Single Nucleotide Polymorphisms: Genome-Wide Applications in Search for Endocrine Tumor Related Genes
Horvath, A., & Stratakis, C. A. (2009) · Methods in molecular biology · doi:10.1007/978-1-60327-378-7_9 · Cited by 3
RNA-sequencing of human post-mortem hypothalamus and nucleus accumbens identifies expression profiles associated with obesityPreprint
Wake, C., Schneider, J. A., Stein, T. D., Bregu, J., Labadorf, A. T., McKee, A. C., Jager, P. L. D., Bennett, D. A., Seshadri, S. S., Myers, R. H., et al. (2022) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2022.01.08.473382 · Cited by 4
“Many genome-wide association studies (GWAS) [3–14] have been conducted in order to find specific sequence variants associated with obesity, and at least 75 genetic loci have been identified [15, 16].”
BackgroundInfluential
Navigating Cardiovascular Challenges of Obesity: Exploring Preventive Approaches
Sinha, V., Roy, S., Shinde, S., Mondal, D., Dixit, V., Dwivedi, D., Pandey, S. K., Gupta, R., Vishwakarma, N. K., & Shukla, D. (2025) · Endocrine Metabolic & Immune Disorders - Drug Targets · doi:10.2174/0118715303317750250210055338 · Cited by 3
Host genetics and nutrition
Odriozola, A., González, A., Álvarez‐Herms, J., & Corbi, F. (2024) · Advances in genetics · doi:10.1016/bs.adgen.2024.03.001 · Cited by 3
Population-Based Association Studies
Zhu, X., & Zhang, S. (2009) · Springer eBooks · doi:10.1007/978-3-540-69264-5_6 · Cited by 2
Gender-Specific Effect of -102G>A Polymorphism in Insulin Induced Gene 2 on Obesity in Chinese Children
Liu, F., Song, J., Zhang, Y., Ma, J., & Wang, H. (2015) · International Journal of Endocrinology · doi:10.1155/2015/872506 · Cited by 2
“[2] reported that a common variation (rs7566605) located 10 kb upstream of insulin induced gene 2 (INSIG2) was associated with obesity in the first obesity genome-wide association study (GWAS) in 2006.”
Background
Identification of Interacting Genes in Genome‐Wide Association Studies Using a Model‐Based Two‐Stage Approach
Zhang, Z., Niu, A., & Sha, Q. (2010) · Annals of Human Genetics · doi:10.1111/j.1469-1809.2010.00594.x · Cited by 2
“Genome-wide association (GWA) studies have identiﬁed loci for cardiac repolarisation (QT interval) (Arking et al., 2006), type 2 diabetes (Sladek et al., 2007), and BMI (Herbert et al., 2006).”
Background
Genome-wide association study on complex diseases:study design and genetic markers
Yan, W. (2008) · Hereditas (Beijing) · doi:10.3724/sp.j.1005.2008.00400 · Cited by 2
“[DOI] [2] Herbert A, Gerry NP, McQueen MB, Heid IM, Pfeufer A,”
Background
INSIG2 is Associated with Lower Gain in Weight-for-Length between Birth and Age 6 Months
Wu, A. C., Gillman, M. W., Taveras, E. M., & Litonjua, A. A. (2009) · Clinical Medicine Insights Pediatrics · doi:10.4137/cmped.s2279 · Cited by 2
Genetics of Obesity in Childhood and Adolescence
Böttcher, Y., & Kovacs, P. L. (2015) · Pediatric and adolescent medicine · doi:10.1159/000368103 · Cited by 2
Upstream genetic variant nearINSIG2, influences response to carnitine supplementation in bipolar patients with valproate-induced weight gain
Doudney, K., Harley, J. L., Pearson, J. F., Miller, A. L., Aitchison, A., Kennedy, M. A., Porter, R., Elmslie, J., & Joyce, P. R. (2009) · Acta Neuropsychiatrica · doi:10.1111/j.1601-5215.2009.00379.x · Cited by 2
“Association of the SNP rs7566605 and weight gain was first seen in related individuals from the Framingham Heart Study (18) where the authors went on to speculate that the SNP rs7566605 may affect regulation of the gene in closest proximity: insulin-induced gene 2 (INSIG2 ; (18,19)).”
BackgroundInfluential
The Study of Eating behavior and Genetic Factors that Cause Masked Obesity in Young Women
Nishimura, S., Miyabayashi, S., & Takii, Y. (2010) · Journal for the Integrated Study of Dietary Habits · doi:10.2740/jisdh.21.217 · Cited by 2
Health consequences of ecogenetic variation
Bamshad, M. J., & Motulsky, A. G. (2007) · Oxford University Press eBooks · doi:10.1093/acprof:oso/9780199207466.003.0004 · Cited by 2
Obesity and anorexia
van Dijk, G., & Kas, M. J. (2014) · Cambridge University Press eBooks · doi:10.1017/9781107360556.005 · Cited by 2
2015 ASHG Awards and Addresses
(2016) · The American Journal of Human Genetics · doi:10.1016/j.ajhg.2016.01.013 · Cited by 2
Nutrition and Diet in the Era of Genomics
Ordovás, J. M., & Corella, D. (2009) · Elsevier eBooks · doi:10.1016/b978-0-12-369420-1.00098-6 · Cited by 2
Identification of leptin gene variants in school children with early onset obesity.
Kongmacheep, P., Sirikulchayanonta, C., Tungtrongchitr, R., & Hancharoen, K. (2009) · PubMed · Cited by 2
Dickes Leben
Hollenrieder, V. (2017) · Springer eBooks · doi:10.1007/978-3-662-53058-0_5 · Cited by 2
Application of Genetic Epidemiology to Understanding Pediatric Obesity
Mair, R. D., & McGarvey, S. T. (2008) · Issues in clinical child psychology · doi:10.1007/978-0-387-76924-0_11 · Cited by 2
Genome-Wide Association Studies of Obesity
Hedman, Å. K., Lindgren, C. M., & McCarthy, M. I. (2013) · Springer eBooks · doi:10.1007/978-1-4614-8642-8_3 · Cited by 2
Bedeutung der Genetik beim Thema "soziale Ungleichheit und Gesundheit"
Mielck, A., & Rogowski, W. H. (2007) · Bundesgesundheitsblatt - Gesundheitsforschung - Gesundheitsschutz · doi:10.1007/s00103-007-0139-4 · Cited by 2
Concerns over 'shifting sands' linger as genetic testing expands
Khamsi, R. (2008) · Nature Medicine · doi:10.1038/nm0608-589 · Cited by 2
Mankind adaptation and present human health
Contaldo, F., & Auricchio, S. (2008) · Internal and Emergency Medicine · doi:10.1007/s11739-008-0171-x · Cited by 2
Quantitative Trait Loci Mapping
Xiong, D.-H., Liu, J., Guo, Y.-F., Guo, Y., Yang, T., Jiang, H., Chen, Y., Yang, F., Recker, R. R., & Deng, H. (2008) · Methods in molecular biology · doi:10.1007/978-1-59745-104-8_16 · Cited by 3
Evolutionary origins of diversity in human viruses
Sharp, P. M., Bailes, E., & Wain, L. V. (2007) · Oxford University Press eBooks · doi:10.1093/acprof:oso/9780199207466.003.0013 · Cited by 2
Eating Behaviors in Obesity: The Role of Appetite
Carnell, S., Benson, L., & Wardle, J. (2012) · doi:10.1002/9781394323142.ch9 · Cited by 2
Understanding the Early Signs of Chronic Disease by Investigating the Overlap of Mental Health Needs and Adolescent Obesity
PhD, T. C. S. M., & PhD, B. S. M. (2015) · AIMS Public Health · doi:10.3934/publichealth.2015.3.487 · Cited by 1
“Numerous efforts are underway to identify genetic predispositions even while other research suggests the environment to be as likely an influential factor in childhood or adolescent obesity [22,27,28].”
Background
Genetics of Nonsyndromic Human Obesity, With Suggestions for New Studies From Work in Mouse Models
Warden, C. H., & Fisler, J. S. (2017) · Elsevier eBooks · doi:10.1016/b978-0-12-802928-2.00021-7 · Cited by 1
Association of common genetic variants with body mass index in Russian population
Berseneva, A. A., Kovalenko, E. V., Vergasova, E., Prohorov, A., Popov, I., Ilinskaya, A. Y., Kim, A., Plotnikov, N. A., Elmuratov, A. U., Ilinsky, V. V., et al. (2023) · European Journal of Clinical Nutrition · doi:10.1038/s41430-023-01265-z · Cited by 1
“[13] on BMI identified a variant in the INSIG2 (insulin-induced gene 2), which, however, did not reach the whole genome significance and was not identified in either [14–17] or in further wholegenome studies.”
Background
Das nationale Genomforschungsnetz
Bickeböller, H. (2007) · Bundesgesundheitsblatt - Gesundheitsforschung - Gesundheitsschutz · doi:10.1007/s00103-007-0137-6 · Cited by 1
“Die Forschergruppe um Professor Johannes Hebebrand und Anke Hinney (Universität Duisburg-Essen) verbindet den Ansatz der Positionsklonierung mit Methoden der genetischen Epidemiologie, um Gene für Fettleibigkeit (Adipositas) aufzuspüren [13, 14, 15, 16].”
Background
Genes and Human Obesity
Price, R. A. (2010) · Springer eBooks · doi:10.1007/978-1-4419-1607-5_7 · Cited by 1
“The first few had relatively low genome coverage and found no associations that met a genome-wide level of significance (2 × 10 –7 ) [28, 29 ].”
Background

Authors: Herbert, A., Gerry, N. P., McQueen, M. B., Heid, I. M., Pfeufer, A., Illig, T., Wichmann, H.-E., Meitinger, T., Hunter, D., Hu, F. B., Colditz, G., Hinney, A., Hebebrand, J., Koberwitz, K., Zhu, X., Cooper, R., Ardlie, K., Lyon, H., Hirschhorn, J. N., Laird, N. M., Lenburg, M. E., Lange, C., & Christman, M. F.
Affiliations: Boston University (US)
Corresponding author: Herbert, Alan
Christman, Michael F.
ORCID: Herbert, Alan
McQueen, Matthew B.
Heid, Iris M.
Wichmann, H.-Erich
Meitinger, Thomas
Hu, Frank B.
Colditz, Graham
Hinney, Anke
Hebebrand, Johannes
Zhu, Xiaofeng
Cooper, Richard
Ardlie, Kristin
Hirschhorn, Joel N.
Laird, Nan M.
Lenburg, Marc E.
Lange, Christoph
Venue: Science
Publisher: American Association for the Advancement of Science (AAAS)
Published: 2006-04-14
Volume: 312
Issue: 5771
Pages: 279-283
ISSN: 0036-8075 (ISSN-L)
1095-9203
DOI: 10.1126/science.1124779
OpenAlex: W2149512324
Cited by: 732
References: 32
Citations by year: 2026: 2 · 2025: 5 · 2024: 2 · 2023: 10 · 2022: 8 · 2021: 10 · 2020: 8 · 2019: 11 · 2018: 2 · 2017: 17 · 2016: 19 · 2015: 28 · 2014: 30 · 2013: 37 · 2012: 39
FWCI: 75.55
Type: journal article
Language: en
Open access: closed
Locations: Science (publishedVersion)
PubMed (publishedVersion)
Civil War Book Review (submittedVersion)
mediaTUM – the media and publications repository of the Technical University Munich (Technical University Munich) (submittedVersion)
Site cant be reached (submittedVersion)
Funders: National Heart, Lung, and Blood Institute (R01 HL54485, U01HL065899, R01HL066289, R01HL66289, R01HL074166, U01 HL65899)
National Institute of Mental Health (R01MH59532, R01MH059532)
National Cancer Institute (CA-87969, P01CA087969)
National Institute of General Medical Sciences (R01GM046877)
National Institute of Diabetes and Digestive and Kidney Diseases (P30DK046200, K23DK067288, P30 DK-46200)
Eunice Kennedy Shriver National Institute of Child Health and Human Development (R01HD060726)
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Genetic Associations and Epidemiology
Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Genetics and Physical Performance
Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Nutrition, Genetics, and Disease
Keywords: obesity, genetic association, INSIG2, childhood obesity, adult obesity, type 2 diabetes risk, whole genome scan, Framingham Heart Study, African Americans
MeSH terms: Adult, Alleles, Black or African American, Child, Europe, Female, Gene Frequency, Genes, Recessive, Genotype, Haplotypes, Humans, Male, Membrane Proteins, Models, Genetic, Obesity, Genetic Variation, Cohort Studies, Linkage Disequilibrium, Body Mass Index, Case-Control Studies, Genetic Predisposition to Disease, Oligonucleotide Array Sequence Analysis, Polymorphism, Single Nucleotide, White People, Intracellular Signaling Peptides and Proteins

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

A common genetic variant is associated with adult and childhood obesity.

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Citations

Cites

Cited by

Related

Metadata

Record

About these checks