The DOI matches its Crossref record; 68 of the 68 references it cites were found in a registry or an index.
Apoptotic Caspases Suppress mtDNA-Induced STING-Mediated Type I IFN Production
Open accessAbstract
Activated caspases are a hallmark of apoptosis induced by the intrinsic pathway, but they are dispensable for cell death and the apoptotic clearance of cells in vivo. This has led to the suggestion that caspases are activated not just to kill but to prevent dying cells from triggering a host immune response. Here, we show that the caspase cascade suppresses type I interferon (IFN) production by cells undergoing Bak/Bax-mediated apoptosis. Bak and Bax trigger the release of mitochondrial DNA. This is recognized by the cGAS/STING-dependent DNA sensing pathway, which initiates IFN production. Activated caspases attenuate this response. Pharmacological caspase inhibition or genetic deletion of caspase-9, Apaf-1, or caspase-3/7 causes dying cells to secrete IFN-β. In vivo, this precipitates an elevation in IFN-β levels and consequent hematopoietic stem cell dysfunction, which is corrected by loss of Bak and Bax. Thus, the apoptotic caspase cascade functions to render mitochondrial apoptosis immunologically silent.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The cited source says what the claim attributes to it.
In the citing paper
“In the absence of active caspases, mtDNA released following mitochondrial outer membrane permeabilization triggers type I interferon responses in a cGAS–STING-dependent manner143,144”
From The role of mitochondria in rheumatic diseases (2022) · cites this paper as [144]
Experimental — accuracy not yet measuredIn the citing paper
“These include: (1) the prominent ability of CASP8 to inhibit necroptosis (see above), which is generally associated with the establishment of robust inflammatory responses linked to NF-κB activation [496 925–928]; (2) the capacity of CASP3 to drive PS exposure (see above), which generally supports the phagocytic removal of dying and dead cells while delivering anti-inflammatory signals to”
From Molecular mechanisms of cell death: recommendations of the nomenclature committee on cell death 2018. (2018) · cites this paper as [932]
In the citing paper
“MtDNA has been reported to activate immunity through two distinct pathways, namely Toll-like receptor 9 (TLR9; Zhang et al, 2010;Oka et al, 2012;Liu et al, 2015), and cGAS activation (White et al, 2014;West et al, 2015).”
From Mitochondrial DNA and TLR9 drive muscle inflammation upon Opa1 deficiency (2018) · cites this paper as White et al, 2014
In the citing paper
“Thus, cytosolic mtDNA activates the DNA sensor cGAS and promotes STING-IRF3-dependent signaling (Rongvaux et al, 2014;White et al, 2014;West et al, 2015).”
From Mitochondrial DNA and TLR9 drive muscle inflammation upon Opa1 deficiency (2018) · cites this paper as White et al, 2014
In the citing paper
“Interestingly, these events were attenuated by caloric restriction (White et al., 2014), an intervention which has been shown to extend lifespan in a plethora of organisms and decrease the burden of senescent cells (Fontana et al., 2018; Mercken et al., 2012).”
From Cytoplasmic DNA: sources, sensing, and role in aging and disease (2021) · cites this paper as White et al., 2014
In the citing paper
“Finally, ABT-737 (an experimental inhibitor of multiple BCL2 family members) is known for its ability to drive robust type I IFN secretion by cancer cells downstream of mtDNA-driven CGAS activation, especially in the context of caspases inhibition (Rongvaux et al., 2014; White et al., 2014).”
From Immunomodulation by targeted anticancer agents (2021) · cites this paper as White et al., 2014
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
Subramanian, A., Tamayo, P., Mootha, V. K., Mukherjee, S., Ebert, B. L., Gillette, M. A., Paulovich, A., Pomeroy, S. L., Golub, T. R., Lander, E. S., et al. (2005) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0506580102 · Cited by 53,625
Smyth, G. K. (2004) · Statistical Applications in Genetics and Molecular Biology · doi:10.2202/1544-6115.1027 · Cited by 11,829
Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S. M., Ahmad, M., Alnemri, E. S., & Wang, X. (1997) · Cell · doi:10.1016/s0092-8674(00)80434-1 · Cited by 7,289
limma: Linear Models for Microarray Data
Smyth, G. K. (2005) · Statistics for Biology and Health · doi:10.1007/0-387-29362-0_23 · Cited by 5,796
Cyclic GMP-AMP Synthase Is a Cytosolic DNA Sensor That Activates the Type I Interferon Pathway
Sun, L., Wu, J., Du, F., Chen, X., & Chen, Z. J. (2013) · Science · doi:10.1126/science.1232458 · Cited by 4,996 · cited 1×
“Recent evidence indicates that cGAS is activated via a direct interaction with cytosolic DNA (Civril et al., 2013; Sun et al., 2013).”
The BCL-2 protein family: opposing activities that mediate cell death
Youle, R. J., & Strasser, A. (2007) · Nature Reviews Molecular Cell Biology · doi:10.1038/nrm2308 · Cited by 4,806 · cited 1×
“Apoptosis comprises two convergent pathways: the intrinsic and extrinsic (Youle and Strasser, 2008).”
Proapoptotic BAX and BAK: A Requisite Gateway to Mitochondrial Dysfunction and Death
Wei, M. C., Zong, W.-X., Cheng, E. H.-Y., Lindsten, T., Panoutsakopoulou, V., Ross, A. J., Roth, K. A., MacGregor, G. R., Thompson, C. B., & Korsmeyer, S. J. (2001) · Science · doi:10.1126/science.1059108 · Cited by 3,988 · cited 1×
“, they can survive and generate viable progeny) (Lindsten et al., 2000; Wei et al., 2001).”
Bioinformatics and Computational Biology Solutions Using R and Bioconductor
Gentleman, R. C., Carey, V. J., Huber, W. K., Irizarry, R. A., & Dudoit, S. (2005) · Statistics in the health sciences · doi:10.1007/0-387-29362-0 · Cited by 3,470
An inhibitor of Bcl-2 family proteins induces regression of solid tumours
Oltersdorf, T., Elmore, S. W., Shoemaker, A. R., Armstrong, R. C., Augeri, D. J., Belli, B., Bruncko, M., Deckwerth, T. L., Dinges, J., Hajduk, P. J., et al. (2005) · Nature · doi:10.1038/nature03579 · Cited by 3,407 · cited 1×
“To test this, we treated WT murine splenocytes with the proapoptotic BH3 mimetic drug ABT-737, which targets the prosurvival proteins Bcl-xL and Bcl-2 (Oltersdorf et al., 2005).”
A caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD
Enari, M., Sakahira, H., Yokoyama, H., Okawa, K., Iwamatsu, A., & Nagata, S. (1998) · Nature · doi:10.1038/34112 · Cited by 3,239 · cited 1×
“Unlike genomic damage, which is triggered by cleavage of iCAD, the inhibitor of caspase-activated DNase (CAD) (Enari et al., 1998), and PS exposure, which is facilitated by cleavage of Xkr8 (Suzuki et al.”
Flagged first, then by citations
Cited by
Sorted by citations
Items 601–700 of 982
Circulating Cell-Free Mitochondrial DNA in Pregnancy
Bradshaw, J. L., Cushen, S. C., Phillips, N., & Goulopoulou, S. (2022) · Physiology · doi:10.1152/physiol.00037.2021 · Cited by 16
The Entanglement between Mitochondrial DNA and Tumor Metastasis
Wu, Q., Tsai, H., Zhu, H., & Wang, D. (2022) · Cancers · doi:10.3390/cancers14081862 · Cited by 19
“BAX/BAK is activated during apoptosis, whereby large BAX/BAK pores appear on the outer membrane of mitochondria, while the inner membrane of mitochondria can herniate into the cytoplasm and carry mtDNA [38,39].”
BackgroundSchattenberg, J. M., & Lee, M. (2016) · Gastroenterology · doi:10.1053/j.gastro.2016.02.064 · Cited by 18
“However, there are some caveats: first, the use of caspase inhibitors has been shown to enhance necroptosis or the release of inflammatory type 1 interferon alpha not only in vitro, but also in vivo.(13) Still, currently explored caspase inhibitors appear to be safe(14) and their safety is likely to increase further w…”
BackgroundYan, Y., Xie, R., Zhang, Q., Zhu, X., Han, J. G., & Xia, R. (2017) · Platelets · doi:10.1080/09537104.2017.1371289 · Cited by 18
“The proapoptotic Bcl-2 proteins Bak and Bax similarly block pro-survival signals, and cells lacking these proteins do not exhibit cytochrome c release or caspase activation [20].”
BackgroundFullstone, G., Bauer, T. L., Guttà, C., Salvucci, M., Prehn, J. H. M., & Rehm, M. (2020) · Cell Death and Differentiation · doi:10.1038/s41418-020-0545-9 · Cited by 17
Kulyar, M. F., Yao, W., Ding, Y., Du, H., Mo, Q., Pan, H., Shahzad, M., Mehmood, K., Iqbal, M., Akhtar, M. F., et al. (2021) · Phytomedicine · doi:10.1016/j.phymed.2021.153865 · Cited by 17
Macrophage cell death upon intracellular bacterial infection
Lai, X., Xu, Y., Chen, X.-M., & Ren, Y. (2015) · Macrophage · doi:10.14800/macrophage.779 · Cited by 18
“Activation of the apoptotic caspase cascade can block the cGAS/STING pathway, inactivate the IFN response, and generate the classical "eat me" signal [102-104] to make the macrophage death immunologically silent.”
BackgroundSelim, N. M., El‐Hawary, S. S., El-Zalabani, S. M. H., Shamma, R. N., Mahdy, N. E., Sherif, N. H., Fahmy, H. A., Mekkawy, M. H., Yasri, A., & Sobeh, M. (2020) · Pharmaceuticals · doi:10.3390/ph13100320 · Cited by 19
“A variety of intrinsic and extrinsic stressors are capable of initiating caspase activation [49].”
Background[Mitochondrial DNA and cGAS-STING Innate Immune Signaling Pathway: Latest Research Progress].
Li, Y.-X., Cui, S.-F., Meng, W., Hu, H., & Wang, C. (2021) · 四川大学学报：医学版 · doi:10.12182/20210560501 · Cited by 17
Klaas, L., Vier, J., Gentle, I. E., Häcker, G. A., & Kirschnek, S. (2021) · Cell Death and Disease · doi:10.1038/s41419-021-04286-3 · Cited by 19
Isolation of endogenous cytosolic DNA from cultured cells
Mosley, S. R., & Baker, K. (2022) · STAR Protocols · doi:10.1016/j.xpro.2022.101165 · Cited by 16
Tang, Q., Guo, Q., Li, K., & Fei, F. (2022) · Neuropsychiatric Disease and Treatment · doi:10.2147/ndt.s364250 · Cited by 17
“The latter specifies that the apoptotic caspase cascade attenuates the inflammatory response.(21) Given the selective inhibition of caspase-1, VRT-043198 has no effect on apoptosis as it is an immunologically silent phenomenon.”
BackgroundSRSF6 balances mitochondrial-driven innate immune outcomes through alternative splicing of BAX
Wagner, A. R., Weindel, C. G., West, K. O., Scott, H. M., Watson, R. O., & Patrick, K. L. (2022) · eLife · doi:10.7554/elife.82244 · Cited by 16
“Seminal work from White et al. and Rongveux et al. implicates apoptotic caspases in suppressing cGAS-dependent type I IFN expression via mtDNA released by BAX/BAK pores during mitochondrial apoptosis (Rongvaux et al., 2014; White et al., 2014).”
BackgroundMohamed, E. E., Ahmed, O. M., Abdel‐Moneim, A., Zoheir, K. M. A., Elesawy, B. H., Askary, A., Hassaballa, A., & El‐Shahawy, A. A. G. (2022) · Pharmaceuticals · doi:10.3390/ph15121558 · Cited by 17
“Both IQGAP1 and IQGAP3 are considered oncogenes in HCC and, thus, can serve as highly sensitive and specific biomarkers for this type of tumor, while IQGAP2 may act as a tumor suppressor [92,93].”
BackgroundA Biodegradable Antigen Nanocapsule Promotes Anti‐Tumor Immunity via the cGAS‐STING Pathway
Jia, X., Chen, H., Wu, M., Wang, L., Li, T., Ma, J., Yi, X., Tan, P., Zheng, P., & Du, J. (2023) · Advanced Functional Materials · doi:10.1002/adfm.202212085 · Cited by 18
Wei, J., Li, Y., Ye, Z., Li, Y., & Zhou, Z. (2023) · Foods · doi:10.3390/foods12183469 · Cited by 17
The molecular mechanism of dsDNA sensing through the cGAS-STING pathway
Shinde, O., & Li, P. (2024) · Advances in immunology · doi:10.1016/bs.ai.2024.02.003 · Cited by 16
Activation of the Innate Immune Receptors: Guardians of the Micro Galaxy
Nardo, D. D. (2017) · Advances in experimental medicine and biology · doi:10.1007/978-981-10-5987-2_1 · Cited by 16
Apoptotic mitochondria prime anti-tumour immunity
McArthur, K., & Kile, B. T. (2020) · Cell Death Discovery · doi:10.1038/s41420-020-00335-6 · Cited by 19
Self-citationDNA sensing and immune responses in cancer therapy
Qiao, J., Tang, H., & Fu, Y. (2017) · Current Opinion in Immunology · doi:10.1016/j.coi.2016.12.005 · Cited by 17
Proteinase 3 Limits the Number of Hematopoietic Stem and Progenitor Cells in Murine Bone Marrow
Karatepe, K., Zhu, H., Zhang, X., Guo, R., Kambara, H., Loison, F., Liu, P., Yu, H., Ren, Q., Luo, X. M., et al. (2018) · Stem Cell Reports · doi:10.1016/j.stemcr.2018.10.004 · Cited by 18
“, 2003), differentiation (Yi and Yuan, 2009), and the silencing of type I interferon production in dying cells to render mitochondrial apoptosis immunologically silent (White et al., 2014) have also been described.”
BackgroundSmarduch, S., Moreno-Velásquez, S. D., Ilic, D., Dadsena, S., Morant, R., Ciprinidis, A., Pereira, G., Binder, M., García‐Sáez, A. J., & Acebrón, S. P. (2025) · The EMBO Journal · doi:10.1038/s44318-025-00370-y · Cited by 18
“Scale bars = 10 μ m. Source data are available online for this fi gure. response to cytosolic mtDNA (Cosentino et al, 2022; Giampazolias et al, 2017; White et al, 2014), triggering of apoptosis in HeLa cells resulted in cell death, but not activation of the biosensor (Fig.”
Kate, W. D., Fanta, M., & Weinfeld, M. (2024) · Nucleic Acids Research · doi:10.1093/nar/gkae654 · Cited by 17
Soh, L.-J., Lee, S.-Y., Roebuck, M. M., & Wong, P. (2024) · Life Sciences · doi:10.1016/j.lfs.2024.123112 · Cited by 15
Metformin downregulates the mitochondrial carrier SLC25A10 in a glucose dependent manner
Zhao, Q., Zhou, X., Curbo, S., & Karlsson, A. (2018) · Biochemical Pharmacology · doi:10.1016/j.bcp.2018.09.015 · Cited by 16
Mitochondria and pathogen immunity: from killer to firestarter
Riley, J. S., & Tait, S. W. G. (2019) · The EMBO Journal · doi:10.15252/embj.2019102325 · Cited by 16
“Paradoxically, while mitochondrial apoptosis is considered immunologically silent, the initiating process of MOMP is inherently pro-inflammatory (Rongvaux et al , 2014; White et al , 2014; Giampazolias et al , 2017).”
Preferential targeting of MCL-1 by a hydrocarbon-stapled BIM BH3 peptide
Hadji, A., Schmitt, G. K., Schnorenberg, M. R., Roach, L. E., Hickey, C. M., Leak, L. B., Tirrell, M., & LaBelle, J. L. (2019) · Oncotarget · doi:10.18632/oncotarget.27262 · Cited by 16
“Mouse embryonic fibroblasts (MEFs) are dependent upon MCL-1, and to a lesser extent, BCL-XL, for survival [31].”
BackgroundMiao, H., Song, R., Xin, Y., Wang, L., Lv, J., Liu, N., Wu, Z., Zhang, W., Li, Y., Zhang, D., et al. (2023) · NeuroMolecular Medicine · doi:10.1007/s12017-023-08737-2 · Cited by 17
“Moreover, chemical inhibition or genetic deletion of caspase-9, caspase-3 and caspase-7 can result in the secretion of inflammatory mediators in dying cells (White et al., 2014).”
InfluentialZhang, L., Zhang, D.-X., Miao, H.-T., Song, R., Shao, J.-J., Liu, J.-Z., Jia, S.-Y., Xin, Y., Wang, H., & Zhang, W. (2023) · International Immunopharmacology · doi:10.1016/j.intimp.2023.109906 · Cited by 15
Fancm has dual roles in the limiting of meiotic crossovers and germ cell maintenance in mammals
Tsui, V., Lyu, R., Novakovic, S., Stringer, J. M., Dunleavy, J. E. M., Granger, E., Semple, T. J., Leichter, A. L., Martelotto, L. G., Merriner, D. J., et al. (2023) · Cell Genomics · doi:10.1016/j.xgen.2023.100349 · Cited by 15
“Sting mice have been described previously(145) and the Sting mice were backcrossed for at least 10 generations on a C57BL/6 background by.(146) The oligos used for genotyping were forward primer 1 (5ʹ GCTGGGAATTGAACGTAG GA 3ʹ), forward primer 2 (5ʹ GTGCCCAGTCATAGCCGAAT 3ʹ, spans deleted region) and reverse primer (5ʹ…”
BackgroundZhou, G., Wang, X., Guo, M., Qu, C., Gao, L., Yu, J., Li, Y., Luo, S., Shi, Q., & Guo, Y. (2023) · Genes & Diseases · doi:10.1016/j.gendis.2023.08.003 · Cited by 15
“Given the important role of mitophagy in mitochondrial quality control and STING pathway activation, 26,27 we next aimed to investigate the association between mitophagy and STING activation in the TAC heart.”
BackgroundZhou, L., Mao, H., Li, J., Chen, Z., & Zhang, L. (2023) · The FASEB Journal · doi:10.1096/fj.202301648r · Cited by 15
The Caspase-Activated DNase drives inflammation and contributes to defense against viral infection
Moeed, A., Thilmany, N., Beck, F., Puthussery, B. K., Ortmann, N., Haimovici, A., Badr, M. T., Haghighi, E. B., Boerries, M., Öllinger, R., et al. (2024) · Cell Death and Differentiation · doi:10.1038/s41418-024-01320-7 · Cited by 14
“…of these pro-in fl ammatory factors, apoptotic cell death is non-in fl ammatory because cell death caspases, which are invariably activated during apoptosis, suppress these in fl ammatory signals, and experimental blockade of caspase-activity is required to unmask the in fl ammatory activity [5 – 7].”
Unlocking Apoptotic Pathways: Overcoming Tumor Resistance in CAR ‐T‐Cell Therapy
Zhang, Z., Su, M., Jiang, P., Wang, X., Tong, X., & Wu, G. (2024) · Cancer Medicine · doi:10.1002/cam4.70283 · Cited by 17
Mitochondria – the CEO of the cell
Lee-Glover, L. P., Picard, M. A., & Shutt, T. E. (2025) · Journal of Cell Science · doi:10.1242/jcs.263403 · Cited by 16
Zhou, X. H., Backman, L. J., & Danielson, P. (2021) · Scientific Reports · doi:10.1038/s41598-021-86522-6 · Cited by 15
Basal IFN-λ2/3 expression mediates tight junction formation in human epithelial cells
Keser, Y., Metz‐Zumaran, C., Uckeley, Z. M., Reuss, D., Doldan, P., Ramsden, J. M., Stanifer, M. L., & Boulant, S. (2025) · The EMBO Journal · doi:10.1038/s44318-025-00539-5 · Cited by 13
“Mitochondrial DNA (mtDNA) was depleted either using Ethidium bromide (EtBr) (protocol adjusted from King and Attardi, 1989) or using 2 ′ -3 ′ -dideoxycytidine (ddC) (protocol adjusted from Rongvaux et al, 2014 (White et al, 2014)).”
Crosstalk Between Cell Death and the cGAS-STING Pathway in Sepsis-Associated Acute Lung Injury
Li, X., Wang, M., Li, Y., Huang, Y., & Xiangcheng, Z. (2025) · Journal of Inflammation Research · doi:10.2147/jir.s543273 · Cited by 16
The role of hepatocyte mitochondrial DNA in liver injury
Xu, Y., Chu, C., Shi, Z., & Zhang, J. (2023) · Biomedicine & Pharmacotherapy · doi:10.1016/j.biopha.2023.115692 · Cited by 19
Rösing, S., Ullrich, F., Meisterfeld, S., Schmidt, F., Mlitzko, L., Croon, M., Nattrass, R. G., Eberl, N., Mahlberg, J., Schlee, M., et al. (2024) · Nature Communications · doi:10.1038/s41467-024-45535-1 · Cited by 15
“MtDNA release is also a hallmark of apoptosis, both downstream of the UPR and due to other causes, and, at the same time, apoptotic cell death is also known to suppress mtDNA-mediated cGAS/STING activation 42,43 .”
BackgroundThe Asthma Risk Gene, GSDMB, Promotes Mitochondrial DNA-induced ISGs Expression
Liu, T., Hecker, J., Liu, S., Rui, X., Boyer, N., Wang, J. P., Yu, Y., Zhang, Y., Mou, H., Gómez-Escobar, L. G., et al. (2024) · Journal of Respiratory Biology and Translational Medicine · doi:10.35534/jrbtm.2024.10005 · Cited by 15
The role of mitochondria in cytokine and chemokine signalling during ageing
Kalykaki, M., Rubio‐Tomás, T., & Tavernarakis, N. (2024) · Mechanisms of Ageing and Development · doi:10.1016/j.mad.2024.111993 · Cited by 14
Nishimura, Y., Shikanai, T., Kawamoto, S., & Toh‐e, A. (2020) · Scientific Reports · doi:10.1038/s41598-020-59277-9 · Cited by 14
Zhao, K., Cui, S., Wang, N., Wei, Q., Wang, X., Hou, K., Zhu, J., & Kong, F. (2026) · Journal of Translational Medicine · doi:10.1186/s12967-026-07748-4 · Cited by 14
“These released mtDNA molecules function as damage-associated molecular patterns (DAMPs), which are detected by cGAS, thereby initiating STING-dependent inflammatory signaling [9, 40, 41].”
What does BCL-2 do? From new molecular insights to the clinical implications
Croce, C. M., Tait, S. W. G., García‐Sáez, A. J., Villunger, A., Letai, A. G., Walter, H. S., Dyer, M. J. S., Green, D. R., Shi, Y., & Melino, G. (2026) · Cell Death and Differentiation · doi:10.1038/s41418-025-01607-3 · Cited by 14
“While the t(14;18) in follicular lymphoma and certain murine models made it clear that BCL-2 could promote tumorigenesis, the therapeutic question was, would antagonizing BCL-2 in an existing tumor actually cause cell death?”
Babu, G., & Nobel, F. (2022) · Informatics in Medicine Unlocked · doi:10.1016/j.imu.2022.101038 · Cited by 11
He, J., Zhao, Y., Zhang, Y., Zhang, Z., Li, D., & Xu, Q. (2024) · Cellular Signalling · doi:10.1016/j.cellsig.2024.111098 · Cited by 13
Grasset, E. M., Barillé‐Nion, S., & Juin, P. P. (2024) · Disease Models & Mechanisms · doi:10.1242/dmm.050542 · Cited by 14
Pan, H., Su, Q., Hong, P., You, Y., Zhou, L., Zou, J., Sun, J., Zhong, G., Liao, J., Zhang, H., et al. (2024) · Pesticide Biochemistry and Physiology · doi:10.1016/j.pestbp.2024.106129 · Cited by 14
ASK family in infection and inflammatory disease
Okazaki, T. (2017) · Advances in Biological Regulation · doi:10.1016/j.jbior.2017.10.001 · Cited by 11
“For example, type I IFN has deleterious effects on bacterial infection (Stifter and Feng, 2015) and reduces the number of hematopoietic stem cells (White et al., 2014).”
BackgroundTumor microenvironment regulation - enhanced radio - immunotherapy
Yu, X., Wang, X., Sun, L., Yamazaki, A., & Li, X. (2022) · Biomaterials Advances · doi:10.1016/j.bioadv.2022.212867 · Cited by 13
T-Cell Repertoire in Tumor Radiation: The Emerging Frontier as a Radiotherapy Biomarker
Baxevanis, C. N., Gritzapis, A. D., Voutsas, I. F., Batsaki, P., Goulielmaki, M., Adamaki, M., Zoumpourlis, V., & Fortis, S. P. (2022) · Cancers · doi:10.3390/cancers14112674 · Cited by 15
“Further evidence supporting the modulation of antitumor immunity by irradiation is provided by the DNA damage, which is induced in the irradiated tumor cells, resulting in immunogenic cell death [18,19].”
BackgroundVoices from beyond the grave: The impact of apoptosis on the microenvironment
Riley, J. S., & Bock, F. J. (2022) · Biochimica et Biophysica Acta (BBA) - Molecular Cell Research · doi:10.1016/j.bbamcr.2022.119341 · Cited by 13
Tabtieng, T., Lent, R. C., Kaku, M., Sanchez, A. M., & Gaglia, M. M. (2022) · mBio · doi:10.1128/mbio.02446-22 · Cited by 12
The expanding regulatory network of STING-mediated signaling
Surpris, G., & Poltorak, A. (2016) · Current Opinion in Microbiology · doi:10.1016/j.mib.2016.05.014 · Cited by 14
“Some of these ligands, such as mitochondrial DNA (mtDNA), easily fit into the DNA-damage based model of STING-activation [16], which is counterbalanced by caspases [17].”
BackgroundConcise Review: Cheating Death for a Better Transplant
Afreen, S., Weiss, J. M., Strahm, B., & Erlacher, M. (2018) · Stem Cells · doi:10.1002/stem.2901 · Cited by 13
Barillé‐Nion, S., Lohard, S., & Juin, P. P. (2020) · Biomolecules · doi:10.3390/biom10081109 · Cited by 16
“In 2014, two studies (using BH3 mimetics) showed that during BAX-BAK dependent MOMP, mitochondrial DNA (mtDNA) is released in the cytosol where it activates the cytosolic DNA sensor pathway cGAS/STING to promote, as does viral infection, an inflammatory reaction with type I IFN expression [95,96].”
BackgroundRuan, J., Wei, X., Li, S., Ye, Z., Hu, L., Zhuang, R., Cao, Y., Wang, S., Wu, S., Peng, D., et al. (2025) · Cell Discovery · doi:10.1038/s41421-024-00750-4 · Cited by 12
Mitochondrial DNA in innate immune responses against infectious diseases
Das, P., & Chakrabarti, O. (2020) · Biochemical Society Transactions · doi:10.1042/bst20200687 · Cited by 12
Lv, D., Zhao, M., Ni, J., Liu, W., Ren, Y., Zhu, D., & Hu, J. (2022) · Theriogenology · doi:10.1016/j.theriogenology.2022.10.017 · Cited by 13
Elzinga, S. E., Koubek, E. J., Hayes, J. M., Carter, A., Mendelson, F. E., Webber‐Davis, I. F., Lentz, S. I., & Feldman, E. L. (2023) · Frontiers in Cellular Neuroscience · doi:10.3389/fncel.2023.1167688 · Cited by 12
“, 2019), including endogenous dsDNA, such as mitochondrial DNAs, which can localize to the cytosol due to cellular stress (White et al., 2014; Bai et al., 2017).”
BackgroundPrognostic value of circulating mitochondrial DNA in prostate cancer and underlying mechanism
Borah, S., Mishra, R., Dey, S., Suchanti, S., Bhowmick, N. A., Giri, B., & Haldar, S. (2023) · Mitochondrion · doi:10.1016/j.mito.2023.05.005 · Cited by 12
Liu, S., Joshi, K., Zhang, L., Li, W., Mack, R. M., Runde, A. P., Hagen, P. A., Barton, K., Breslin, P., Ji, H., et al. (2024) · Cell Death and Disease · doi:10.1038/s41419-024-06660-3 · Cited by 12
“Casp9 − / − HSCs display impaired self-renewal and CHRC due to the increased production of Ifn β [80], which recapitulates the phenotype of our Casp8 − / − Ripk3 − / − HSCs despite the different mechanisms involved in the activation of Tbk1-Irf3 signaling.”
BackgroundSelective BCL-2 inhibitor triggers STING-dependent antitumor immunity via inducing mtDNA release
Zhang, W., Pan, X., Wang, L., Li, W., Dai, X., Zheng, M., Guo, H., Chen, X., Xu, Y., Wu, H., et al. (2025) · Journal for ImmunoTherapy of Cancer · doi:10.1136/jitc-2024-010889 · Cited by 12
Sun, C., Gui, J., Sheng, Y., Huang, L., Zhu, X., & Huang, K. (2025) · Discover Oncology · doi:10.1007/s12672-025-02592-2 · Cited by 12
Zhang, J., Kodali, S., Chen, M., & Wang, J. (2020) · The Journal of Immunology · doi:10.4049/jimmunol.2000359 · Cited by 13
“Caspase-9 can also inhibit inflammatory responses by promoting immunologically silent apoptosis (43, 44), suggesting”
BackgroundMonian, P., & Jiang, X. (2015) · Journal of Biological Chemistry · doi:10.1074/jbc.m115.685008 · Cited by 12
“Finally, it is worth noting that, even in cases where MOMP is sufficient to trigger cell death, caspase-3 activity is essential in preventing an immune response in vivo (42, 43).”
BackgroundLebrec, V., Afshar, N., Davies, L. R., Kujirai, T., Κανέλλου, Α., Tidu, F., & Zierhut, C. (2024) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2024.05.13.593978 · Cited by 12
Ma, J., Liu, Y., Yuan, J., Ma, Y., Zhao, X., Chen, K., Zhang, X., Zhang, F., & Wang, H. (2023) · Cancer Letters · doi:10.1016/j.canlet.2023.216483 · Cited by 11
Li, Z., Chen, Z., Wang, Y., Li, Z., Huang, H., Shen, G., Ren, Y., Mao, X., Wang, W., Ou, J., et al. (2024) · Biomedicine & Pharmacotherapy · doi:10.1016/j.biopha.2024.117134 · Cited by 11
Saad, M., Ibrahim, W., Hasanin, A. H., Elyamany, A. M., & Matboli, M. (2024) · RSC Medicinal Chemistry · doi:10.1039/d4md00477a · Cited by 12
Review of Excessive Cytosolic DNA and Its Role in AIM2 and cGAS-STING Mediated Psoriasis Development
Xu, T., Zhong, X., Luo, N., Ma, W., & Hao, P. (2024) · Clinical Cosmetic and Investigational Dermatology · doi:10.2147/ccid.s476785 · Cited by 12
“98,99 Both the cGAS-STING pathway and AIM2 inflammasome can positively regulate apoptosis. cGAS-STING-IRF3 signaling can induce Endoplasmic Reticulum Stress-mediated-apoptosis via Bax activation.”
BackgroundManganese oxide nanoparticle acts as a promising immune adjuvant via tuning ferroptosis signaling
Liang, X., Qi, S., Lü, F., Wu, Y., Mao, C., & Jiang, Y. (2025) · Journal of Controlled Release · doi:10.1016/j.jconrel.2025.114022 · Cited by 11
Yu, H., Lai, H.-J., Lin, T.-W., Chen, C., & Lo, S. J. (2015) · Biochemical Journal · doi:10.1042/bj20150563 · Cited by 11
Xiao, W.-M., Liu, H., Lei, Y., Gao, H.-W., Alahmadi, T. A., Peng, H., & Chen, W. (2020) · Environmental Toxicology · doi:10.1002/tox.23082 · Cited by 12
“proteins were playing essential functions in the molecular events of apoptosis.(55) The enhanced levels of pro-apoptotic proteins like Bax, could facilitate the induction of apoptosis via improved caspase cleavage that was a well-established approach to stimulate apoptosis in cancer cells.”
BackgroundLeaked Mitochondrial C1QBP Inhibits Activation of the DNA Sensor cGAS
Song, K., Wu, Y., Fu, B., Wang, L., Hao, W., Hua, F., Sun, Y., Dorf, M. E., & Li, S. (2021) · The Journal of Immunology · doi:10.4049/jimmunol.2100392 · Cited by 11
T Cell Extracellular Traps: Tipping the Balance Between Skin Health and Disease
Ouyang, K., Oparaugo, N. C., Nelson, A. M., & Agak, G. W. (2022) · Frontiers in Immunology · doi:10.3389/fimmu.2022.900634 · Cited by 12
Huang, N., Groover, D., Damania, B., & Moody, C. A. (2022) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.2200206119 · Cited by 11
STING signalling compensates for low tumour mutation burden to drive anti-tumour immunity
Tan, J., Egelston, C. A., Guo, W., Stark, J. M., & Lee, P. P. (2024) · EBioMedicine · doi:10.1016/j.ebiom.2024.105035 · Cited by 11
“84 STING activation has been linked to promoting apoptosis 85 and cell death.”
Limited MOMP, ATM, and their roles in carcinogenesis and cancer treatment
Bao, X., Liu, X., Li, F., & Li, C. (2020) · Cell & Bioscience · doi:10.1186/s13578-020-00442-y · Cited by 11
Pan-cancer analysis of cuproptosis-promoting gene signature from multiple perspectives
Ma, J., Gong, B., & Zhao, Q. (2023) · Clinical and Experimental Medicine · doi:10.1007/s10238-023-01108-y · Cited by 11
“Studies have proved that apoptosis-related caspases could inhibit the production of IFN-β, and the immune response induced by necrotic cells was mainly responsible for tissue-repairing [32, 33].”
Research progress on mitochondria regulating tumor immunity
Li, J., Xu, P., & Chen, S. (2024) · Journal of Zhejiang University (Medical Sciences) · doi:10.3724/zdxbyxb-2023-0484 · Cited by 11
VHL loss enhances antitumor immunity by activating the anti-viral DNA-sensing pathway
Jiao, M., Hu, M., Pan, D., Liu, X., Bao, X., Kim, J., Li, F., & Li, C. (2024) · iScience · doi:10.1016/j.isci.2024.110285 · Cited by 10
Kusuma, F., Park, S., Nguyen, K. A., Elvira, R., Lee, D., & Han, J. (2024) · International Journal of Molecular Sciences · doi:10.3390/ijms25147738 · Cited by 10
Zhong, G., Wang, X., Zhang, Q., Zhang, X., Fang, X., Li, S., Pan, Y., Ma, Y., Wang, X., Wan, T., et al. (2024) · Phytotherapy Research · doi:10.1002/ptr.8316 · Cited by 10
“Furthermore, in the absence of caspases, BAX/BAK-induced MOMP may initiate mitochondrial apoptosis by triggering the release of mtDNA to activate the cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) signaling pathway (White et al., 2014).”
Xue, P., Wang, Y., Wang, X. J., Zhou, S., Wu, X., Long, L., & Guo, C. (2024) · Chemical Engineering Journal · doi:10.1016/j.cej.2024.156729 · Cited by 10
Shu, C., Li, J., Rui, J., Fan, D., Niu, Q., Bai, R., Cicka, D., Doyle, S. P., Wahafu, A., Zheng, X., et al. (2025) · Nature Communications · doi:10.1038/s41467-025-57297-5 · Cited by 11
“STING activation was shown to induce apoptosis in a context-speci fi c manner 53 – 56 .”
Zou, Z., Cheng, X., Chen, J., Xing, C., Zhang, C., Guo, X., Cao, H., Hu, G., & Zhuang, Y. (2025) · Ecotoxicology and Environmental Safety · doi:10.1016/j.ecoenv.2025.118118 · Cited by 10
Open questions: seeking a holistic approach for mitochondrial research
McBride, H. M. (2015) · BMC Biology · doi:10.1186/s12915-015-0120-x · Cited by 11
“forms of cell death do not launch unnecessary inflammation [3,4].”
Apoptotic caspases suppress Mycobacterium bovis-induced IFN-β production in murine macrophage
Song, Y., Dong, Y., Liao, Y., Liang, Z., Yao, J., & Zhou, X. (2021) · Journal of Infection · doi:10.1016/j.jinf.2021.04.014 · Cited by 10
Gong, Z., Jia, Q., Guo, J., Li, C., Xu, S., Jin, Z., Chu, H., Wan, Y. Y., Zhu, B., & Zhou, Y. (2023) · Experimental Hematology and Oncology · doi:10.1186/s40164-022-00371-1 · Cited by 10
DNA sensing of dendritic cells in cancer immunotherapy
Qian, W. P., Ye, J., & Xia, S. (2024) · Frontiers in Molecular Biosciences · doi:10.3389/fmolb.2024.1391046 · Cited by 10
Through DNA sensors and hidden mitochondrial effects of SARS-CoV-2
Targhetta, V. P., do Amaral, M. A., & Câmara, N. O. S. (2021) · The Journal of venomous animals and toxins including tropical diseases · doi:10.1590/1678-9199-jvatitd-2020-0183 · Cited by 10
“In 2014, two distinct groups showed that, during apoptosis in a caspase 3/7 knockout model, through the permeabilization of mitochondrial membrane by pores formed by BAK and BAX, mtDNA can be released in the cytosol [30,31].”
Gradzka-Boberda, S., Gentle, I. E., & Häcker, G. A. (2022) · Journal of Virology · doi:10.1128/jvi.01212-22 · Cited by 10
“drial DNA, which is recognized by cGAS and activates a STING-driven IFN response (33, 34).”
BackgroundCell death in genome evolution
Teng, X., & Hardwick, J. M. (2015) · Seminars in Cell and Developmental Biology · doi:10.1016/j.semcdb.2015.02.014 · Cited by 9
“While apoptosis suppresses inflammatory mechanisms [29, 30], release of cellular contents from necrotic cells can trigger inflammatory responses through activation of TLRs and inflammasomes that activate caspases-1 and -11 [31].”
BackgroundThe odyssey of cGAS: From cytosol to nucleus
Hao, W., Li, W., Wang, L., & Li, S. (2023) · Cytokine & Growth Factor Reviews · doi:10.1016/j.cytogfr.2023.09.004 · Cited by 11
Yan, Q., Gao, Y., Wu, D., Liu, Q.-Q., Su, C., Liu, G., Yang, L., Zhao, M., & Yao, J. (2024) · Frontiers in Pharmacology · doi:10.3389/fphar.2024.1509482 · Cited by 10
Guan, X., Li, H., Zhang, L., & Zhi, H. (2025) · Inflammation Research · doi:10.1007/s00011-025-01993-x · Cited by 10
“In addition, LPS-stimulated cell lysates mixed with uCL liposomes caused pro-capsase-1 cleavage, indicating that CL leakage from the outer membrane of the or proinflammatory cell death [31].”
Three decades of caspases and RIPKs in life and death
Malireddi, R. K. S., & Kanneganti, T. (2025) · Human Molecular Genetics · doi:10.1093/hmg/ddaf106 · Cited by 10
Jiang, H., Liu, L., He, S., Qu, S., Yang, Y., Kang, G., Wu, M., Liu, H., Zhang, Y., Wang, Z., et al. (2025) · Journal of Biomedical Science · doi:10.1186/s12929-025-01187-x · Cited by 12
“…protocol to deplete mtDNA. mtDNA loss was achieved by culturing cells in the presence of either low concentrations of ethidium bromide (EthBr) [34] or 2 ′ ,3 ′ -dideoxycytidine (DDC) [35], generating ρ⁰ cells, a derivative of cells that lacks the mitochondrial genome but retains nuclear DNA…”
Metadata
- Authors
- White, M. J., McArthur, K., Metcalf, D., Lane, R. M., Cambier, J. C., Herold, M. J., van Delft, M. F., Bedoui, S., Lessene, G., Ritchie, M. E., Huang, D. C. S., & Kile, B. T.
- Affiliations
- The University of Melbourne (AU)
- Walter and Eliza Hall Institute of Medical Research (AU)
- National Jewish Health (US)
- Corresponding author
- White, Michael J.
- Kile, Benjamin T.
- ORCID
- Venue
- Cell
- Publisher
- Elsevier BV
- Published
- 2014-12
- Volume
- 159
- Issue
- 7
- Pages
- 1549-1562
- ISSN
- 0092-8674 (ISSN-L)
- PMC
- PMC4520319
- OpenAlex
- W2028107828
- Cited by
- 983
- References
- 68
- Citations by year
- 2026: 89 · 2025: 88 · 2024: 118 · 2023: 107 · 2022: 111 · 2021: 94 · 2020: 93 · 2019: 61 · 2018: 76 · 2017: 63 · 2016: 39 · 2015: 40
- FWCI
- 21.61
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- Locations
- Cell (publishedVersion)
- PubMed (publishedVersion)
- Europe PMC (PubMed Central) (acceptedVersion)
- PubMed Central (acceptedVersion)
- Adelaide Research & Scholarship (AR&S) (University of Adelaide) (submittedVersion)
- Funders
- National Institute of Allergy and Infectious Diseases (R21AI099346)
- Topics
- Life Sciences › Immunology and Microbiology › Immunology › interferon and immune responses
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Cell death mechanisms and regulation
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Inflammasome and immune disorders
- Keywords
- caspases, apoptosis, type I interferon, STING, cGAS, mitochondrial DNA, Bak, Bax, caspase-9, Apaf-1, caspase-3, caspase-7, interferon-beta, hematopoietic stem cells
- MeSH terms
- STING Protein, Animals, Crosses, Genetic, DNA, Mitochondrial, Female, Hematopoietic Stem Cells, Interferon Type I, Male, Membrane Proteins, Mice, Inbred C57BL, Signal Transduction, Apoptosis, Caspases, Caspase 9
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
