Cited by 130Metabolism, Diabetes, and CancerEstrogen and related hormone effectsAdrenal Hormones and Disorders

The DOI matches its Crossref record; 46 of the 46 references it cites were found in a registry or an index.

Regulation of gluconeogenesis by glucocorticoids.

Exton, J. H.·1979·Monographs on endocrinology

Open this paper in CoChat — free account

Abstract

1. Regulation of gluconeogenic substrate supply and modulation of the gluconeogenic pathway in the liver are both important in the control of gluconeogenesis by glucocorticoids. 2. Adrenal deficiency decreases the release of gluconeogenic and other amino acids from skeletal muscle during starvation. The effect is reversed by glucocorticoid replacement. The changes in amino acid release are accompanied by similar alterations in tissue amino acid levels and are not explained by alterations in net protein breakdown. Glucocorticoids do not alter protein catabolism and cause a small inhibition of protein synthesis. The biochemical alterations underlying the changes in amino acid metabolism induced by these steroids remain to be elucidated. Glucocorticoids may also regulate the supply of gluconeogenic substrates through permissive effects on the lipolytic action of catecholamines and other hormones in adipose tissue and on the glycogenolytic action of catecholamines on skeletal muscle. 3. Glucocorticoids are required for the increases in gluconeogenesis in starvation and diabetes. Part of their action is exerted directly on the liver and appears to involve modulation of P-enlopyruvate carboxykinase levels. Glucocorticoids increase the synthesis of this enzyme apparently through effects at the level of transcription. 4. Glucocorticoids exert permissive effects on the stimulation of gluconeogenesis in the liver by glucagon and epinephrine. The steroids are not required for cAMP generation or protein kinase activation by these hormones, but appear to act by maintaining the responsiveness of certain enzymes to the effects of the cAMP and alpha-adrenergic systems. It is proposed that this involves the maintenance of a normal intracellular ionic environment.

Integrity signals

Registry

Crossref · 10.1007/978-3-642-81265-1_28

Cites

46 of 46 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

This paper’s full text isn’t openly available, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

THE ADRENAL CORTEX AND CARBOHYDRATE METABOLISM
Long, C. N. H., Katzin, B., & Fry, E. G. (1940) · Endocrinology · doi:10.1210/endo-26-2-309 · Cited by 519
The rate of gluconeogenesis from various precursors in the perfused rat liver
Ross, B. D., Hems, R., & Krebs, H. A. (1967) · Biochemical Journal · doi:10.1042/bj1020942 · Cited by 408
Metabolic and Hormonal Control of Phosphoenolpyruvate Carboxykinase and Malic Enzyme in Rat Liver
Shrago, E. S., Lardy, H. A., Nordlie, R. C., & Foster, D. O. (1963) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(18)48645-0 · Cited by 386
Studies on the alpha-adrenergic activation of hepatic glucose output. I. Studies on the alpha-adrenergic activation of phosphorylase and gluconeogenesis and inactivation of glycogen synthase in isolated rat liver parenchymal cells.
Hutson, N. J., Brumley, F. T., Assimacopoulos, F. D., Harper, S. C., & Exton, J. H. (1976) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(17)33147-2 · Cited by 348
Self-citation
Interaction of Glucocorticoids with Glucagon and Epinephrine in the Control of Gluconeogenesis and Glycogenolysis in Liver and of Lipolysis in Adipose Tissue
Exton, J. H., Friedmann, N. K., Wong, E., Brineaux, J. P., Corbin, J. D., & Park, C. R. (1972) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(19)45180-6 · Cited by 283
Effect of dexamethasone on insulin binding, glucose transport, and glucose oxidation of isolated rat adipocytes.
Olefsky, J. M. (1975) · Journal of Clinical Investigation · doi:10.1172/jci108231 · Cited by 277
The Role of Hepatic Glucose-6-phosphatase in the Regulation of Carbohydrate Metabolism
Ashmore, J., & Weber, G. F. (1959) · Vitamins and hormones · doi:10.1016/s0083-6729(08)60269-1 · Cited by 259
Hormonal control of pyruvate kinase activity and of gluconeogenesis in isolated hepatocytes.
Feliú, J. E., Hue, L., & Hers, H. G. (1976) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.73.8.2762 · Cited by 220
Lack of Correlation between Catecholamine Effects on Cyclic Adenosine 3′:5′-Monophosphate and Gluconeogenesis in Isolated Rat Liver Cells
Tolbert, M. E. M., Butcher, F. R., & Fain, J. N. (1973) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(19)43560-6 · Cited by 171
Hepatic pyruvate kinase. Regulation by glucagon, cyclic adenosine 3'-5'-monophosphate, and insulin in the perfused rat liver.
Blair, J. B., Cimbala, M. A., Foster, J. L., & Morgan, R. A. (1976) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(17)33408-7 · Cited by 170

Show all 46 references

Research works printed but not linked: 6

Steele, R.: Influences of corticosteroids on protein and carbohydrate metabolism. In: Handbook of Physiology. Sect. 7: Endrocrinology, Vol. VI. Adrenal Gland. Blaschko, H., Sayers, G., Smith, A. D. (eds.), Washington, D. C.: American Physiological Society 1975, pp. 135–167.
Caldwell, M. D., Lacy, W. W., Exton, J. H.: Effect of glucocorticoids on substrate utilization by muscle. Fed. Proc. 36, 527 (1977).
Rannels, S. R., Li J. B., Jefferson, L. S.: Amino and release and protein turnover in perfused skeletal muscle of fasted normal and adrenalectomized rats. Diabetes 25, 333 (1976).
Fain, J. N., Czech, M. P.: Glucocorticoid effects on lipid mobilization and adipose tissue metabolism. In: Handbook of Physiology. Section 7: Endocrinology, Vol. VI. Adrenal Gland. Blaschko, H., Sayers, G., Smith, A. D. (eds.) Washington, D. C.: American Physiological Society 1975, pp. 169–178.
Chan, T. M.: Unpublished observations (1977).
Chan, T. M., Exton, J. H.: Enhanced β-adrenergic activation of glycogen Phosphorylase in hepatocytes from adrenalectomized rats. Fed. Proc. 36, 384 (1977).

Sorted by citations

How do glucocorticoids influence stress responses? Integrating permissive, suppressive, stimulatory, and preparative actions
Sapolsky, R. M., Romero, L. M., & Munck, A. U. (2000) · Endocrine Reviews · doi:10.1210/edrv.21.1.0389 · Cited by 7,541
“Increased substrates for gluconeogenesis are primarily amino acids released from muscle and other peripheral tissues, and glycerol released from adipose tissue sensitized permissively by GCs to lipolysis by GH and catecholamines (419, 420).”
Background
Regulation of glucose homeostasis by glucocorticoids
Kuo, T., McQueen, A., Chen, T.-C., & Wang, J.-C. (2015) · Advances in Experimental Medicine and Biology · doi:10.1007/978-1-4939-2895-8_5 · Cited by 723
Glucocorticoid actions on synapses, circuits, and behavior: Implications for the energetics of stress
Myers, B., McKlveen, J. M., & Herman, J. P. (2014) · Frontiers in Neuroendocrinology · doi:10.1016/j.yfrne.2013.12.003 · Cited by 318
“…travel throughout the body, exerting a multitude of effects in the periphery including glycogen breakdown and gluconeogenesis (Coderre et al., 1991; Exton, 1979; Munck et al., 1984; for detailed reviews of brain circuits regulating glucose homeostasis see Schwartz et al., 2000; Seeley and Woods,…”
Background
Aquaglyceroporin AQP9: Solute permeation and metabolic control of expression in liver
Carbrey, J. M., Gorelick-Feldman, D. A., Kozono, D., Prætorius, J., Nielsen, S., & Agre, P. C. (2003) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0437994100 · Cited by 306
Adrenal Corticosteroid Biosynthesis, Metabolism, and Action
Arlt, W., & Stewart, P. M. (2005) · Endocrinology and Metabolism Clinics of North America · doi:10.1016/j.ecl.2005.01.002 · Cited by 200
“Hepatic glucose output increases through the activation of key enzymes involved in gluconeogenesis, principally glucose-6-phosphatase and phosphoenolpyruvate kinase (PEPCK) [67].”
Background
Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia
German, J. P., Thaler, J. P., Wisse, B. E., Oh-I, S., Sarruf, D. A., Matsen, M. E., Fischer, J. D., Taborsky, G. J., Schwartz, M. W., & Morton, G. J. (2011) · Endocrinology · doi:10.1210/en.2010-0890 · Cited by 169
“The primer sequences for 18S RNA, G6Pase, Pepck, and Igfbp-2 were designed using Primer Express (version 2.0.0; Applied Biosystems) and are as follows: 18S RNA forward, CGGACAGGATTGACAGATTG and reverse, CAAATCGCTCCACCAACTAA; G6Pase forward, TCAACCTCGTCTTCAAGTGGATT and reverse, CTGCTTTATTATAGGCACGGAGCT; Pepck forward,…”
BackgroundInfluential
Leptin Deficiency Causes Insulin Resistance Induced by Uncontrolled Diabetes
German, J. P., Wisse, B. E., Thaler, J. P., Oh-I, S., Sarruf, D. A., Ogimoto, K., Kaiyala, K. J., Fischer, J. D., Matsen, M. E., Taborsky, G. J., et al. (2010) · Diabetes · doi:10.2337/db09-1918 · Cited by 159
“Because glucocorticoids both inhibit peripheral glucose uptake in muscle and adipose tissue and induce hepatic expression of G6Pase and Pepck (39), HPA activation in uDM probably contributes to insulin resistance in this setting.”
BackgroundInfluential
Physiological stress in broilers: Ramifications on nutrient digestibility and responses
Virden, W. S., & Kidd, M. T. (2009) · The Journal of Applied Poultry Research · doi:10.3382/japr.2007-00093 · Cited by 142
“duction [40].”
Background
Neural basis for fasting activation of the hypothalamic–pituitary–adrenal axis
Douglass, A. M., Resch, J. M., Madara, J. C., Kucukdereli, H., Yizhar, O., Grama, A., Yamagata, M., Yang, Z., & Lowell, B. B. (2023) · Nature · doi:10.1038/s41586-023-06358-0 · Cited by 123
Energy metabolism in the newborn farm animal with emphasis on the calf: endocrine changes and responses to milk-born and systemic hormones
Hammon, H. M., Steinhoff‐Wagner, J., Schönhusen, U., Metges, C. C., & Blum, J. W. (2012) · Domestic Animal Endocrinology · doi:10.1016/j.domaniend.2012.02.005 · Cited by 116
Noradrenergic feeding elicited via the paraventricular nucleus is dependent upon circulating corticosterone
LEIBOWITZ, S. F., ROLAND, C., Hor, L., & SQUILLARI, V. (1984) · Physiology & Behavior · doi:10.1016/0031-9384(84)90206-3 · Cited by 101
Involvement of corticosterone in the fasting-induced rise in protein utilization and locomotor activity
Challet, É. (1995) · Pharmacology Biochemistry and Behavior · doi:10.1016/0091-3057(94)00287-s · Cited by 93
Consumption of a high-fat diet rapidly exacerbates the development of fatty liver disease that occurs with chronically elevated glucocorticoids
D'souza, A. M., Beaudry, J. L., Szigiato, A.-A., Trumble, S. J., Snook, L. A., Bonen, A., Giacca, A., & Riddell, M. C. (2012) · American Journal of Physiology-Gastrointestinal and Liver Physiology · doi:10.1152/ajpgi.00378.2011 · Cited by 91
Subcutaneous administration of leptin normalizes fasting plasma glucose in obese type 2 diabetic UCD-T2DM rats
Cummings, B. P., Bettaieb, A., Graham, J. L., Stanhope, K. L., Dill, R., Morton, G. J., Haj, F. G., & Havel, P. J. (2011) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1107163108 · Cited by 87
“Corticosterone has been suggested to contribute to the glucose-lowering effects of central leptin signaling because glucocorticoid action increases hepatic glucose production (32) and decreases insulin sensitivity (33).”
Background
Recent and emerging anti‐diabetes targets
Mohler, M. L., He, Y., Wu, Z., Hwang, D., & Miller, D. D. (2008) · Medicinal Research Reviews · doi:10.1002/med.20142 · Cited by 88
MicroRNA-214 Suppresses Gluconeogenesis by Targeting Activating Transcriptional Factor 4
Li, K., Zhang, J., Yu, J., Liu, B., Guo, Y., Deng, J., Chen, S., Wang, C., & Guo, F. (2015) · Journal of Biological Chemistry · doi:10.1074/jbc.m114.633990 · Cited by 81
Chicken domestication changes expression of stress-related genes in brain, pituitary and adrenals
Løtvedt, P. K., Fallahshahroudi, A., Bektic, L., Altimiras, J., & Jensen, P. (2017) · Neurobiology of Stress · doi:10.1016/j.ynstr.2017.08.002 · Cited by 81
“Glucocorticoids have a wide variety of effects depending on the target tissue, including glycogen breakdown and gluconeogenesis (Exton, 1978; Munk et al., 1984; Coderre et al., 1991; Myers et al., 2014).”
Background
The Effects of Handling and Anesthetic Agents on the Stress Response and Carbohydrate Metabolism in Northern Elephant Seals
Champagne, C. D., Houser, D. S., da Costa, D. P., & Crocker, D. E. (2012) · PLoS ONE · doi:10.1371/journal.pone.0038442 · Cited by 73
“Although cortisol is known to stimulate glucose production in mammals [34,91], this lack of correlation in elephant seals is not necessarily surprising.”
Background
Focus on FKBP51: A molecular link between stress and metabolic disorders
Häusl, A. S., Balsevich, G., Gassen, N. C., & Schmidt, M. V. (2019) · Molecular Metabolism · doi:10.1016/j.molmet.2019.09.003 · Cited by 73
“For instance, GCs increase glucose production in the liver by stimulating hepatic gluconeogenesis [14].”
Background
The Endocrine Effects of Nonhormonal Antineoplastic Therapy
Yeung, S. J., Chiu, A. C., Vassilopoulou‐Sellin, R., & Gagel, R. F. (1998) · Endocrine Reviews · doi:10.1210/edrv.19.2.0328 · Cited by 72
Glucocorticoids and hypothalamic obesity
King, B. M. (1988) · Neuroscience & Biobehavioral Reviews · doi:10.1016/s0149-7634(88)80071-x · Cited by 68
Dexamethasone and colostrum feeding affect hepatic gluconeogenic enzymes differently in neonatal calves1,2,3
Hammon, H. M., Sauter, S. N., Reist, M., Zbinden, Y., Philipona, C., Morel, C., & Blum, J. W. (2003) · Journal of Animal Science · doi:10.2527/2003.81123095x · Cited by 67
Effects of fasting on plasma catecholamine, corticosterone and glucose concentrations under basal and stress conditions in individual rats
de Boer, S. F., Koopmans, S. J., Slangen, J. L., & van der Gugten, J. (1989) · Physiology & Behavior · doi:10.1016/0031-9384(89)90226-6 · Cited by 64
Muscular response and adaptation to diabetes mellitus
Sun, Z. (2008) · Frontiers in bioscience · doi:10.2741/3038 · Cited by 56
“4771 muscle, and through permissive effects on the stimulation of gluconeogenesis in the liver by glucagon and epinephrine (137).”
Background
The Hypothalamic‐Pituitary‐Adrenal Axis in Obesity
Chalew, S. A., Nagel, H., & Shore, S. (1995) · Obesity Research · doi:10.1002/j.1550-8528.1995.tb00163.x · Cited by 53
Fat-brain connections: Adipocyte glucocorticoid control of stress and metabolism
de Kloet, A. D., & Herman, J. P. (2017) · Frontiers in Neuroendocrinology · doi:10.1016/j.yfrne.2017.10.005 · Cited by 46
Steroid use and misuse: a key performance indicator in the management of IBD
Blackwell, J., Selinger, C. P., Raine, T., Parkes, G. C., Smith, M. A., & Pollok, R. (2020) · Frontline Gastroenterology · doi:10.1136/flgastro-2019-101288 · Cited by 42
Mobilisation of Structural Proteins During Exercise
Viru, A. (1987) · Sports Medicine · doi:10.2165/00007256-198704020-00003 · Cited by 43
Comprehensive understanding of regulatory mechanisms, physiological models and key enzymes in microalgal cells based on various concentrations of CO2
Wang, Z., Cheng, J., Sun, Y., Jia, D., Tang, Y., Yang, W., & Cen, K. (2022) · Chemical Engineering Journal · doi:10.1016/j.cej.2022.140233 · Cited by 38
Assessment of ground transportation stress in juvenile Kemp’s ridley sea turtles (Lepidochelys kempii)
Hunt, K. E., Innis, C. J., Kennedy, A. S., McNally, K. L., Davis, D., Burgess, E. A., & Merigo, C. (2016) · Conservation Physiology · doi:10.1093/conphys/cov071 · Cited by 38
“Similar patterns of increased glucose are seen in livestock in response to road transport and other types of stressors and are generally interpreted as evidence of a physiological stress response (Exton, 1979; McMahon et al., 1988; Knowles and Warriss, 2007).”
Background
Glucocorticoids and Their Receptor Isoforms: Roles in Female Reproduction, Pregnancy, and Foetal Development
Bhaumik, S., Lockett, J., Cuffe, J. S. M., & Clifton, V. L. (2023) · Biology · doi:10.3390/biology12081104 · Cited by 42
Multihormonal control of enzyme clusters in rat liver ontogenesis II. Role of glucocorticosteroid and thyroid hormone and of glucagon and insulin
Lamers, W. H., & Mooren, P. G. (1981) · Mechanisms of Ageing and Development · doi:10.1016/0047-6374(81)90010-5 · Cited by 36
PCK1 dysregulation in cancer: Metabolic reprogramming, oncogenic activation, and therapeutic opportunities
Jin, X., Wang, K., & Tang, N. (2022) · Genes & Diseases · doi:10.1016/j.gendis.2022.02.010 · Cited by 35
Proteomic similarities in steroid responsiveness in normal and glaucomatous trabecular meshwork cells.
Bollinger, K. E., Crabb, J. S., Yuan, X., Sharma, T. P., Clark, A. F., & Crabb, J. W. (2012) · Europe PMC (PubMed Central) · Cited by 35
Glucagon, cyclic AMP, and hepatic glucose mobilization: A half‐century of uncertainty
Rodgers, R. L. (2022) · Physiological Reports · doi:10.14814/phy2.15263 · Cited by 34
“…corticosteroids are often described as having a “permissive” effect on the generation of cAMP by high concentrations of glucagon and by other AC activators such as NaF, isoproterenol, or forskolin (Adigun et al., 2010; Exton, 1979; Exton et al., 1972; Krone et al., 1976; Yoon et al., 2001).”
Background
Differential Neuropeptide Responses to Starvation with Ageing
Kaneda, T., Makino, S., Nishiyama, M., Asaba, K., & Hashimoto, K. (2001) · Journal of Neuroendocrinology · doi:10.1046/j.1365-2826.2001.00730.x · Cited by 35
Modeling of Corticosteroid Effects on Hepatic Low-Density Lipoprotein Receptors and Plasma Lipid Dynamics in Rats
Hazra, A., Pyszczynski, N. A., DuBois, D. C., Almon, R. R., & Jusko, W. J. (2007) · Pharmaceutical Research · doi:10.1007/s11095-007-9371-8 · Cited by 34
“Although the practical advantages in using this model are substantial, adrenalectomy may lead to undesirable physiological changes (35,36) especially when evaluating the inter-relationships between carbohydrate, protein, and lipid metabolism.”
Background
Fructose 2,6-bisphosphate and the control of glycolysis by glucocorticoids and by other agents in rat hepatoma cells.
Loiseau, A. M., Rousseau, G. G., & Hue, L. (1985) · PubMed · Cited by 32
Regulation of cytosolic aspartate aminotransferase mRNAs in the Fao rat hepatoma cell line by dexamethasone, insulin and cyclic AMP
Barouki, R., Pavé-Preux, M., Bousquet-Lemercier, B., Pol, S., Bouguet, J., & Hanoune, J. (1989) · European Journal of Biochemistry · doi:10.1111/j.1432-1033.1989.tb15180.x · Cited by 32
Antisense Oligonucleotides as Potential Therapeutics for Type 2 Diabetes
Chen, S., Sbuh, N., & Veedu, R. N. (2020) · Nucleic Acid Therapeutics · doi:10.1089/nat.2020.0891 · Cited by 30
“Glucocorticoids promote gluconeogenesis in liver [139,140], reduce glucose uptake in muscle and fat [141,142], and inhibit glycogen synthesis in skeletal muscle [143,144] by antagonizing insulin response.”
Modeling receptor/gene-mediated effects of corticosteroids on hepatic tyrosine aminotransferase dynamics in rats: dual regulation by endogenous and exogenous corticosteroids
Hazra, A., Pyszczynski, N. A., DuBois, D. C., Almon, R. R., & Jusko, W. J. (2007) · Journal of Pharmacokinetics and Pharmacodynamics · doi:10.1007/s10928-007-9063-3 · Cited by 30
“Although the practical advantages in using this model are substantial, adrenalectomy may lead to undesirable physiological changes such as increased sensitivity of hepatic cAMP in response to catecholamines [12], decrease in body weight [13], delay in onset of puberty in female rats, changes in expression of various n…”
Background
Glucocorticoid-Induced Osteoporosis
Adler, R. A., Curtis, J. R., Weinstein, R. S., & Saag, K. G. (2008) · Elsevier eBooks · doi:10.1016/b978-012370544-0.50046-x · Cited by 27
Neuroendocrine, Metabolic, and Immune Functions during the Acute Phase Response of Inflammatory Stress in Monosodium L-Glutamate-Damaged, Hyperadipose Male Rat
Castrogiovanni, D. C., Gaillard, R. C., Giovambattista, A., & Spinedi, E. (2008) · Neuroendocrinology · doi:10.1159/000124131 · Cited by 26
Effects of Dexamethasone and Growth Hormone Treatment on Hepatic Gluconeogenic Enzymes in Calves
Hammon, H. M., Philipona, C., Zbinden, Y., Blum, J. W., & Donkin, S. S. (2005) · Journal of Dairy Science · doi:10.3168/jds.s0022-0302(05)72887-3 · Cited by 26
Angiotensin II stimulates the reactivity of the pituitary-adrenal axis in leptin-resistant Zucker rats, thereby influencing the glucose utilization
Müller‐Fielitz, H., Schweitzer, N., Jöhren, O., Dominiak, P., & Raasch, W. (2007) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.00650.2006 · Cited by 25
“Considering that plasma glucose was high in the CRH test and OGTT, whereas corticosterone remained elevated, one might hypothesize that this effect is due to enhanced gluconeogenesis, since glucocorticoids are known to play a permissive role in the regulation of gluconeogenesis (25).”
Background
Effect of brief exposure to a potential predator on cortisol concentrations in female Columbian ground squirrels (Spermophilus columbianus)
Hubbs, A. H., Millar, J. S., & Wiebe, J. P. (2000) · Canadian Journal of Zoology · doi:10.1139/z99-244 · Cited by 25
An aptamer-responsive microneedle patch sensor platform combining with hybridization chain reaction amplification for detection of steroid hormone cortisol in skin interstitial fluid
Zhou, Y., He, L., Zhang, M., Chen, M., Wu, Y., Qi, L., Qi, L., Zhang, B., Yang, X., He, X., et al. (2024) · Biosensors and Bioelectronics · doi:10.1016/j.bios.2024.116935 · Cited by 25
Physiological plasticity in elephants: highly dynamic glucocorticoids in African and Asian elephants
Pokharel, S. S., & Brown, J. L. (2023) · Conservation Physiology · doi:10.1093/conphys/coad088 · Cited by 23
Temperament Type Specific Metabolite Profiles of the Prefrontal Cortex and Serum in Cattle
Brand, B., Hadlich, F., Brandt, B., Schauer, N., Graunke, K. L., Langbein, J., Repsilber, D., Ponsuksili, S., & Schwerin, M. (2015) · PLoS ONE · doi:10.1371/journal.pone.0125044 · Cited by 22
“In addition, the observed significant higher abundance of glucocorticoid 5a-tetrahydrocorticosterone in the fearful/neophobic-alert animals is concordant to the significant higher abundance of intermediates of gluconeogenesis [53] like glucose, glucose-6-phophat and fructose-6-phosphat (Table A in S2 File) at least in…”
Background
Analysis of Corticosterone and Testosterone Synthesis in Rat Salivary Gland Homogenates
Ieko, T., Sasaki, H., Maeda, N., Fujiki, J., Iwano, H., & Yokota, H. (2019) · Frontiers in Endocrinology · doi:10.3389/fendo.2019.00479 · Cited by 21
“The glucocorticoids inhibit the uptake of glucose by competing with the insulin response in skeletal muscle and white adipocytes (50, 51).”
Background
Glucocorticoids and activity in free-living arctic ground squirrels: Interrelationships between weather, body condition, and reproduction
Zhang, V. Y., Williams, C. T., Palme, R., & Buck, C. L. (2020) · Hormones and Behavior · doi:10.1016/j.yhbeh.2020.104818 · Cited by 20
“One major function of GCs is to promote gluconeogenesis (Dallman et al., 1993; Exton, 1979; Hasselgren, 1999), and the Energy Mobilization hypothesis posits that GC concentrations will be highest during time points with the highest energetic demands (Romero, 2002).”
Background
Triiodothyronine (T3) levels fluctuate in response to ambient temperature rather than nutritional status in a wild tropical ungulate
Hunninck, L., Jackson, C. R., May, R. F., Røskaft, E., Palme, R., & Sheriff, M. J. (2020) · Conservation Physiology · doi:10.1093/conphys/coaa105 · Cited by 19
Developmental programming of tissue-resident macrophages
Viola, M. F., Taveras, E. F., & Mass, E. (2024) · Frontiers in Immunology · doi:10.3389/fimmu.2024.1475369 · Cited by 22
Glucocorticoids and Diabetes.
Bauerle, K. T., & Harris, C. A. (2016) · Europe PMC (PubMed Central) · Cited by 20
Glucocorticoid‐Dependent Induction of mRNA Coding for Phosphoenolpyruvate Carboxykinase (GTP) in Rat Kidney
Iynedjian, P. B., & JACOT, M. M. (1980) · European Journal of Biochemistry · doi:10.1111/j.1432-1033.1980.tb06078.x · Cited by 20
Insulin inhibits glucocorticoid‐induced stimulation of liver 6‐phosphofructo‐2‐kinase/fructose‐2,6‐bisphosphatase gene transcription
Lemaigre, F. P., Lause, P., & Rousseau, G. G. (1994) · FEBS Letters · doi:10.1016/0014-5793(94)80142-8 · Cited by 20
Glycogen synthesis in serum-free cultured hepatocytes in response to insulin and dexamethasone
López, M. P., Gómez‐Lechón, M. J., & Castell, J. V. (1984) · In Vitro Cellular & Developmental Biology - Plant · doi:10.1007/bf02619665 · Cited by 20
Effect of spontaneous hyperadrenocorticism on endogenous production and utilization of glucose in the dog
Peterson, M. E., Winkler, B., Kintzer, P. P., & ALTSZULER, N. (1986) · Domestic Animal Endocrinology · doi:10.1016/0739-7240(86)90018-4 · Cited by 18
Corticosterone modulates acute toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in male Sprague-Dawley rats
Gorski, J. R. (1988) · Fundamental and Applied Toxicology · doi:10.1016/0272-0590(88)90113-3 · Cited by 18
Maladaptive Neuroplasticity Under Stress: Insights into Neuronal and Synaptic Changes in the Prefrontal Cortex
Ren, B., Yuan, Q., Cha, S., Liu, S.-Y. M., Zhang, J., & Guo, G. (2025) · Molecular Neurobiology · doi:10.1007/s12035-025-05152-5 · Cited by 21
“They primarily modulate glucose metabolism by promoting gluconeogenesis and inhibiting insulin secretion (reviewed in [71]).”
How should rheumatologists manage glucocorticoid-induced hyperglycemia?
Nakamura, H., Fujieda, Y., Nakamura, A., & Atsumi, T. (2020) · Modern Rheumatology · doi:10.1080/14397595.2020.1823060 · Cited by 20
“[5] and reduction of peripheral insulin sensitivity [6].”
Background
Simultaneous detection of salivary cortisol and cortisone using an automated high-throughput sample preparation method for LC-MS/MS
Fariha, R., Jabrah, M., Hill, C., Spooner, A., Deshpande, P. S., & Tripathi, A. (2022) · SLAS TECHNOLOGY · doi:10.1016/j.slast.2022.01.006 · Cited by 17
GLUCOCORTICOIDS AND GLUCOSE METABOLISM: HEPATIC GLUCOSE PRODUCTION IN UNTREATED ADDISONIAN PATIENTS AND ON TWO DIFFERENT LEVELS OF GLUCOCORTICOID ADMINISTRATION
Malerbi, D. A. C., Liberman, B., Filho, A. G., Giannella‐Neto, D., & WAJCHENBERG, B. L. (1988) · Clinical Endocrinology · doi:10.1111/j.1365-2265.1988.tb03673.x · Cited by 16
Parenteral Nourishment of Patients Undergoing Surgical or Traumatic Stress
Gilder, H. (1986) · Journal of Parenteral and Enteral Nutrition · doi:10.1177/014860718601000188 · Cited by 17
EJE Prize 2023: genes on steroids—genomic control of hepatic metabolism by the glucocorticoid receptor
Quagliarini, F., Makris, K., Friano, M. E., & Uhlenhaut, N. H. (2023) · European Journal of Endocrinology · doi:10.1093/ejendo/lvad048 · Cited by 19
Investigation of the impact of birth by cesarean section on fetal and maternal metabolism
Shokry, E., Marchioro, L., Uhl, O., García-Bermúdez, M., García-Santos, J. A., Segura, M. T., Campoy, C., & Koletzko, B. V. (2019) · Archives of Gynecology and Obstetrics · doi:10.1007/s00404-019-05213-w · Cited by 16
Effects of mammalian ACTH on potential fuels and gluconeogenic substrates in the plasma of the spiny dogfish shark (Squalus acanthias)
deRoos, R., & deRoos, C. C. (1992) · General and Comparative Endocrinology · doi:10.1016/0016-6480(92)90161-c · Cited by 16
Glucocorticoids modulate renal glucocorticoid receptors and Na-K ATPase activity
Ellis, D., Sothi, T. D., & Avner, E. D. (1987) · Kidney International · doi:10.1038/ki.1987.233 · Cited by 15
Stress as a facilitator? Territorial male impala have higher glucocorticoid levels than bachelors
Hunninck, L., Palme, R., & Sheriff, M. J. (2020) · General and Comparative Endocrinology · doi:10.1016/j.ygcen.2020.113553 · Cited by 13
Short-term exposure to 12‰ brackish water has significant effects on the endocrine physiology of juvenile American alligator (Alligator mississippiensis)
Faulkner, P. C., Hala, D. N., Rahman, M. S., & Petersen, L. H. (2019) · Comparative Biochemistry and Physiology Part A Molecular & Integrative Physiology · doi:10.1016/j.cbpa.2019.110531 · Cited by 13
Perioperative Complications of Adrenal Surgery
Angermeier, K. W., & Montie, J. E. (1989) · Urologic Clinics of North America · doi:10.1016/s0094-0143(21)01840-1 · Cited by 12
Glucagon 100 years. Important, but still enigmatic
Holst, J. J. (2023) · Peptides · doi:10.1016/j.peptides.2023.170942 · Cited by 11
“depends on the substrate (amino acids and glycerol) provision, which is regulated by the glucocorticoids and the HPA axis [32].”
Elevation of plasma glucose, alanine, and urea levels by mammalian ACTH in the American bullfrog (Rana catesbeiana)
Rosenthal, E. J., & deRoos, R. (1985) · General and Comparative Endocrinology · doi:10.1016/0016-6480(85)90370-3 · Cited by 11
The hypothalamic-pituitary-adrenal (HPA) axis: A major mediator of the adaptive responses to stress
Gabry, K. E., Chrousos, G. P., & Gold, P. W. (2003) · Neuroimmune biology · doi:10.1016/s1567-7443(03)80055-8 · Cited by 12
Characterizing the postnatal hypothalamic–pituitary–adrenal axis response of in utero heat stressed pigs at 10 and 15 weeks of age
Maskal, J. M., Brito, L. F., Duttlinger, A. W., Kpodo, K. R., McConn, B. R., Byrd, C. J., Richert, B. T., Marchant, J. N., Lay, D. C., Jr., Perry, S. D., et al. (2021) · Scientific Reports · doi:10.1038/s41598-021-01889-w · Cited by 10
Efeitos sistêmicos e síndrome de retirada em tomadores crônicos de corticosteróides
Faiçal, S., & Uehara, M. H. (1998) · Revista da Associação Médica Brasileira · doi:10.1590/s0104-42301998000100014 · Cited by 10
Pathophysiology of type II diabetes mellitus
Pierre-Jerome, C. (2024) · Elsevier eBooks · doi:10.1016/b978-0-443-13328-2.00003-9 · Cited by 11
Annotation of differential protein expression in the hypothalami of layer-type Taiwan country chickens in response to acute heat stress
Tu, W., Cheng, C., Chen, C., Chan, H., Wang, S.-H., Tang, P., Chen, C., Lee, Y., Chen, S., & Huang, S. (2018) · Journal of Thermal Biology · doi:10.1016/j.jtherbio.2018.08.013 · Cited by 9
Glucocorticoid-induced changes in glucocorticoid receptor mRNA and protein expression in the human placenta as a potential factor for altering fetal growth and development
Bivol, S., Owen, S., & Rose’Meyer, R. B. (2016) · Reproduction Fertility and Development · doi:10.1071/rd15356 · Cited by 11
“…including (but not limited to) metabolism, stress response, vascular responsiveness, embryogenesis, reproduction and programmed cell death (Exton 1979; Meagher et al. 1996; Barnes 1998; Newton 2000; Sapolsky et al. 2000; Arlt and Stewart 2005), the biological roles of corticosterone in…”
Normalization of enhanced hepatic gluconeogenesis by the antiglucocorticoid RU 38486 in acutely uraemic rats
Schaefer, R. M., Riegel, W., STEPHAN, E., KELLER, H., Hörl, W. H., & Heidland, A. (1990) · European Journal of Clinical Investigation · doi:10.1111/j.1365-2362.1990.tb01788.x · Cited by 9
Improved Insulin Sensitivity during Pioglitazone Treatment Is Associated with Changes in IGF-I and Cortisol Secretion in Type 2 Diabetes and Impaired Glucose Tolerance
Arnetz, L., Ekberg, N. R., Höybye, C., Brismar, K., & Alvarsson, M. (2013) · ISRN Endocrinology · doi:10.1155/2013/148497 · Cited by 8
“Cortisol has anti-insulin effects on glucose metabolism, increasing gluconeogenesis and decreasing glucose uptake [6].”
Background
Síndrome de Cushing exógena e retirada de glicocorticóides
Romanholi, D. J. P. C., & Salgado, L. R. (2007) · Arquivos Brasileiros de Endocrinologia & Metabologia · doi:10.1590/s0004-27302007000800014 · Cited by 8
Associations of Lameness with Indicators of Nitrogen Metabolism and Excretion in Dairy Cows
Necula, D.-C., Warren, H. E., Taylor-Pickard, J. A., Simiz, E., & Ştef, L. (2022) · Agriculture · doi:10.3390/agriculture12122109 · Cited by 7
An adventitious role of cortisol in degenerative processes due to decreased opposition by insulin: Implications for aging
Sorenson, D. K. (1981) · Medical Hypotheses · doi:10.1016/0306-9877(81)90068-2 · Cited by 7
A cross-tissue transcriptomic approach decodes glucocorticoid receptor-dependent links to human metabolic phenotypes
Piechota, M., Zięba, M., Borczyk, M., Gołda, S., Hajto, J., Skupio, U., Ślęzak, M., Parkitna, J. M. R., & Korostyński, M. (2025) · BMC Genomics · doi:10.1186/s12864-025-11676-w · Cited by 7
Association between Diabetes and Rheumatoid Arthritis: A Systematic Literature Review
Okais, J., Fayad, F., Baddoura, R., Tabesh, O. A., Aouad, K., Ghoubar, M., Sunna, N., & Mysler, E. (2022) · The Open Rheumatology Journal · doi:10.2174/18743129-v16-e221205-2022-13 · Cited by 6
Glucocorticoid-Induced Osteoporosis
Adler, R. A., Weinstein, R. S., & Saag, K. G. (2013) · Elsevier eBooks · doi:10.1016/b978-0-12-415853-5.00049-2 · Cited by 6
Glucocorticoid Receptor Antagonism Improves Glucose Metabolism in a Mouse Model of Polycystic Ovary Syndrome
Li, S., Ying, Z., Gentenaar, M., Rensen, P. C. N., Kooijman, S., Visser, J. A., Meijer, O. C., & Kroon, J. (2023) · Journal of the Endocrine Society · doi:10.1210/jendso/bvad162 · Cited by 5
“Glucocorticoid receptor (GR) signaling is known to play a major role in various metabolic process [12, 13], including lipid metabolism [14] and glucose metabolism [15-17].”
Background
Unraveling the mysteries of hepatic insulin signaling: deconvoluting the nuclear targets of insulin
Kitamoto, T., & Accili, D. (2023) · Endocrine Journal · doi:10.1507/endocrj.ej23-0150 · Cited by 4
Role of small leucine zipper protein in hepatic gluconeogenesis and metabolic disorder
Kang, M., Han, S. K., Kim, S., Park, S., Jo, Y., Kang, H., & Ko, J. (2020) · Journal of Molecular Cell Biology · doi:10.1093/jmcb/mjaa069 · Cited by 4
“Blood glucose level is tightly regulated by various hormones such as insulin, glucagon, and glucocorticoids (Exton, 1979; Kraus-Friedmann, 1984; Roder et al., 2016).”
Background
Glucocorticoid biology — a historical perspective
Munck, A. U. (2001) · Birkhäuser Basel eBooks · doi:10.1007/978-3-0348-8348-1_2 · Cited by 4
Oral Metformin Treatment Counteracts Adipoinsular Axis Dysfunction in Hypothalamic Obese Rats
Castrogiovanni, D. C., Ongaro, L., Zuburía, G., Giovambattista, A., & Spinedi, E. (2015) · International Scholarly Research Notices · doi:10.1155/2015/284042 · Cited by 4
“Moreover, animals under endotoxemia also develop an increase in glucocorticoid production that precedes that of insulin [27]; thus the enhanced glucocorticoid endogenous environment could be cooperating for maintaining glucose homeostasis [49], a phenomenon vital for survival during endotoxic shock.”
Background
The influence of Rooibos (Aspalathus linearis) on adrenal steroidogenic P450 enzymes
Perold, H. (2009) · SUNScholar (Stellenbosch University) · Cited by 4
Steroid-dependent metabolic rewiring reveals novel therapeutic and imaging approaches for glioblastoma
Allega, M. F., Deshmukh, R. S., Hillinger, T., Akhmetshina, A., Oudin, A., Bielik, R., Soloviev, D., Villar, V. H., Ackermann, T., Bourmeau, G., et al. (2026) · Science Advances · doi:10.1126/sciadv.adx6539 · Cited by 3
“They promote gluconeogenesis in the liver ( 12 ), whereas in skeletal muscle and white adipose tissue, they cause a decrease in glucose uptake antagonizing insulin signaling ( 13 ) and inducing hyperlipidemia ( 14 ).”
Diabetes support from romantic partners during early emerging adulthood
de Grey, R. G. K., Berg, C. A., Campbell, M. S., Munion, A. K., Luyckx, K., Raymaekers, K., Litchman, M. L., & Wiebe, D. J. (2022) · Journal of Behavioral Medicine · doi:10.1007/s10865-021-00271-5 · Cited by 7
“For example, cortisol is involved in regulation of the pancreas, glucagon secretion and glucose uptake (Exton, 1979; Kuo et al., 2015; Thau et al., 2021), meaning that dysregulation of cortisol may complicate the management of blood glucose.”
System identification of the control of gluconeogenesis in the intact organism under conditions of long-term stress
Paletta, B., Estelberger, W., & Porod, G. (1981) · Journal of Mathematical Biology · doi:10.1007/bf00275438 · Cited by 3
Elevated glucocorticoids during the ovarian follicular phase predict conception in wild female chacma baboons.
Steiniche, T., Foerster, S., White, K., Monfort, S., Brown, J. L., Chowdhury, S., & Swedell, L. (2023) · Hormones and Behavior · doi:10.1016/j.yhbeh.2023.105354 · Cited by 2
Stress and parental behaviors
Wang, Y., & Lin, D. (2024) · Neuroscience Research · doi:10.1016/j.neures.2024.12.004 · Cited by 2
“Glucocorticoids cause a wide range of bodily changes, such as increasing glucose levels to fuel the muscle and brain and suppressing immune systems (Hostinar et al., 2014; Coutinho and Chapman, 2011; Exton, 1979; Chourpiliadis and Narothama, 2024).”
Signaling Pathways That Promote Muscle Catabolism in Cachexia
Gilda, J. E., & Cohen, S. (2022) · Springer eBooks · doi:10.1007/978-3-031-09518-4_5 · Cited by 2
Hormonal and metabolic control of hepatic carbohydrate metabolism
Jakob, A. (1981) · Molecular Aspects of Medicine · doi:10.1016/0098-2997(81)90009-1 · Cited by 2

Authors: Exton, J. H.
Corresponding author: Exton, J. H.
Venue: Monographs on endocrinology
Publisher: Springer Berlin Heidelberg
Published: 1979
Volume: 12
Pages: 535-546
ISSN: 0077-1015 (ISSN-L)
DOI: 10.1007/978-3-642-81265-1_28
OpenAlex: W2407810808
Cited by: 130
References: 46
Citations by year: 2026: 5 · 2025: 4 · 2024: 6 · 2023: 10 · 2022: 8 · 2021: 3 · 2020: 10 · 2019: 4 · 2018: 2 · 2017: 4 · 2016: 5 · 2015: 4 · 2014: 1 · 2013: 3 · 2012: 4
FWCI: 2.39
Type: book chapter
Language: en
Open access: closed
Locations: Monographs on endocrinology (publishedVersion)
PubMed (publishedVersion)
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Metabolism, Diabetes, and Cancer
Life Sciences › Biochemistry, Genetics and Molecular Biology › Endocrinology › Estrogen and related hormone effects
Health Sciences › Medicine › Endocrinology, Diabetes and Metabolism › Adrenal Hormones and Disorders
Keywords: gluconeogenesis, glucocorticoids, starvation, adrenal insufficiency, glucocorticoid replacement therapy, protein synthesis, lipolysis, catecholamines, glycogenolysis, transcriptional regulation, glucagon, epinephrine, cAMP signaling, alpha-adrenergic receptors, diabetes mellitus
MeSH terms: Adrenalectomy, Animals, Diabetes Mellitus, Experimental, Epinephrine, Glucagon, Glucocorticoids, Gluconeogenesis, Hydrocortisone, Liver, Rats

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Regulation of gluconeogenesis by glucocorticoids.

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Citations

Cites

Cited by

Related

Metadata

Record

About these checks