Anterior-posterior differences in HoxD chromatin topology in limb development
Open accessAbstract
A late phase of HoxD activation is crucial for the patterning and growth of distal structures across the anterior-posterior (A-P) limb axis of mammals. Polycomb complexes and chromatin compaction have been shown to regulate Hox loci along the main body axis in embryonic development, but the extent to which they have a role in limb-specific HoxD expression, an evolutionary adaptation defined by the activity of distal enhancer elements that drive expression of 5′ Hoxd genes, has yet to be fully elucidated. We reveal two levels of chromatin topology that differentiate distal limb A-P HoxD activity. Using both immortalised cell lines derived from posterior and anterior regions of distal E10.5 mouse limb buds, and analysis in E10.5 dissected limb buds themselves, we show that there is a loss of polycomb-catalysed H3K27me3 histone modification and a chromatin decompaction over HoxD in the distal posterior limb compared with anterior. Moreover, we show that the global control region (GCR) long-range enhancer spatially colocalises with the 5′ HoxD genomic region specifically in the distal posterior limb. This is consistent with the formation of a chromatin loop between 5′ HoxD and the GCR regulatory module at the time and place of distal limb bud development when the GCR participates in initiating Hoxd gene quantitative collinearity and Hoxd13 expression. This is the first example of A-P differences in chromatin compaction and chromatin looping in the development of the mammalian secondary body axis (limb).
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
Many enhancers are spatially proximate to their target promoter in 3D, but exceptions have been described.
“Many enhancers are spatially proximate to their target promoter in 3D109,110, but exceptions have been described111-114.”
From Towards a comprehensive catalogue of validated and target-linked human enhancers (2020) · cites this paper as [111]
DNA FISH has been used to characterise enhancer-promoter loops for several developmental genes such as Shh and HoxD.
“DNA FISH has been used to characterise enhancer–promoter loops for several developmental genes such as Shh and HoxD [303, 304].”
From Transcriptional enhancers and their communication with gene promoters (2021) · cites this paper as [304]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Cites
Amano, T., Sagai, T., Tanabe, H., Mizushina, Y., Nakazawa, H., & Shiroishi, T. (2009) · Developmental Cell · doi:10.1016/j.devcel.2008.11.011 · Cited by 268 · see citing works
Control of Hoxd genes' collinearity during early limb development
Tarchini, B., & Duboule, D. (2006) · Developmental Cell · doi:10.1016/j.devcel.2005.11.014 · Cited by 222 · see citing works
Flagged first, then by citations
Research works printed but not linked: 2
- Jat, P. S., Noble, M. D., Ataliotis, P., Tanaka, Y., Yannoutsos, N., Larsen, L. and Kioussis, D. (1991). Direct derivation of conditionally immortal cell lines from an H-2Kb-tsA58 transgenic mouse. Proc. Natl. Acad. Sci. USA 88, 5096- 5100.
- Voncken, J. W., Roelen, B. A. J., Roefs, M., de Vries, S., Verhoeven, E., Marino, S., Deschamps, J. and van Lohuizen, M. (2003). Rnf2 (Ring1b) deficiency causes gastrulation arrest and cell cycle inhibition. Proc. Natl. Acad. Sci. USA 100, 2468-2473.
Cited by
Sorted by citations
Enhancers: five essential questions
Pennacchio, L. A., Bickmore, W. A., Dean, A., Nóbrega, M. A., & Bejerano, G. (2013) · Nature Reviews Genetics · doi:10.1038/nrg3458 · Cited by 584 · see citing works
Self-citationRivera, C. M., & Ren, B. (2013) · Cell · doi:10.1016/j.cell.2013.09.011 · Cited by 550 · see citing works
Polycomb repressive complex PRC1 spatially constrains the mouse embryonic stem cell genome
Schoenfelder, S., Sugar, R., Dimond, A., Javierre, B.-M., Armstrong, H., Mifsud, B., Dimitrova, E., Matheson, L., Tavares-Cadete, F., Furlan-Magaril, M., et al. (2015) · Nature Genetics · doi:10.1038/ng.3393 · Cited by 398 · see citing works
Towards a comprehensive catalogue of validated and target-linked human enhancers
Gasperini, M., Tome, J. M., & Shendure, J. (2020) · Nature Reviews Genetics · doi:10.1038/s41576-019-0209-0 · Cited by 396 · see citing works
The Spatial Organization of the Human Genome
Bickmore, W. A. (2013) · Annual Review of Genomics and Human Genetics · doi:10.1146/annurev-genom-091212-153515 · Cited by 391 · see citing works
Self-citationGenome-wide mapping and analysis of chromosome architecture
Schmitt, A. D., Hu, M., & Ren, B. (2016) · Nature Reviews Molecular Cell Biology · doi:10.1038/nrm.2016.104 · Cited by 344 · see citing works
“…of proximity-ligation products has been used to infer the 3D distances between a pair of DNA sequences, procedures including crosslinking, chromatin fragmentation, biotin-labelling and re-ligation can all introduce biases that complicate the interpretation of observed contact frequencies 74–76 .”
BackgroundEnhancer variants: evaluating functions in common disease
Corradin, O., & Scacheri, P. C. (2014) · Genome Medicine · doi:10.1186/s13073-014-0085-3 · Cited by 241 · see citing works
“3C: Chromosome conformation capture; 4C: Circular chromosome conformation capture; 5C: Carbon-copy chromosome conformation capture; CAGE: Cap analysis of gene expression; ChIA-PET: Chromatin interaction analysis by paired-end tag sequencing; ChIP-seq: Chromatin immunoprecipitation with massively parallel DNA sequencin…”
MethodWilliamson, I., Berlivet, S., Eskeland, R., Boyle, S., Illingworth, R. S., Paquette, D., Dostie, J., & Bickmore, W. A. (2014) · Genes & Development · doi:10.1101/gad.251694.114 · Cited by 229 · see citing works
“FISH has also been used to examine tissue-specific colocalization of long-range enhancers and their target genes (Amano et al. 2009; Williamson et al. 2012) Although visually compelling, FISH and live-cell imaging are restricted to viewpoints corresponding to the regions detected by the probes used…”
InfluentialSelf-citationAn Overview of Genome Organization and How We Got There: from FISH to Hi-C
Fraser, J., Williamson, I., Bickmore, W. A., & Dostie, J. (2015) · Microbiology and Molecular Biology Reviews · doi:10.1128/mmbr.00006-15 · Cited by 218 · see citing works
“We have used 2D-FISH to determine changes in chromatin condensation at the submegabase level, during differentiation and across a polarizing axis during development (45, 49) or between wild-type and mutant cells (46, 52).”
BackgroundMethodSelf-citationClustering of Tissue-Specific Sub-TADs Accompanies the Regulation of HoxA Genes in Developing Limbs
Berlivet, S., Paquette, D., Dumouchel, A., Langlais, D., Dostie, J., & Kmita, M. (2013) · PLoS Genetics · doi:10.1371/journal.pgen.1004018 · Cited by 170 · see citing works
A central role for canonical PRC1 in shaping the 3D nuclear landscapePreprint
Boyle, S., Flyamer, I. M., Williamson, I., Sengupta, D., Bickmore, W. A., & Illingworth, R. S. (2020) · Genes & Development · doi:10.1101/gad.336487.120 · Cited by 130 · see citing works
“…types, PRC1 mediated domains are developmentally dynamic and are eroded upon gene activation and the loss of PRC1 association (Lieberman-Aiden et al. 2009; Eskeland et al. 2010; Dixon et al. 2012; Nora et al. 2012; Williamson et al. 2012; Rao et al. 2014; Bonev et al. 2017; Kundu et al. 2017).”
BackgroundSelf-citationChromatin accessibility: methods, mechanisms, and biological insights
Mansisidor, A., & Risca, V. I. (2022) · Nucleus · doi:10.1080/19491034.2022.2143106 · Cited by 150 · see citing works
In the loop: promoter–enhancer interactions and bioinformatics
Mora, A., Sandve, G. K., Gabrielsen, O. S., & Eskeland, R. (2015) · Briefings in Bioinformatics · doi:10.1093/bib/bbv097 · Cited by 115 · see citing works
“Moreover, this method has shown that active gene loci can loop out of their chromosome territory [59, 60], and have been used to characterize PEIs for gene loci such as Hoxb13 , Shh and the olfactory receptor [61–63].”
MethodSelf-citation<i>Shh</i> and ZRS enhancer colocalisation is specific to the zone of polarising activity
Williamson, I., Lettice, L. A., Hill, R. E., & Bickmore, W. A. (2016) · Development · doi:10.1242/dev.139188 · Cited by 124 · see citing works
“5 limb bud (Williamson et al., 2012).”
BackgroundMethodInfluentialSelf-citationLong-range interactions between proximal and distal regulatory regions in maize
Li, E., Liu, H., Huang, L., Zhang, X., Dong, X., Song, W., Zhao, H., & Lai, J. (2019) · Nature Communications · doi:10.1038/s41467-019-10603-4 · Cited by 129 · see citing works
Chromatin loops, gene positioning, and gene expression
Holwerda, S. J. B., & de Laat, W. L. (2012) · Frontiers in Genetics · doi:10.3389/fgene.2012.00217 · Cited by 93 · see citing works
“This picture seems confirmed by a recent high-resolution FISH study, which also revealed that further fine-tuning of the contacts between HoxD genes and flanking regulatory sequences takes place along the anterior–posterior axis of the limb bud (Williamson et al., 2012).”
BackgroundExtensive pleiotropism and allelic heterogeneity mediate metabolic effects of IRX3 and IRX5
Sobreira, D. R., Joslin, A. C., Zhang, Q., Williamson, I., Hansen, G. T., Farris, K. M., Sakabe, N. J., Sinnott-Armstrong, N., Bozek, G., Jensen-Cody, S. O., et al. (2021) · Science · doi:10.1126/science.abf1008 · Cited by 106 · see citing works
Self-citationDNA Methylation Directs Polycomb-Dependent 3D Genome Re-organization in Naive Pluripotency
McLaughlin, K. A., Flyamer, I. M., Thomson, J. P., Mjoseng, H. K., Shukla, R., Williamson, I., Grimes, G. R., Illingworth, R. S., Adams, I. R., Pennings, S., et al. (2019) · Cell Reports · doi:10.1016/j.celrep.2019.10.031 · Cited by 95 · see citing works
“Since polycomb is a powerful mediator of higher-order chromatin structure (Boettiger et al., 2016; Eskeland et al., 2010; Francis et al., 2004; Joshi et al., 2015; Kundu et al., 2017; Schoenfelder et al., 2015; Williamson et al., 2012), it is possible that the redistribution of H3K27me3/polycomb across the genome resu…”
BackgroundSelf-citationChromatin organization and global regulation of Hox gene clusters
Montavon, T., & Duboule, D. (2013) · Philosophical Transactions of the Royal Society B Biological Sciences · doi:10.1098/rstb.2012.0367 · Cited by 78 · see citing works
Transcriptional enhancers and their communication with gene promoters
Ray-Jones, H., & Spivakov, M. (2021) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-021-03903-w · Cited by 81 · see citing works
“DNA FISH has been used to characterise enhancer–promoter loops for several developmental genes such as Shh and HoxD [303, 304].”
MethodDynamic Control of X-Chromosome Conformation and Repression by a Histone H4K20 Demethylase
Brejc, K., Bian, Q., Uzawa, S., Wheeler, B. S., Anderson, E., King, D. S., Kranzusch, P., Preston, C., & Meyer, B. J. (2017) · Cell · doi:10.1016/j.cell.2017.07.041 · Cited by 81 · see citing works
“…numerous genes within sub-chromosomal domains (e.g., imprinted gene clusters, hox clusters) (Andrey et al., 2013; Plasschaert and Bartolomei, 2014; Williamson et al., 2012), or across entire chromosomes (e.g., X chromosome dosage compensation) (da Rocha and Heard, 2017; Kuroda et al., 2016;…”
Matharu, N. K., & Ahituv, N. (2015) · PLoS Genetics · doi:10.1371/journal.pgen.1005640 · Cited by 88 · see citing works
“DNA-FISH was also used in mouse limb buds to show the chromatin looping interaction between the 50HoxD complex and the global control region (GCR) module in the distal posterior limb bud [11].”
MethodIn vivo formaldehyde cross-linking: it is time for black box analysis
Gavrilov, A., Razin, S., & Cavalli, G. (2014) · Briefings in Functional Genomics · doi:10.1093/bfgp/elu037 · Cited by 70 · see citing works
Diffusible signals and epigenetic timing cooperate in late proximo-distal limb patterning
Roselló‐Díez, A., Arqués, C. G., Delgado, I., Giovinazzo, G., & Torres, M. (2014) · Development · doi:10.1242/dev.106831 · Cited by 66 · see citing works
Svoboda, L. K., Harris, A., Bailey, N. J., Schwentner, R., Tomazou, E., von Levetzow, C., Magnuson, B., Ljungman, M., Kovar, H., & Lawlor, E. (2014) · Epigenetics · doi:10.4161/15592294.2014.988048 · Cited by 64
“In pediatric ES, tumors most commonly arise in the pelvis and appendicular skeleton, anatomic sites that express posterior HOXD genes during development.(14) We therefore hypothesized that the relative overexpression of posterior HOXD genes in ES might be a mark of their anatomic sites of origin.”
BackgroundInfluentialL-type voltage-gated Ca2+ channel CaV1.2 regulates chondrogenesis during limb development
Atsuta, Y., Tomizawa, R. R., Levin, M., & Tabin, C. (2019) · Proceedings of the National Academy of Sciences of the United States of America · doi:10.1073/pnas.1908981116 · Cited by 61 · see citing works
“mFgf10-R, CCTGCCATTGTGCTGCCAGTTAAA (57);”
Huang, Y., Sicar, S., Ramirez-Prado, J. S., Manza-Mianza, D., Antúnez-Sánchez, J., Brik‐Chaouche, R., Rodriguez‐Granados, N. Y., An, J., Bergounioux, C., Mahfouz, M. M., et al. (2021) · Genome Research · doi:10.1101/gr.273771.120 · Cited by 68 · see citing works
“…(Schoenfelder et al. 2015), and H3K27me3 levels have been associated with the Drosophila’s genome subdivision into TADs (Francis et al. 2004; Eskeland et al. 2010;Williamson et al. 2012; Joshi et al. 2015; Boettiger et al. 2016; El-Sharnouby et al. 2017; Kundu et al. 2017; McLaughlin et al. 2019).”
BackgroundChromatin Architectures and Hox Gene Collinearity
Noordermeer, D., & Duboule, D. (2013) · Current topics in developmental biology/Current Topics in Developmental Biology · doi:10.1016/b978-0-12-416027-9.00004-8 · Cited by 54 · see citing works
“5 limb bud cells, where the HoxD cluster is partially active and decompacted, RING1B occupancy is indeed strongly decreased (Williamson et al., 2012).”
Jubb, A. W., Boyle, S., Hume, D. A., & Bickmore, W. A. (2017) · Cell Reports · doi:10.1016/j.celrep.2017.11.053 · Cited by 48 · see citing works
“Slides were imaged and analyzed as described previously (Williamson et al., 2012).”
MethodSelf-citationChromatin folding and nuclear architecture: PRC1 function in 3D
Illingworth, R. S. (2019) · Current Opinion in Genetics & Development · doi:10.1016/j.gde.2019.06.006 · Cited by 48 · see citing works
Chromatin dynamics: H3K4 methylation and H3 variant replacement during development and in cancer
Deb, M., Kar, S., Sengupta, D., Shilpi, A., Parbin, S., Rath, S., Londhe, V., & Patra, S. K. (2014) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-014-1605-4 · Cited by 45 · see citing works
Psip1/Ledgf p75 restrainsHoxgene expression by recruiting both trithorax and polycomb group proteins
Pradeepa, M. M., Grimes, G. R., Taylor, G. C. A., Sutherland, H. G. E., & Bickmore, W. A. (2014) · Nucleic Acids Research · doi:10.1093/nar/gku647 · Cited by 30 · see citing works
Self-citationRegulatory Domains and Their MechanismsPreprint
Benabdallah, N. S., & Bickmore, W. A. (2015) · Cold Spring Harbor Symposia on Quantitative Biology · doi:10.1101/sqb.2015.80.027268 · Cited by 34 · see citing works
“(Williamson et al. 2012).”
Self-citationShiraishi, K., Shichino, S., Ueha, S., Nakajima, T., Hashimoto, S., Yamazaki, S., & Matsushima, K. (2018) · iScience · doi:10.1016/j.isci.2018.12.022 · Cited by 35 · see citing works
“R el at iv e m R N A ex pr es si on 0 0.05 0.10 0.15 0.20 0.25 Fgfr1c Ep i; b efo re cu ltu re Ep i; c o-c ult ure d7 FB ; lo we r c ha mb er FB ; b efo re cu ltu re FB ; c o-c ult ure d7 FB ; c o-c ult ure d1 4 Ep i; c o-c ult ure d1 4R el at iv e m R N A ex pr es si on *** *** n.s. **** Co ntr ol mF gf2 * Al ve olo…”
BackgroundInfluentialPsip1/p52 regulates posterior Hoxa genes through activation of lncRNA Hottip
Pradeepa, M. M., McKenna, F., Taylor, G. C. A., Bengani, H., Grimes, G. R., Wood, A. J., Bhatia, S., & Bickmore, W. A. (2017) · PLoS Genetics · doi:10.1371/journal.pgen.1006677 · Cited by 32 · see citing works
Self-citationThe Functionality and Evolution of Eukaryotic Transcriptional Enhancers
Buffry, A. D., Mendes, C. C., & McGregor, A. P. (2016) · Advances in genetics · doi:10.1016/bs.adgen.2016.08.004 · Cited by 30 · see citing works
Reliable detection of epigenetic histone marks and nuclear proteins in tissue cryosections
Eberhart, A., Kimura, H., Leonhardt, H., Joffe, B., & Solovei, I. (2012) · Chromosome Research · doi:10.1007/s10577-012-9318-8 · Cited by 29 · see citing works
“In particular, the spatial organization of interphase chromosomes and their subregions, as well as the distribution of associated proteins, differ strongly among cell types (Parada et al. 2004; Solovei et al. 2009; Williamson et al. 2012).”
Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene
Xie, G., Peng, Z., Liang, J., Larabee, S. M., Drachenberg, C. B., Yfantis, H. G., & Raufman, J. (2022) · JCI Insight · doi:10.1172/jci.insight.150894 · Cited by 46 · see citing works
Quantitative analysis of genomic element interactions by molecular colony technique
Gavrilov, A. A., Chetverina, H. V., Chermnykh, E. S., Razin, S. V., & Chetverin, A. B. (2014) · Nucleic Acids Research · doi:10.1093/nar/gkt1322 · Cited by 25 · see citing works
“This conclusion may seem contradictory to the FISH results that in some instances genes and remote regulatory elements are colocalized in a significant proportion of cells in a population, which may be as high as 30% (47) or even 85% (48).”
Djeghloul, D., Dimond, A., Cheriyamkunnel, S., Kramer, H. B., Patel, B., Brown, K., Montoya, A., Whilding, C., Wang, Y.-F., Futschik, M., et al. (2023) · Nature Structural & Molecular Biology · doi:10.1038/s41594-023-00943-7 · Cited by 25 · see citing works
PARP mediated chromatin unfolding is coupled to long-range enhancer activationPreprint
Benabdallah, N. S., Williamson, I., Illingworth, R. S., Boyle, S., Grimes, G. R., Therizols, P., & Bickmore, W. A. (2017) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/155325 · Cited by 24 · see citing works
Self-citationRepressive histone methylation: A case study in deterministic versus stochastic gene regulation
Lyons, D. B., & Lomvardas, S. (2014) · Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms · doi:10.1016/j.bbagrm.2014.05.010 · Cited by 22 · see citing works
Xu, C.-X., Yang, X.-M., Zhou, H., Li, Y.-Y., Xing, C., Zhou, T.-F., Zhong, D.-M., Lian, C.-J., Yan, M., Chen, T., et al. (2019) · Genetics in Medicine · doi:10.1038/s41436-019-0626-7 · Cited by 24
Dexamethasone use during pregnancy: potential adverse effects on embryonic skeletogenesis.
Cheng, X., Wang, G., Lee, K. K., & Yang, X. (2014) · Current pharmaceutical design · doi:10.2174/1381612820666140205144534 · Cited by 23
“particular, the signaling genes involved in this process are Shh, Hox, Fgf10, Fgf8, Tbx4, Tbx5 and the BMPs, which must be expressed in a precise spatiotemporal fashion for the limbs to develop and pattern properly [37-40].”
BackgroundPeluso, S., Douglas, A., Hill, A., Angelis, C. D., Moore, B. L., Grimes, G. R., Petrovich, G., Essafi, A., & Hill, R. E. (2017) · eLife · doi:10.7554/elife.28590 · Cited by 15 · see citing works
Self-citationEpigenetic mechanisms and boundaries in the regulation of mammalian Hox clusters.
Srivastava, S., Dhawan, J., & Mishra, R. (2015) · Mechanisms of Development · doi:10.1016/j.mod.2015.07.015 · Cited by 9 · see citing works
Harmston, N., Ing-Simmons, E., Tan, G., Perry, M., Merkenschlager, M., & Lenhard, B. (2016) · bioRxiv · doi:10.1101/042952 · Cited by 8 · see citing works
Chromatin organization in pluripotent cells: emerging approaches to study and disrupt function
Novo, C. L., & Rugg‐Gunn, P. J. (2015) · Briefings in Functional Genomics · doi:10.1093/bfgp/elv029 · Cited by 6 · see citing works
“enhancers and their target genes [20–22].”
Multitasking by Polycomb response elementsPreprint
Jaensch, E. S., Kundu, S., & Kingston, R. (2017) · Genes & Development · doi:10.1101/gad.303206.117 · Cited by 7 · see citing works
“…by enhancers and repression by the PcG proteins are known to involve higher-order 1070 GENES & DEVELOPMENT interactions that place distant regions adjacent to one another by either looping or forming discrete domains of interaction (Deng et al. 2012; Williamson et al. 2012; Kundu et al. 2017).”
BackgroundRaymond, M. J., Cherubino, M. A., Vieira, W., Manon, S., & McCusker, C. D. (2025) · Communications Biology · doi:10.1038/s42003-025-08084-x · Cited by 6 · see citing works
“This repressive epigenetic mark was chosen because of its role in the maintenance of positional memory in differentiated cells 50,51 and the regulation of patterning gene expression in the developing limb fi eld 48,60 .”
Geminin is required for Hox gene regulation to pattern the developing limb
Lewis, E., Sankar, S., Tong, C.-L., Patterson, E. S., Waller, L. E., Gontarz, P., Zhang, B., Ornitz, D., & Kroll, K. L. (2020) · bioRxiv · doi:10.1101/2020.01.07.896472 · Cited by 5
“5), H3K27me3 is cleared from 5’ Hox genes in the posterior limb bud mesenchyme to promote their expression (Montavon and Duboule, 2013; Soshnikova and Duboule, 2009; Williamson et al., 2012).”
BackgroundCagnan, I., Coşgun, E., Konu, O., Uçkan, D., & Gunel-Ozcan, A. (2018) · Molecular Biology Reports · doi:10.1007/s11033-018-4522-z · Cited by 4 · see citing works
Zu, B.-L., Wang, Z.-G., Xu, Y.-L., You, G.-L., & Fu, Q.-H. (2021) · Developmental Dynamics · doi:10.1002/dvdy.310 · Cited by 3
An Approach for Recognition of Enhancer-promoter Associations based on Random Forest
Zhang, T., & Wang, Y.-D. (2019) · International Conference on Biomedical Signal and Image Processing · doi:10.1145/3354031.3354039 · Cited by 3 · see citing works
“Methods of biological experiments to recognize the enhancerpromoter associations include DNA Fluorescence in situ Hybridization (FISH) [2], [21] and Chromosome Conformation Capture (3C) [4].”
BackgroundVisualizing Genome Reorganization Using 3D DNA FISH.
Jubb, A., & Boyle, S. (2020) · Methods in molecular biology · doi:10.1007/978-1-0716-0623-0_5 · Cited by 3 · see citing works
Self-citationGenome-wide Prediction of Potential Polycomb Response Elements and their FunctionsPreprint
Khabiri, M., & Freddolino, P. L. (2019) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/516500 · Cited by 1 · see citing works
“It has already been shown that the activation by enhancers and repression by the PcG proteins are involved in higher-order interactions, either by looping or forming discrete domains of interaction (50-52).”
BackgroundChromatin Topology and Long- Range Genomic Interactions
Bayarsaihan, D. (2013) · Journal of Regenerative Medicine · doi:10.4172/2325-9620.1000e106 · Cited by 2 · see citing works
Psip1/p52 regulates distal Hoxa genes through activation of lncRNA Hottip
Pradeepa, M. M., Taylor, G., Grimes, G., Wood, A., & Bickmore, W. (2016) · bioRxiv · doi:10.1101/061192 · Cited by 1
Self-citationInterpretable machine learning methods for prediction and analysis of genome regulation in 3D
Nikumbh, S. (2019) · doi:10.22028/d291-28153 · Cited by 1
Djeghloul, D., Dimond, A., Kramer, H. B., Brown, K. E., Patel, B., Wang, Y.-F., Futschik, M., Whilding, C., Montoya, A., Veland, N., et al. (2022) · bioRxiv · doi:10.1101/2022.02.01.478684
Oslo Epigenetics Symposium 2012. Oslo, Norway, 8-9 November 2012.
Collas, P., & Eskeland, R. (2013) · Epigenomics · doi:10.2217/epi.12.76
Self-citationGlobal Functions of PRC2 Complexes
Pirrotta, V. (2017) · Elsevier eBooks · doi:10.1016/b978-0-12-809737-3.00013-1
The Recombination Enhancer Modulates the Conformation of Chr. III in Budding Yeast: A Dissertation
Belton, J.-M. (2014) · The Journal of the American Medical Association (JAMA) Network (American Medical Association) · doi:10.13028/m2f88z
“1986), light microscopy (Williamson et al. 2012), RNA TRAP (Carter et al.”
Method
- Authors
- Williamson, I., Eskeland, R., Lettice, L. A., Hill, A. E., Boyle, S., Grimes, G. R., Hill, R. E., & Bickmore, W. A.
- Affiliations
- Institute of Genetics and Cancer (GB)
- ORCID
- Venue
- Development
- Publisher
- The Company of Biologists
- Published
- 2012-09-01
- Volume
- 139
- Issue
- 17
- Pages
- 3157-3167
- ISSN
- 0950-1991 (ISSN-L)
- 1477-9129
- PMC
- PMC3413162
- OpenAlex
- W2151362772
- Cited by
- 62
- References
- 0
- Citations by year
- 2025: 1 · 2023: 1 · 2022: 3 · 2021: 5 · 2020: 3 · 2019: 7 · 2018: 1 · 2017: 7 · 2016: 4 · 2015: 8 · 2014: 10 · 2013: 10 · 2012: 2
- FWCI
- 3.86
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Locations
- Development (publishedVersion)
- Europe PMC (PubMed Central) (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Edinburgh Research Explorer (University of Edinburgh) (publishedVersion, other-oa)
- Funders
- Medical Research Council
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Chromatin Dynamics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Developmental Biology and Gene Regulation
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Epigenetics and DNA Methylation
- Keywords
- chromatin topology, limb development, anterior-posterior axis, Polycomb complexes, H3K27me3, chromatin condensation, chromatin looping, long-range enhancers, HOXD13, distal enhancers, limb bud, mouse embryo
- MeSH terms
- Animals, Cell Line, Extremities, Histones, Image Processing, Computer-Assisted, Microscopy, Fluorescence, Repressor Proteins, Transcription Factors, Blotting, Western, In Situ Hybridization, Fluorescence, DNA Primers, Homeodomain Proteins, Gene Expression Regulation, Developmental, Body Patterning, Chromatin Assembly and Disassembly, Chromatin Immunoprecipitation, Mice, Real-Time Polymerase Chain Reaction, Polycomb-Group Proteins
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
