Cited by 209Salmonella and Campylobacter epidemiologyAntibiotic Resistance in BacteriaBacterial Genetics and Biotechnology

The DOI matches its Crossref record; 52 of the 52 references it cites were found in a registry or an index.

Characterization of Variant Salmonella Genomic Island 1 Multidrug Resistance Regions from Serovars Typhimurium DT104 and Agona

Open access

Boyd, David, Cloeckaert, Axel, Chaslus-Dancla, Elisabeth, Mulvey, Michael R.·2002·Antimicrobial Agents and Chemotherapy

DOI 10.1128/aac.46.6.1714-1722.2002PMC PMC127246

Open this paper in CoChat — free account

Abstract

Strains of multidrug-resistant Salmonella enterica serovar Typhimurium DT104 (DT104) and S. enterica serovar Agona (Agona) have been found to harbor Salmonella genomic island 1 (SGI1), a 43-kb genomic region that contains many of the drug resistance genes. Such strains are resistant to ampicillin (pse-1), chloramphenicol/florfenicol (floR), streptomycin/spectinomycin (aadA2), sulfonamides (sul1), and tetracycline [tet(G)] (commonly called the ACSSuT phenotype). All five resistance genes are found in a 13-kb multidrug resistance (MDR) region consisting of an unusual class I integron structure related to In4. We examined DT104 and Agona strains that exhibited other resistance phenotypes to determine if the resistance genes were associated with variant SGI1 MDR regions. All strains were found to harbor variant SGI1-like elements by using a combination of Southern hybridization, PCR mapping, and sequencing. Variant SGI1-like elements were found with MDR regions consisting of (i) an integron consisting of the SGI1 MDR region with the addition of a region containing a putative transposase gene (orf513) and dfrA10 located between duplicated qacE Δ 1/sulI genes (SGI1-A; ACSSuTTm); (ii) an integron with either an aadA2(SSu) or a pse-1(ASu) cassette (SGI1-C and SGI1-B, respectively); (iii) an integron consisting of the SGI1-C MDR region plus an orf513/dfrA10 region as in SGI1-A (SGI1-D; ASSuTm; ampicillin resistance due to a TEM β-lactamase); and (iv) an integron related to that in SGI1 but which contains a 10-kb inversion between two copies of IS 6100, one which is inserted in floR(SGI1-E; ASSuT). We hypothesize that the MDR of SGI1 is subject to recombinational events that lead to the various resistance phenotypes in the Salmonella strains in which it is found.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1128/aac.46.6.1714-1722.2002

Cites

52 of 52 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

Gapped BLAST and PSI-BLAST: a new generation of protein database search programs
Altschul, S. (1997) · Nucleic Acids Research · doi:10.1093/nar/25.17.3389 · Cited by 73,302
National Committee for Clinical Laboratory Standards
Bruck, E. (1980) · PEDIATRICS · doi:10.1542/peds.65.1.187 · Cited by 14,736
Insertion Sequences
Mahillon, J., & Chandler, M. (1998) · Microbiology and Molecular Biology Reviews · doi:10.1128/mmbr.62.3.725-774.1998 · Cited by 1,292
Emergence of Multidrug-ResistantSalmonella entericaSerotypeTyphimurium DT104 Infections in the United States
Glynn, M. K., Bopp, C. A., DeWitt, W. E., Dabney, P., Mokhtar, M., & Angulo, F. J. (1998) · New England Journal of Medicine · doi:10.1056/nejm199805073381901 · Cited by 615
An Outbreak of Multidrug-Resistant, Quinolone-ResistantSalmonella entericaSerotype Typhimurium DT104
Mølbak, K., Baggesen, D. L., Aarestrup, F. M., Ebessen, J. M., Engberg, J., Frydendahl, K., Gerner‐Smidt, P., Petersen, A. M., & Wegener, H. C. (1999) · New England Journal of Medicine · doi:10.1056/nejm199911043411902 · Cited by 491
Integrons and Gene Cassettes in the Enterobacteriaceae
White, P. A., McIver, C. J., & Rawlinson, W. D. (2001) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.45.9.2658-2661.2001 · Cited by 467
Complete Nucleotide Sequence of a 43-Kilobase Genomic Island Associated with the Multidrug Resistance Region of Salmonella enterica Serovar Typhimurium DT104 and Its Identification in Phage Type DT120 and Serovar Agona
Boyd, D., Peters, G. A., Cloeckaert, A., Boumedine, K. S., Chaslus-Dancla, E., Imberechts, H., & Mulvey, M. R. (2001) · Journal of Bacteriology · doi:10.1128/jb.183.19.5725-5732.2001 · Cited by 414
Self-citation
Class 1 Integrons, Gene Cassettes, Mobility, and Epidemiology
Fluit, A. C., & Schmitz, F.-J. (1999) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s100960050398 · Cited by 334
Molecular Characterization of an Antibiotic Resistance Gene Cluster of Salmonella typhimurium DT104
Briggs, C. E., & Fratamico, P. M. (1999) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.43.4.846 · Cited by 316
Characterisation of integrons and antibiotic resistance genes in Danish multiresistantSalmonella entericaTyphimurium DT104
Sandvang, D., Aarestrup, F. M., & Jensen, L. B. (1998) · FEMS Microbiology Letters · doi:10.1111/j.1574-6968.1998.tb12887.x · Cited by 275

Show all 52 references

Research works printed but not linked: 2

Ng, L.-K., R. Khakhria, D. Woodward, and W. Johnson. 1997. National laboratory surveillance of enteric pathogens. Can. J. Infect. Dis.8:133-136.
Threlfall, E. J., L. R. Ward, and B. Rowe. 1998. Multiresistant Salmonella typhimurium DT104 and salmonella bacteremia. Lancet352:287-288.

Sorted by citations

Items 101–200 of 209

Loss of outer membrane protein A (OmpA) impairs the survival of Salmonella Typhimurium by inducing membrane damage in the presence of ceftazidime and meropenem
Chowdhury, A. R., Mukherjee, D., Singh, A. K., & Chakravortty, D. (2022) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dkac327 · Cited by 31
Analysis of Salmonella Agona and Salmonella Weltevreden in Malaysia by PCR fingerprinting and antibiotic resistance profiling
Lee, L., Cheah, Y. K., Salleh, N. A., Sukardi, S., Sim, J.-H., Khoo, C.-H., & Radu, S. (2008) · Antonie van Leeuwenhoek · doi:10.1007/s10482-008-9254-y · Cited by 33
Prevalence and Genetic Properties ofSalmonella entericaSerovar Typhimurium Definitive Phage Type 104 Isolated fromRattus norvegicusandRattus rattusHouse Rats in Yokohama City, Japan
Yokoyama, E., Maruyama, S., Kabeya, H., Hara, S., Sata, S., Kuroki, T., & Yamamoto, T. (2007) · Applied and Environmental Microbiology · doi:10.1128/aem.02465-06 · Cited by 32
“The absence of DT104 strains with the ACSSuT or SSu resistance pattern in building YS suggests that DT104 strains with the ASu resistance pattern in building YS may have originated from ACSSuT strains by a single crossover at intI1 (3) before DT104 spread in this building.”
Background
IS6100-mediated genetic rearrangement within the complex class 1 integron In104 of the Salmonella genomic island 1
Targant, H., Doublet, B., Aarestrup, F. M., Cloeckaert, A., & Madec, J.-Y. (2010) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dkq163 · Cited by 32
Self-citation
The influence mechanism of phospholipids structure and composition changes caused by oxidation on the formation of flavor substances in sturgeon caviar
Zhang, W., Jiang, X., Liu, L., Zhao, Y., Bai, F., Wang, J., Gao, R., & Xu, X. (2024) · Food Chemistry · doi:10.1016/j.foodchem.2024.140585 · Cited by 30
Characterization of the emerging multidrug-resistant Salmonella enterica serovar Indiana strains in China
Gong, J., Zeng, X., Zhang, P., Zhang, D., Wang, C., & Lin, J. (2019) · Emerging Microbes & Infections · doi:10.1080/22221751.2018.1558961 · Cited by 30
“in which the primers of U7-L12/LJ-R1, 104-RJ/C9-L2 and U7-L12/104-D target the SGI1 left junction, right junction and across junction, respectively [36].”
European clinical isolate of Proteus mirabilis harbouring the Salmonella genomic island 1 variant SGI1-O
Doublet, B., Poirel, L., Praud, K., Nordmann, P., & Cloeckaert, A. (2010) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dkq283 · Cited by 30
Self-citation
Identification of putative ancestors of the multidrug-resistant Salmonella enterica serovar typhimurium DT104 clone harboring the Salmonella genomic island 1
Matiasovicova, J., Adams, P., Barrow, P., Hradecká, H., Malcova, M., Karpíšková, R., Budínská, E., Pilousová, L., & Rychlı́k, I. (2006) · Archives of Microbiology · doi:10.1007/s00203-006-0205-6 · Cited by 30
“Finally, due to the activity of IS6100, a part of SGI1, more recent genome modiWcation of this clone continues, as can be documented, either by the formation of a chloramphenicol-sensitive SGI1 E variant (Boyd et al. 2002) or loss of the retron reverse transcriptase locus (Pilousova et al.”
Background
Molecular Epidemiological Analysis and Microbial Source Tracking of Salmonella enterica Serovars in a Preharvest Turkey Production Environment
Nayak, R., & Stewart-King, T. (2008) · Foodborne Pathogens and Disease · doi:10.1089/fpd.2007.0029 · Cited by 29
“Furthermore, Salmonella strains can acquire resistance to antimicrobials due to mutations and acquisitionsofresistanceencodinggenecassettes and integrons (Class 1 and 2), which contain components of a site-specific recognition system that is capable of recognizing and capturing mobile gene cassettes (Boyd et al., 2002…”
Nontyphoidal Salmonella causing focal infections in patients admitted at a Spanish general hospital during an 11-year period (1991–2001)
Rodríguez, M., de Diego, I., Martínez, N., Rodicio, M. R., & Mendoza, M. C. (2006) · International Journal of Medical Microbiology · doi:10.1016/j.ijmm.2006.01.068 · Cited by 29
The effect of the Salmonella genomic island 1 on in vitro global gene expression in Salmonella enterica serovar Typhimurium LT2
Golding, G. R., Olson, A. B., Doublet, B., Cloeckaert, A., Christianson, S., Graham, M., & Mulvey, M. R. (2006) · Microbes and Infection · doi:10.1016/j.micinf.2006.10.004 · Cited by 28
Self-citation
Characterization of florfenicol resistance among calf pathogenic Escherichia coli
Du, X., Xia, C., Shen, J., Wu, B., & Shen, Z. (2004) · FEMS Microbiology Letters · doi:10.1111/j.1574-6968.2004.tb09645.x · Cited by 28
Multidrug-resistantSalmonellaJava
Threlfall, J. E., Levent, B., Hopkins, K. L., de Pinna, E., Ward, L. R., & Brown, D. (2005) · Emerging infectious diseases · doi:10.3201/eid1101.031092 · Cited by 27
“This resistance gene cluster has also been identified in strains of S. Agona from poultry in Belgium (6), in a strain of S. Paratyphi B from tropical fish in Singapore (7), and a variant cluster in a strain of S. Albany from fish food from Thailand (8).”
Background
Antimicrobial susceptibility phenotypes, resistance determinants and DNA fingerprints of Salmonella enterica serotype Typhimurium isolated from bovine in Southern Japan
Shahada, F., Amamoto, A., CHUMA, T., Shirai, A., & OKAMOTO, K. (2007) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2007.03.017 · Cited by 26
Antimicrobial Resistance and Phage and Molecular Typing of Salmonella Strains Isolated from Food for Human Consumption in Spain
Valdezate, S., Arroyo, M., González-Sanz, R., Ramiro, R., Herrera-León, S., Usera, M. A., Fuente, M. D. L., & Echeíta, A. (2007) · Journal of Food Protection · doi:10.4315/0362-028x-70.12.2741 · Cited by 26
Genomic Diversity, Antimicrobial Resistance, Plasmidome, and Virulence Profiles of Salmonella Isolated from Small Specialty Crop Farms Revealed by Whole-Genome Sequencing
Bhandari, M., Poelstra, J. W., Kauffman, M. D., Varghese, B., Helmy, Y. A., Scaria, J., & Rajashekara, G. (2023) · Antibiotics · doi:10.3390/antibiotics12111637 · Cited by 25
“Interestingly, S. Dublin and S. Newport harbored the ACSSuT cassette, which confers resistance to ampicillin, chloramphenicol, streptomycin, sulfonamides, and tetracyclines, on a plasmid [35].”
Background
Microbiological study of biofilm formation in isolates of Salmonella enterica Typhimurium DT104 and DT104b cultured from the modern pork chain
O'Leary, D., McCabe, E. M., McCusker, M. P., Martins, M., Fanning, S., & Duffy, G. (2012) · International Journal of Food Microbiology · doi:10.1016/j.ijfoodmicro.2012.11.021 · Cited by 25
Characterization of florfenicol resistance among calf pathogenic Escherichia coli
Du, X. (2004) · FEMS Microbiology Letters · doi:10.1016/j.femsle.2004.05.013 · Cited by 25
Studies on seasonal dynamics of soil-higher fungal communities in Mongolian oak-dominant Gwangneung forest in Korea
Kim, C. S., Nam, J.-W., Jo, J. W., Kim, S.-Y., Han, J., Hyun, M. W., Sung, G., & Han, S. (2016) · The Journal of Microbiology · doi:10.1007/s12275-016-5521-1 · Cited by 24
Phenotypic and Genotypic Characterization of Salmonella enterica Recovered from Poultry Meat in Tunisia and Identification of New Genetic Traits
Soufi, L., Sáenz, Y., de Toro, M., Abbassi, M. S., Rojo‐Bezares, B., Vinué, L., Bouchami, O., Touati, A., Hassen, A. B., Hammami, S., et al. (2011) · Vector-Borne and Zoonotic Diseases · doi:10.1089/vbz.2011.0667 · Cited by 24
“Salmonella Genomic Island type 1 (Boyd et al. 2002, Carattoli et al. 2002, Miko et al. 2005, Vo et al. 2010).”
Background
Outer Membrane Proteins of Salmonella as Potential Markers of Resistance to Serum, Antibiotics and Biocides
Futoma-Kołoch, B., Bugla‐Płoskońska, G., Dudek, B., Dorotkiewicz‐Jach, A., Drulis‐Kawa, Z., & Gamian, A. (2018) · Current Medicinal Chemistry · doi:10.2174/0929867325666181031130851 · Cited by 23
The native Pseudomonas stutzeri strain Q chromosomal integron can capture and express cassette-associated genes
Coleman, N. V., & Holmes, A. J. (2005) · Microbiology · doi:10.1099/mic.0.27854-0 · Cited by 23
“Integrons have been observed in a diverse range of genetic elements, including transposons, plasmids, genomic islands, chromosomes and combinations thereof (Boyd et al., 2002; Hall & Collis, 1998; Hochhut et al., 2001; Liebert et al., 1999; Rowe-Magnus et al., 2001; Szczepanowski et al., 2004).”
Background
Lateral Gene Transfer in Evolution
Gophna, U. (2013) · Springer eBooks · doi:10.1007/978-1-4614-7780-8 · Cited by 25
Identification and Characterization of New Resistance-Conferring SGI1s (Salmonella Genomic Island 1) in Proteus mirabilis
Bie, L., Fang, M., Li, Z., Wang, M., & Xu, H. (2018) · Frontiers in Microbiology · doi:10.3389/fmicb.2018.03172 · Cited by 22
“SGI1-PmJN16 is derived from SGI1-Z with the MDR region containing a new gene cassette array dfrA12-orfF-aadA2-qacEM1-sul1-chrA-orf1.”
BackgroundInfluential
Determination and Analysis of the Putative AcaCD-Responsive Promoters of Salmonella Genomic Island 1
Murányi, G., Szabó, M., Olasz, F., & Kiss, J. (2016) · PLoS ONE · doi:10.1371/journal.pone.0164561 · Cited by 21
Genomic islands related to Salmonella genomic island 1; integrative mobilisable elements in trmE mobilised in trans by A/C plasmids
de Curraize, C., Siébor, E., & Neuwirth, C. (2021) · Plasmid · doi:10.1016/j.plasmid.2021.102565 · Cited by 20
Extended-spectrum β-Lactamase-producing Flora in Healthy Persons
Rodrigues, C. S., Shukla, U., Jog, S., & Mehta, A. P. (2005) · Emerging infectious diseases · doi:10.3201/eid1106.041111 · Cited by 20
Interpreting streptomycin susceptibility test results for Salmonella enterica serovar Typhimurium
Doran, G., NICHULAIN, M., DeLappe, N., O’Hare, C., Corbett-Feeney, G., & Cormican, M. (2006) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2006.03.005 · Cited by 20
“All isolates were tested by olymerase chain reaction (PCR) for genes strA, aadA1 and adA2 [12,13].”
BackgroundMethod
SalmonellaAgona Harboring Genomic Island 1-A
Doublet, B., Butaye, P., Imberechts, H., Collard, J., Chaslus-Dancla, E., & Cloeckaert, A. (2004) · Emerging infectious diseases · doi:10.3201/eid1004.030417 · Cited by 20
“These data are in accordance with the multidrug resistance phenotype of serovar Agona strain 02/01177 and indicate the presence of the variant antibiotic resistance gene cluster Salmonella genomic island 1-A (10).”
BackgroundResultInfluentialSelf-citation
Evidence for a Chromosomally Located Third Integron in Salmonella enterica Serovar Typhimurium DT104b
Daly, M., Buckley, J., Power, E., & Fanning, S. (2004) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.48.4.1350-1352.2004 · Cited by 20
“The corresponding determinants for multiple drug resistance (MDR) are clustered in part of a 43-kbp Salmonella genomic island 1 (SGI1) on the bacterial chromosome (1).”
BackgroundInfluential
IncC helper dependent plasmid-like replication of Salmonella Genomic Island 1
Szabó, M., Murányi, G., & Kiss, J. (2020) · Nucleic Acids Research · doi:10.1093/nar/gkaa1257 · Cited by 19
The consequences of a sudden demographic change on the seroprevalence pattern, virulence genes, identification and characterisation of integron-mediated antibiotic resistance in the Salmonella enterica isolated from clinically diarrhoeic humans in Egypt
Osman, K. M., HASSAN, W. M. M., & Mohamed, R. A. H. (2014) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-014-2072-4 · Cited by 18
“Class 1 integrons with resistance gene cassettes [77] have been detected worldwide in different serovars of Salmonella isolated from many different reservoirs [27, 78–88] and may be located on the socalled Salmonella genomic island 1 (SGI1) [27, 89, 90].”
Background
Real-Time PCRs and Fingerprinting Assays for the Detection and Characterization of Salmonella Genomic Island-1 Encoding Multidrug Resistance: Application to 445 European Isolates of Salmonella, Escherichia coli, Shigella , and Proteus
Amar, C., Arnold, C. E., Bankier, A. T., Dear, P. H., Guerra, B., Hopkins, K. L., Liébana, E., Mevius, D. J., & Threlfall, E. J. (2008) · Microbial Drug Resistance · doi:10.1089/mdr.2008.0812 · Cited by 19
“5,12 Previous PCR assays 4,10,14,19,29 for SGI-1 which rely on detecting the sequence of junctions between the island and the bacterial chromosome are not effective in non-Salmonella iso-lates, 1,12 and do not allow for possible divergence of SGI-1 from the single sequenced example.”
Genomic Analysis of Delftia tsuruhatensis Strain TR1180 Isolated From A Patient From China With In4-Like Integron-Associated Antimicrobial Resistance
Cheng, C., Zhou, W., Dong, X., Zhang, P., Zhou, K., Zhou, D., Qian, C., Lin, X., Li, P., Li, K., et al. (2021) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2021.663933 · Cited by 18
“Notably, the ISCR3-carrying In4-like element was initially described in the Salmonella genomic island 1 (SGI1) of S. enterica Typhymurium DT104 (Boyd et al., 2000; Boyd et al., 2002).”
Background
Characterization of Pathogenic and Resistant Genome Repertoire Reveals Two Clonal Lines in Salmonella enterica subsp. enterica Serovar Paratyphi B (+)-Tartrate Positive
Huehn, S., Helmuth, R., Bunge, C., Guerra, B., Junker, E., Davies, R. H., Wattiau, P., van Pelt, W., & Malorny, B. (2009) · Foodborne Pathogens and Disease · doi:10.1089/fpd.2008.0221 · Cited by 18
“Of the four multidrug-resistant Salmonella Paratyphi B dT þ O:5 þ isolates, three harbored SGI-1 previously described for Salmonella Typhimurium DT104 (Boyd et al. , 2002).”
Influential
Phage types, ribotypes and tetracycline resistance genes of Salmonella enterica subsp. enterica serovar Typhimurium strains isolated from different origins in Italy
Pasquali, F., Cesare, A. D., Ricci, A., Kehrenberg, C., Schwarz, Š., & Manfreda, G. (2004) · Veterinary Microbiology · doi:10.1016/j.vetmic.2004.07.007 · Cited by 18
Two New dfr Genes in Trimethoprim-Resistant Integron-Negative Escherichia coli Isolates
Grape, M., Sundström, L., & Kronvall, G. (2007) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.01273-06 · Cited by 18
Crucial role of Salmonella genomic island 1 master activator in the parasitism of IncC plasmids
Durand, R., Huguet, K. T., Rivard, N., Carraro, N., Rodrigue, S., & Burrus, V. (2021) · Nucleic Acids Research · doi:10.1093/nar/gkab204 · Cited by 17
Defying the odds: Determinants of the antimicrobial response of Salmonella Typhi and their interplay
Chowdhury, A. R., Mukherjee, D., Chatterjee, R., & Chakravortty, D. (2023) · Molecular Microbiology · doi:10.1111/mmi.15209 · Cited by 16
“Typhi are associated with the synthesis of β - lactamase enzymes that struc - turally alter and inactivate ampicillin (Boyd et al., 2002; Crump et al., 2015).”
Background
Conjugative IncC Plasmid Entry Triggers the SOS Response and Promotes Effective Transfer of the Integrative Antibiotic Resistance Element SGI1
Pons, M. C., Praud, K., Re, S. D., Cloeckaert, A., & Doublet, B. (2022) · Microbiology Spectrum · doi:10.1128/spectrum.02201-22 · Cited by 17
Self-citation
A multiplex oligonucleotide ligation-PCR as a complementary tool for subtyping of Salmonella Typhimurium
Wuyts, V., Mattheus, W., Roosens, N. H. C., Kathleen Marchal, D., Bertrand, S., & Keersmaecker, S. C. J. D. (2015) · Applied Microbiology and Biotechnology · doi:10.1007/s00253-015-6831-7 · Cited by 16
“1999) SAL-66-R TGCTTAGCTTCAAGTAAGACG 500 (Boyd et al. 2002) SNP 4213 yjeF SAL-71-F AGCCGGTCTGATTGAACAGG 60 200 616 This study SAL-71-R ATCCGCATCCCACAGCATAG 200 This study SNP TM2079 intergenic SAL-72-F TCAGAAGGAGGGAGCAA 55 200 701 (Hu et al.”
Mobile ISCR elements: Structure, functions, and role in emergence, increase, and spread of blocks of bacterial multiple antibiotic resistance genes
Ilyina, T. S. (2012) · Molecular Genetics Microbiology and Virology · doi:10.3103/s0891416812040040 · Cited by 16
DISSEMINATION OF SALMONELLA ENTERICA SEROTYPE AGONA AND MULTIDRUG-RESISTANT SALMONELLA ENTERICA SEROTYPE TYPHIMURIUM IN CUBA
Cabrera, R., Ruiz, J., Ramírez, M., Bravo, L., Fernández, A., Aladueña, A., Echeíta, A., Gascón, J., Alonso, P. L., & Vilà, J. (2006) · American Journal of Tropical Medicine and Hygiene · doi:10.4269/ajtmh.2006.74.1049 · Cited by 16
Distribution of integrons and SGI1 among antibiotic-resistant Salmonella enterica isolates of animal origin
Havlíčková, H., Hradecká, H., Bernardyová, I., & Rychlı́k, I. (2008) · Veterinary Microbiology · doi:10.1016/j.vetmic.2008.06.027 · Cited by 15
The Prevalences of Salmonella Genomic Island 1 Variants in Human and Animal Salmonella Typhimurium DT104 Are Distinguishable Using a Bayesian Approach
Mather, A., Denwood, M., Haydon, D., Matthews, L., Mellor, D., Coia, J., Brown, D., & Reid, S. (2011) · PLoS ONE · doi:10.1371/journal.pone.0027220 · Cited by 14
“SGI1-E 5 ASpStSxT blaPSE-1, sulI, aadA2, floR (interrupted), tetG [22]”
Characterization of Resistance Genes in Multidrug-Resistant Salmonella enterica Serotype Typhimurium Isolated from Diseased Cattle in France (2002 to 2007)
Targant, H., Ponsin, C., Brunet, C., Doublet, B., Cloeckaert, A., Madec, J.-Y., & Meunier, D. (2010) · Foodborne Pathogens and Disease · doi:10.1089/fpd.2009.0414 · Cited by 14
“Also, as the remaining ﬁve isolates that did not harbor SGI1 were susceptible to ﬂorfenicol, this antimicrobial remains probably a good indicator for the presence of SGI1 in S. enterica isolates (Arcangioli et al. , 1999; Briggs and Fratamico, 1999; Boyd et al. , 2001, 2002).”
InfluentialSelf-citation
Occurrence and Distribution of Various Genetic Structures of Class 1 and Class 2 Integrons in Salmonella enterica Isolates from Foodborne Disease Patients in Korea for 16 Years
Kim, S., Kim, S., Kim, J., Shin, J., Lee, B.-K., & Park, M. (2010) · Foodborne Pathogens and Disease · doi:10.1089/fpd.2010.0646 · Cited by 14
“…to amplify ﬂoR (forward primer: 5 0 -ATG ACC ACC ACA CGC CCC GCG TGG-3 0 , reverse primer: 5 0 -CTA GAC GAC TGG CGA CTT CTC GGT GGC-3 0 ), tet(G) genes (Ng et al. , 1999) located in SGI1, and the boundaries of SGI1 and In104 located in SGI1 (Boyd et al. , 2001, 2002; Carattoli et al. , 2002).”
Influential
Molecular Methods for Detection of Antibiotic Resistance
Aarts, H. J. M., Guerra, B., & Malorny, B. (2019) · ASM Press eBooks · doi:10.1128/9781555817534.ch4 · Cited by 14
Microarray-based Detection of Antibiotic Resistance Genes in Salmonella
van Hoek, A. H. A. M., & Aarts, H. J. M. (2008) · Food Analytical Methods · doi:10.1007/s12161-007-9012-1 · Cited by 13
“Forty-nine out of the 143 examined Salmonella harbored a blaTEM gene, whereas blaPSE-01 was Table 1 (continued) Oligonucleotide namea Sequence (5′–3′) GC % Gene(s) representedd vanC2/C3 50merb tttgactgtcggtgcttgtgacgccatttcattagtagacggctttttcg 46.0 vanC-2/3 vanC2/C3 60merb actctttgactgtcggtgcttgtgacgccatttcattagtagacg…”
BackgroundInfluential
Molecular epidemiology and antimicrobial susceptibility of Salmonella enterica serotype Stanley isolates in Taiwan.
Huang, K.-Y. A., Hong, Y. W., Wang, M. H., Chu, C., Su, L. H. J., Chiou, C., & Chiu, C. H. (2007) · PubMed · Cited by 12
Isolation of Salmonella enterica subspecies enterica serovar Paratyphi B dT+, or Salmonella Java, from Indonesia and alteration of the d-tartrate fermentation phenotype by disrupting the ORF STM 3356
Han, K. H., Choi, S. Y., Lee, J., Lee, H., Shin, E. H., Agtini, M. D., von Seidlein, L., Ochiai, R. L., Clemens, J. D., Wain, J. R., et al. (2006) · Journal of Medical Microbiology · doi:10.1099/jmm.0.46792-0 · Cited by 12
“According to the antibiotic-resistance phenotype and the PCR-mapping results, IB70, IB76 and IB80 contain SGI1, and IB75 contains a variant of SGI1, SGI1-C (Boyd et al., 2002).”
MethodInfluential
Antimicrobial Resistance in Isolates of Salmonella spp. from Pigs and the Characterization of an S. Infantis Gene Cassette
O’Mahony, R., Saugy, M., Leonard, N., Drudy, D., Bradshaw, B., Egan, J., Whyte, P., O’Mahony, M., Wall, P. G., & Fanning, S. (2005) · Foodborne Pathogens and Disease · doi:10.1089/fpd.2005.2.274 · Cited by 12
“It is possible that S. Infantis may be an example of the recently described non-S GI-1 island (Daly et al., 2005) wherein gene replacement occurred within the integron structure.”
Distribution and characteristics of SGI1/PGI2 genomic island from Proteus strains in China
Xiao, T., Dai, H., Lu, B., Li, Z., Cai, H., Huang, Z., Kan, B., & Wang, D. (2019) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2019.02.027 · Cited by 11
Phenotypic and genetic traits of Salmonella enterica subsp. serovar Typhimurium strains causing salmonellosis foci in rabbit farms from Southern Italy in 1999–2003
Camarda, A., Pupillo, A., Pugliese, N., Circella, E., Dionisi, A. M., Ricci, A., & Pazzani, C. (2012) · Research in Veterinary Science · doi:10.1016/j.rvsc.2012.10.015 · Cited by 11
Variation in Antimicrobial Resistance in Sporadic and Outbreak-relatedSalmonella entericaSerovar Typhimurium
Nielsen, E. M., Torpdahl, M., Ethelberg, S., & Hammerum, A. M. (2008) · Emerging infectious diseases · doi:10.3201/eid1501.080853 · Cited by 11
“The most likely mechanism for the creation of variants of SGI1 is considered to be homologue recombination between identical DNA segments (12).”
BackgroundResult
Diversification inSalmonellaTyphimurium DT104
Threlfall, J. E., Hopkins, K. L., & Ward, L. R. (2005) · Emerging infectious diseases · doi:10.3201/eid1106.050100 · Cited by 11
“Testing for SGI1 was conducted by using primers U7-L12 and LJ-R1 for the left junction and primers 104-RJ and 104-D for the right junction (9).”
Method
Retron reverse transcriptase () can be lost in multidrug resistant serovar Typhimurium DT 104 strains and influences virulence for mice
Pilousová, L., Matiasovicova, J., SISAK, F., Havlíčková, H., & Rychlı́k, I. (2005) · Veterinary Microbiology · doi:10.1016/j.vetmic.2005.10.010 · Cited by 10
Les intégrons en tant que support génétique de résistance aux antibiotiques
Ploy, M.-C., Gassama, A., Chainier, D., & Denis, F. (2005) · Immuno-analyse & Biologie Spécialisée · doi:10.1016/j.immbio.2005.10.001 · Cited by 9
Prevalence and Antimicrobial Characteristics of Shiga Toxin-Producing Escherichia coli Isolates from Pork in Korea
Heo, E. J., Ko, E. K., Kang, H. J., Kim, Y. J., Park, H. J., Wee, S., & Moon, J. (2020) · Foodborne Pathogens and Disease · doi:10.1089/fpd.2019.2760 · Cited by 9
“…that ﬂoR occurs in various Gram-negative bacteria such as in several S. enterica subsp. enterica serovars as part of the Salmonella genomic island 1 (Boyd et al. , 2002; Doublet et al. , 2003; Ebner et al. , 2004), in the SXT element ( Vibrio cholera -derived integrating and conjugative element)…”
Highly clonal relationship among Salmonella Enteritidis isolates in a commercial chicken production chain, Brazil
Monte, D. F. M., Andrigheto, C., Ribeiro, V. B., Landgraf, M., & Destro, M. T. (2020) · Brazilian Journal of Microbiology · doi:10.1007/s42770-020-00372-4 · Cited by 9
Brote de gastroenteritis en una guardería causado por una cepa de Salmonella enterica serovar Typhimurium portadora del plásmido híbrido de resistencia-virulencia pUO-StVR2
Bances, M., Herrero-Fresno, A., González, Y., Rodicio, M. R., & González‐Hevia, M. A. (2007) · Enfermedades Infecciosas y Microbiología Clínica · doi:10.1157/13106962 · Cited by 8
Influence of Anti-FloR Antibody on Florfenicol Accumulation in Florfenicol-Resistant Escherichia coli and Enzyme-Linked Immunosorbent Assay for Detection of Florfenicol-Resistant E. coli Isolates
Wu, B., Xia, C., Du, X., Cao, X., & Shen, J. (2006) · Journal of Clinical Microbiology · doi:10.1128/jcm.44.2.378-382.2006 · Cited by 8
“SGI1 or variants of SGI1 have also been identified at the same chromosomal location in another S. enterica serovar, Agona ( 9 , 13).”
Background
Complete sequence of multidrug resistance p9134 plasmid and its variants including natural recombinant with the virulence plasmid of Salmonella serovar Typhimurium
Kubasová, T., Matiasovicova, J., Rychlı́k, I., & Juřicová, H. (2014) · Plasmid · doi:10.1016/j.plasmid.2014.08.003 · Cited by 7
Antimicrobial profile of Salmonella enterica serotype Choleraesuis from free-range swine in Kakamega fish market, western Kenya
Onyango, D. M., Ndeda, V. M., Wandili, S., Sifuna, A. W., & Ochieng, P. (2014) · The Journal of Infection in Developing Countries · doi:10.3855/jidc.3861 · Cited by 8
“[70]”
Ingeniería evolutiva en Salmonella: la emergencia de plásmidos híbridos de virulencia-resistencia a antimicrobianos en serotipos no tifoideos
Mendoza, M. D. C., Herrero, A., & Rodicio, M. R. (2009) · Enfermedades Infecciosas y Microbiología Clínica · doi:10.1016/j.eimc.2008.09.001 · Cited by 7
Integron-plasmid mediated antibiotic resistance and virulence factors in clinical Salmonella enterica serovars in rural Western Kenya
Onyango, D. M., Kakai, R., Waindi, E. N., ago, Ghebremedhin, B., König, W., & Kong, B. H. (2010) · African Journal of Pharmacy and Pharmacology · doi:10.5897/ajpp.9000191 · Cited by 7
Anti Microbial Resistance in Salmonella
Singh, Y., Saxena, A., Bohra, J. S., Kumar, R., Kumar, A., & Saxena, M. K. (2019) · Journal of Basic & Applied Sciences · doi:10.29169/1927-5129.2019.15.03 · Cited by 7
A novel variant in Salmonella genomic island 1 of multidrug-resistant Salmonella enterica serovar Kentucky ST198
Intuy, R., Supa-amornkul, S., Jaemsai, B., Ruangchai, W., Wiriyarat, W., Chaturongakul, S., & Palittapongarnpim, P. (2024) · Microbiology Spectrum · doi:10.1128/spectrum.03994-23 · Cited by 6
“SGI1 is known as a hotspot for the integration of ARGs in many species of Enterobac teriaceae (13–16).”
Background
From phenotype to genotype: a Bayesian solution
Denwood, M. J., Mather, A. E., Haydon, D. T., Matthews, L., Mellor, D. J., & Reid, S. W. J. (2010) · Proceedings of the Royal Society B Biological Sciences · doi:10.1098/rspb.2010.1719 · Cited by 6
“Variants of this SGI1 in DT104, with different corresponding resistance proﬁles, have been reported [18–26].”
BackgroundMethod
Analysis and Identification of Golden pompano (Trachinotus blochii) Head Phospholipid Molecular Species by Liquid Chromatography-Mass Spectrometry
Li, Y., Li, P., Xia, G., Li, C., & Shen, X. (2019) · Journal of Oleo Science · doi:10.5650/jos.ess19189 · Cited by 6
Salmonella Genomic Island 1 requires a self‐encoded small RNA for mobilization
Nagy, I., Szabó, M., Hegyi, A., & Kiss, J. (2021) · Molecular Microbiology · doi:10.1111/mmi.14846 · Cited by 6
“Strain ST21S/1 carries an SGI1 derivative that is identical to the known SGI1- C variant described by (Boyd et al., 2002) and has been shown to have the same mobilization properties as the parental SGI1 (Kiss et al., 2012).”
An Additional Novel Antimicrobial Resistance Gene Cluster in Salmonella Genomic Island 1 of a Salmonella enterica Serovar Typhimurium DT104 Human Isolate
Kim, S., Kim, S., Chun, S. G., Park, M., Lim, H. M., & Lee, B.-K. (2009) · Foodborne Pathogens and Disease · doi:10.1089/fpd.2008.0199 · Cited by 6
“However, the Salmonella Typhimurium DT104 #13 isolate, which was ACSSuT-resistant with elevated MIC values against ampicillin and chloramphenicol, had the partially edited and shufﬂed version of MR gene cluster as well as In104, harboring two copies of bla PSE-1 , ﬂoR , and tetR (Figs.”
Influential
Evaluation of multi-drug resistance, virulence factors, and antimicrobial resistance genes of non-typhoidal Salmonella isolated from ruminants as a potential human health threat in Razavi Khorasan, northeastern Iran
Zavari, A., Badouei, M. A., & Tabar, G. H. (2024) · Microbial Pathogenesis · doi:10.1016/j.micpath.2024.107222 · Cited by 5
Organization of Tn 2610 Containing Two Transposition Modules
Takaya, A., Watanabe, M., & Yamamoto, T. (2006) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.50.4.1143-1147.2006 · Cited by 5
“, ACSSuS plus trimethoprim, SSu, ASu, and ASSuT) have been identified, suggesting that the multidrug resistance region of SGI1 was subject to recombination events that generated variants (4, 6).”
Background
Plasmid Replicon Typing of Commensal and Pathogenic Types of Escherichia coli Isolates
Johnson, T. J., Wannemuehler, Y. M., Johnson, S. J., Logue, C. M., White, D. G., Doetkott, C. D., & Nolan, L. K. (2007) · Applied and Environmental Microbiology · doi:10.1128/aem.00760-07 · Cited by 5
Mobilized Integrons: Team Players in the Spread of Antibiotic Resistance Genes
Martinez, E. M., Djordjevic, S. P., Stokes, H. W., & Chowdhury, P. R. (2013) · Springer eBooks · doi:10.1007/978-1-4614-7780-8_4 · Cited by 5
“aeruginosa [85], and SGI1 in Salmonella carrying two class 1 integrons [86], to be discussed in a later section.”
Background
Plasmid-mediated antimicrobial resistance in non-typhoidal Salmonella: serotype-specific mechanisms and ecological implications
Xiujuan, Z., Bremer, P. J., & Shi, C. (2026) · International Journal of Food Microbiology · doi:10.1016/j.ijfoodmicro.2026.111647 · Cited by 4
Resistance-Gene Cassettes Associated WithSalmonella entericaGenotypes
Bakhshi, B., Ghafari, M., Pourshafie, M. R., Zarbakhsh, B., Katouli, M., Rahbar, M., Hajia, M., Hosseini-Aliabad, N., & Boustanshenas, M. (2015) · Laboratory Medicine · doi:10.1309/lmfn8d17sohqhgrp · Cited by 4
Prevalence and characterization of multidrug resistance and variant Salmonella genomic island 1 in Salmonella isolates from cattle, poultry and humans in Iran
Ghoddusi, A., Fasaei, B. N., Salehı, T. Z., & Akbarein, H. (2019) · Zoonoses and Public Health · doi:10.1111/zph.12608 · Cited by 4
Salmonella Genomic Island 1 (SGI1) and genetic characteristics of animal and food isolates of Salmonella Typhimurium DT104 in Hungary
Fekete, P. Z., & Nagy, B. (2008) · Acta Veterinaria Hungarica · doi:10.1556/avet.56.2008.1.2 · Cited by 4
“Newport), although with different resistance phenotypes (Boyd et al., 2002).”
Antibiotic resistance, integrons and Salmonella genomic island 1 among Salmonella Schwarzengrund in broiler chicken and pig
Wang, Y. C., Chang, Y., Chuang, H.-L., Chiu, C. C., Yeh, K., Chang, C., Hsuan, S. L., & Chen, T. H. (2010) · African Journal of Pig Farming · doi:10.5897/ajmr.9000058 · Cited by 4
Detection of Plasmids and Class 1 Integrons in Salmonella enterica Serovar Agona Isolated from NARMS Slaughter Samples Collected in the Years 1997–2003
Douris, A., Fedorka–Cray, P. J., & Jackson, C. R. (2007) · Microbial Drug Resistance · doi:10.1089/mdr.2007.752 · Cited by 3
Phenicol Resistance
Schwarz, Š., & White, D. G. (2014) · ASM Press eBooks · doi:10.1128/9781555817572.ch9 · Cited by 3
Molecular characterization of class 1 integrons in clinical strains of Salmonella typhimurium isolated in Slovakia.
Majtánová, L., Majtán, T., & Majtan, V. (2007) · PubMed · Cited by 3
Novel Class 1 Integron Structures in High‐Risk Metallo‐β‐Lactamase‐Producing Pseudomonas aeruginosa ST235 and ST654 From Companion Animals
Leelapsawas, C., Chuanchuen, R., Sroithongkham, P., Perreten, V., & Chanchaithong, P. (2025) · Zoonoses and Public Health · doi:10.1111/zph.13224 · Cited by 2
“The conserved floR2 - tet (G) region in the complex Int1 and Tn 6061 was also found in the chromosome of the canine CP-Pa ST654 strain in this study, as well as in Salmonella GI1 and Acinetobacter baumannii resistance island AbaR1 (Boyd et al. 2002; Coyne et al. 2010; Fournier et al. 2006).”
New strains, new threats: the rise of atypical non-typhoidal Salmonella serovars and what it means for global health
Campbell, A., Harber, A., Fanning, S., & Marshall, H. (2026) · Critical Reviews in Microbiology · doi:10.1080/1040841x.2026.2668055 · Cited by 2
“S004 has been identified as being part of the replication module (Szabó et al. 2021), however the functions of all the other hypothetical proteins mentioned within Figure 5 are unknown (boyd et al. 2002).”
Management of Multiple Drug-Resistant Salmonella Infections
Parry, C. M. (2004) · Humana Press eBooks · doi:10.1007/978-1-59259-738-3_11 · Cited by 2
Challenges of Phage Therapy as a Strategic Tool for the Control of Salmonella Kentucky and Repertoire of Antibiotic Resistance Genes in Africa
Igomu, E. E. (2021) · IntechOpen eBooks · doi:10.5772/intechopen.95329 · Cited by 2
“The penta-resistance genes in phage type DT104 are clustered on a 43-kb Salmonella genomic island-1 (SGI1), which is flanked by two type I integrons [29].”
Background
New strategies to combat drug resistance in bacteria
Singh, T., Dar, S. A., Das, S., & Haque, S. (2020) · Elsevier eBooks · doi:10.1016/b978-0-12-818480-6.00013-8 · Cited by 2
THE PROBLEMS OF RESISTANCE OF SALMONELLAS TO CLINICALLY SIGNIFICANT ANTIBIOTICS
Tapalski, D. V., Osipov, V. A., Жаворонок, С. В., Тирещенко, Л. А., Шитикова, П. В., Торчишник, Е. Н., Козлова, А. И., & Волченко, А. Н. (2005) · Health and Ecology Issues · doi:10.51523/2708-6011.2005-2-1-20 · Cited by 2
“Описаны разновидности SGI1, возникающие, возможно, из-за рекомбинаций [8].”
POLSKIE TOWARZYSTWO MIKROBIOLOG"W POLISH SOCIETY OF MICROBIOLOGIS TS
Polonica, A. M. (2007) · Cited by 1
Prevalence of Class 1 Integrons and Antibiotic Resistance Patterns in Bacteria of Swine and Chicken in the US and Thailand
Liamthong, S. (2008) · Cited by 1
Development and validation of a DNA microarray for characterisation and typing of Salmonella isolates
Huehn, S. (2010) · Universitätsbibliothek der FU Berlin Hochschulschriftenstelle u. Dokumentenserver · doi:10.17169/refubium-13906 · Cited by 1
Integrons as a key tool in bacteria evolution
Kozyrovska, N. (2004) · Biopolymers and Cell · doi:10.7124/bc.0006c0 · Cited by 1
Antimicrobial Resistance Spread and the Role of Mobile Genetic Elements
Khan, M. A. (2010) · RePub (Erasmus University Rotterdam)
Molecular Characterization of Multidrug Resistant Salmonella Isolates From a Single Finisher Building for Determination of Horizontal Transmission of Resistance Genes
Gaul, S. B., Harris, I. T., & Harris, D. L. (2005) · doi:10.31274/ans_air-180814-1094
Epidemiología y caracterización molecular de los mecanismos de resistencia a diversos agentes antimicrobianos en aislamientos clínicos de "Salmonella" spp.
Cabrera, R. (2008) · Tesis Doctorals en Xarxa (Consorci de Serveis Universitaris de Catalunya)
Mechanisms of dissemination of integron-mediated multiple antibiotic resistance in Salmonella enterica
Krauland, M. G. (2008) · D-Scholarship@Pitt (University of Pittsburgh)
Characterisation of antibiotic resistance gene clusters and their mobility within a collection of multi-drug resistant Salmonella spp
Liu, X. (2009) · Research Online (University of Wollongong)
Variation in Antimicrobial Resistance in Sporadic and Outbreak-related Salmonella
Nielsen, E. M., Torpdahl, M., Ethelberg, S., & Hammerum, A. M. (2009)

Authors: Boyd, D., Cloeckaert, A., Chaslus-Dancla, E., & Mulvey, M. R.
Affiliations: Health Canada (CA)
Institut National de Recherche pour l'Agriculture, l'Alimentation et l'Environnement (FR)
ORCID: Boyd, David
Cloeckaert, Axel
Venue: Antimicrobial Agents and Chemotherapy
Publisher: American Society for Microbiology
Published: 2002-06
Volume: 46
Issue: 6
Pages: 1714-1722
ISSN: 0066-4804 (ISSN-L)
1098-6596
DOI: 10.1128/aac.46.6.1714-1722.2002
PMC: PMC127246
OpenAlex: W2123741711
Cited by: 209
References: 52
Citations by year: 2026: 5 · 2025: 1 · 2024: 4 · 2023: 2 · 2022: 3 · 2021: 5 · 2020: 4 · 2019: 9 · 2018: 5 · 2017: 5 · 2016: 6 · 2015: 6 · 2014: 5 · 2013: 7 · 2012: 5
FWCI: 26.02
Type: journal article
Language: en
Open access: green
europepmc.org
Licence: journals.asm.org/non-commercial-tdm-license (tdm)
Locations: Antimicrobial Agents and Chemotherapy (publishedVersion)
Europe PMC (PubMed Central) (publishedVersion)
PubMed Central (publishedVersion)
PubMed (publishedVersion)
Topics: Life Sciences › Agricultural and Biological Sciences › Food Science › Salmonella and Campylobacter epidemiology
Health Sciences › Medicine › Microbiology (medical) › Antibiotic Resistance in Bacteria
Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Bacterial Genetics and Biotechnology
Keywords: Salmonella genomic island 1, multidrug resistance, Salmonella Typhimurium DT104, Salmonella Agona, class 1 integron, aadA2, floR, qacEΔ1, transposase genes, gene rearrangement, antimicrobial resistance genes
MeSH terms: Amino Acid Sequence, Anti-Bacterial Agents, Culture Media, DNA, Bacterial, Drug Resistance, Microbial, Microbial Sensitivity Tests, Terminology as Topic, Phenotype, Salmonella Infections, Sequence Homology, Nucleic Acid, Genomic Library, Drug Resistance, Multiple, Salmonella enterica

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Characterization of Variant Salmonella Genomic Island 1 Multidrug Resistance Regions from Serovars Typhimurium DT104 and Agona

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks