The DOI matches its Crossref record; 45 of the 45 references it cites were found in a registry or an index.
The Environmental Sensor AHR Protects from Inflammatory Damage by Maintaining Intestinal Stem Cell Homeostasis and Barrier Integrity
Open accessAbstract
The epithelium and immune compartment in the intestine are constantly exposed to a fluctuating external environment. Defective communication between these compartments at this barrier surface underlies susceptibility to infections and chronic inflammation. Environmental factors play a significant, but mechanistically poorly understood, role in intestinal homeostasis. We found that regeneration of intestinal epithelial cells (IECs) upon injury through infection or chemical insults was profoundly influenced by the environmental sensor aryl hydrocarbon receptor (AHR). IEC-specific deletion of Ahr resulted in failure to control C. rodentium infection due to unrestricted intestinal stem cell (ISC) proliferation and impaired differentiation, culminating in malignant transformation. AHR activation by dietary ligands restored barrier homeostasis, protected the stem cell niche, and prevented tumorigenesis via transcriptional regulation of of Rnf43 and Znrf3, E3 ubiquitin ligases that inhibit Wnt-β-catenin signaling and restrict ISC proliferation. Thus, activation of the AHR pathway in IECs guards the stem cell niche to maintain intestinal barrier integrity.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“Dietary supplementation with indole-3-carbinol activates the AHR in intestinal epithelial cells to restore intestinal barrier integrity in mice infected with Citrobacter rodentium.”
From Microbiota–gut–brain axis and its therapeutic applications in neurodegenerative diseases (2024) · cites this paper as [653]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche
Sato, T., Vries, R. G., Snippert, H. J., van de Wetering, M., Barker, N., Stange, D. E., van Es, J. H., Abo, A., Kujala, P., Peters, P. J., et al. (2009) · Nature · doi:10.1038/nature07935 · Cited by 7,204 · cited 1×
“Wnt-b-Catenin Signaling The intestinal epithelium continuously renews itself from crypt stem cells that differentiate into short-lived specialized epithelial subtypes (Sato et al., 2009).”
BackgroundIdentification of stem cells in small intestine and colon by marker gene Lgr5
Barker, N., van Es, J. H., Kuipers, J., Kujala, P., van den Born, M., Cozijnsen, M., Haegebarth, A., Korving, J., Begthel, H., Peters, P. J., et al. (2007) · Nature · doi:10.1038/nature06196 · Cited by 5,687 · cited 6×
“Since we were not able to maintain Ahr-deficient Lgr5Egfp-Ires-creErt2 reporter mice viable for long enough, we used mice heterozygous for Ahr deletion, which were partially affected.”
BackgroundMethodInfluentialZelante, T., Iannitti, R. G., Cunha, C., De Luca, A., Giovannini, G., Pieraccini, G., Zecchi, R., D’Angelo, C., Massi-Benedetti, C., Fallarino, F., et al. (2013) · Immunity · doi:10.1016/j.immuni.2013.08.003 · Cited by 2,614 · cited 2×
“Although the AHR was originally described as a receptor for dioxin and other xenobiotics, it is now clear that physiological AHR ligands such as dietary components and tryptophan metabolites (Denison and Nagy, 2003; Hubbard et al., 2015; Lamas et al., 2016;McMillan and Bradfield, 2007; Moura-Alves et al., 2014; Zelant…”
BackgroundLiu, J. Z., van Sommeren, S., Huang, H., Ng, S. C., Alberts, R., Takahashi, A., Ripke, S., Lee, J. C., Jostins, L., Shah, T., et al. (2015) · Nature Genetics · doi:10.1038/ng.3359 · Cited by 2,603
Denison, M. S., & Nagy, S. R. (2003) · Annual Review of Pharmacology and Toxicology · doi:10.1146/annurev.pharmtox.43.100901.135828 · Cited by 1,895 · cited 2×
“Although the AHR was originally described as a receptor for dioxin and other xenobiotics, it is now clear that physiological AHR ligands such as dietary components and tryptophan metabolites (Denison and Nagy, 2003; Hubbard et al., 2015; Lamas et al., 2016;McMillan and Bradfield, 2007; Moura-Alves et al., 2014; Zelant…”
BackgroundLamas, B., Richard, M. L., Leducq, V., Pham, H.-P., Michel, M.-L., Da Costa, G., Bridonneau, C., Jegou, S., Hoffmann, T. W., Natividad, J. M., et al. (2016) · Nature Medicine · doi:10.1038/nm.4102 · Cited by 1,482 · cited 2×
“Although the AHR was originally described as a receptor for dioxin and other xenobiotics, it is now clear that physiological AHR ligands such as dietary components and tryptophan metabolites (Denison and Nagy, 2003; Hubbard et al., 2015; Lamas et al., 2016;McMillan and Bradfield, 2007; Moura-Alves et al., 2014; Zelant…”
BackgroundGrowing Self-Organizing Mini-Guts from a Single Intestinal Stem Cell: Mechanism and Applications
Sato, T., & Clevers, H. (2013) · Science · doi:10.1126/science.1234852 · Cited by 1,170 · cited 1×
“In order to directly investigate the role of AHR in the process of crypt stem cell proliferation and differentiation, we generated colon organoids (Sato and Clevers, 2013).”
BackgroundTumour suppressor RNF43 is a stem-cell E3 ligase that induces endocytosis of Wnt receptors
Koo, B.-K., Spit, M., Jordens, I., Low, T. Y., Stange, D. E., van de Wetering, M., van Es, J. H., Mohammed, S., Heck, A. J. R., Maurice, M. M., et al. (2012) · Nature · doi:10.1038/nature11308 · Cited by 980 · cited 3×
“Our results provide evidence that Wnt-b-catenin pathway dysregulation in Ahrdeficient IECs occurred upstream of b-catenin degradation, affecting the response to WNT signals themselves through the expression of the two related E3 ubiquitin ligases (ZNRF3 and RNF43) that degrade the Wnt frizzled receptors (Koo et al., 2…”
BackgroundCancer as an overhealing wound: an old hypothesis revisited
Schäfer, M., & Werner, S. (2008) · Nature Reviews Molecular Cell Biology · doi:10.1038/nrm2455 · Cited by 974
ZNRF3 promotes Wnt receptor turnover in an R-spondin-sensitive manner
Hao, H.-X., Xie, Y., Zhang, Y., Charlat, O., Oster, E., Avello, M., Lei, H., Mickanin, C., Liu, D., Ruffner, H., et al. (2012) · Nature · doi:10.1038/nature11019 · Cited by 962 · cited 2×
“We focused on the tumor suppressors RNF43 and ZNRF3, which are transmembrane E3 ubiquitin ligases expressed in LGR5 stem cells that regulate WNT signals by targeting WNT receptors for degradation in an R-spondin-sensitive manner (Hao et al., 2012; Koo et al., 2012; Tsukiyama et al., 2015).”
Background
Flagged first, then by citations
Cited by
Sorted by citations
Items 301–400 of 403
Modulation of aryl hydrocarbon receptor activity by halogenated indoles
Vrzalová, A., Vrzal, R., Nádvorník, P., Šebela, M., & Dvořák, Z. (2024) · Bioorganic & Medicinal Chemistry · doi:10.1016/j.bmc.2024.117964 · Cited by 5
Indole metabolism and its role in diabetic macrovascular and microvascular complications
Hu, W., Garrison, C., Prasad, R., Boulton, M., & Grant, M. B. (2025) · American Heart Journal Plus Cardiology Research and Practice · doi:10.1016/j.ahjo.2025.100532 · Cited by 4
“AhR activation by this metabolite and others is known to regulate intestinal stem cell (ISC) activity and is essential for safeguarding the ISC niche and maintaining the integrity of the intestinal barrier [34,35].”
Intestinal-region-specific functions of AHR in intrinsic enteric neurons during infections
Sun, Z., Wang, Y., Liu, S., Li, H., He, D., & Xu, H. (2025) · Cell Reports · doi:10.1016/j.celrep.2025.115524 · Cited by 5
Beneficial and detrimental consequences of AHR activation in intestinal infection
Diaz, O. E., Zhou, L., Barrington, C., Lindqvist, D., Graelmann, F. J., Wincent, E., & Stockinger, B. (2025) · Life Science Alliance · doi:10.26508/lsa.202503414 · Cited by 4
“The experimental model we studied was infection with the pathogen Citrobacter rodentium as our previous data had shown the importance of AHR in recovery from this infection (Schiering et al, 2017; Metidji et al, 2018).”
Self-citationXu, X., Fang, H., Fang, L., Zhou, Y., Wen, Y., Wang, X., Du, D., Lu, L., Yin, J., Sun, T., et al. (2026) · Phytomedicine · doi:10.1016/j.phymed.2026.157829 · Cited by 7
Zhang, T., Yu, Z., Xu, Y., Zhao, L., Zhu, F., Zhou, Y., Gu, L., & Gong, J. (2024) · Diseases of the Colon & Rectum · doi:10.1097/dcr.0000000000003549 · Cited by 5
“5 Metidji et al 5 found that the intestinal barrier function of Ahr -knockout mice is impaired, accompanied by a decrease in goblet cells and an increase in inflammation.”
InfluentialChen, J., Liu, J., Liu, S., Li, Z., Gao, C., Wang, Z., Huang, S., Jiang, Z., & Yang, H. (2025) · Bulletin of Environmental Contamination and Toxicology · doi:10.1007/s00128-025-04057-2 · Cited by 5
“Tryptophan and indole, with their antioxidant and anti-inflammatory properties, acti - vate detoxifying genes like cytochrome p450 (Metidji et al. 2018).”
Song, Y., Zhang, J., Liang, S., Cao, Y., & Wang, Q. (2025) · Journal of Future Foods · doi:10.1016/j.jfutfo.2025.10.014 · Cited by 4
Colorectal cancer initiation by benzo[a]pyrene and N-nitroso compounds in A/J Min/+ mice
Johanson, S. M., Kleiven, T. H., Ivanova, L., Rangel-Huerta, Ó. D., Åkesson, C. P., Niklas, A. A., Granby, K., Ropstad, E., Paulsen, J. E., & Müller, M. H. B. (2025) · Food and Chemical Toxicology · doi:10.1016/j.fct.2025.115902 · Cited by 4
Enteric nervous system in microbiota-associated gut inflammation
Yang, C., Lan, X., Zhong, H., Geng, J., & Wang, W. (2026) · Frontiers in Immunology · doi:10.3389/fimmu.2026.1735727 · Cited by 4
Beyond Random Fecal Microbial Transplants
Sartor, R. B. (2024) · Gastroenterology Clinics of North America · doi:10.1016/j.gtc.2024.11.002 · Cited by 4
Abdelhalim, W. A., Rabee, A. R., Soliman, S. M., Hagar, M., Moneer, E. A., Bakr, B. A., Barakat, A., Haukka, M., & Rasheed, H. A. (2025) · Scientific Reports · doi:10.1038/s41598-024-81683-6 · Cited by 4
Seo, M.-S., Baek, J., & Jeon, M. (2025) · Immune Network · doi:10.4110/in.2025.25.e1 · Cited by 4
“The role of AhR in epithelial maintenance has been elucidated in studies involving a dextran sulfate sodium (DSS)-induced injury mouse model and Citrobacter rodentium infection in Vil-cre AHR fl/fl mice (41,42).”
Guo, Z., Cui, L., Yao, R., Lin, Y., Wang, Z., Jin, H., Guo, H., Xie, C., Lin, L., Huang, P., et al. (2025) · Journal of Biological Chemistry · doi:10.1016/j.jbc.2025.111004 · Cited by 5
“To elucidate the molecular mechanism by which I3A–AHR suppresses RSL3-induced JNK–c-JUN activation, we considered prior evidence that AHR can function as a noncanonical E3 ubiquitin ligase (31), and ubiquitin-mediated regulation of JNKc-JUN has been well documented (32, 33).”
Epithelial TIPE1 Protein Guards against Colitis by Inhibiting TNF-α–Mediated Inflammation
Lou, Y., Jiang, S., Song, M., Wang, H., Han, M., Tian, X., Zhao, Y., Gao, J., Song, Y., Ma, S., et al. (2023) · The Journal of Immunology · doi:10.4049/jimmunol.2300291 · Cited by 4
Molina, P. A., Edell, C., Dunaway, L. S., Kellum, C. E., Muir, R. Q., Jennings, M. S., Colson, J. C., Miguel, C. D., Rhoads, M. K., Buzzelli, A. A., et al. (2025) · Function · doi:10.1093/function/zqaf001 · Cited by 6
Ma, M., Guo, J., Su, X., Ma, B., Wang, X., Wangshao, M., Zhong, K. L., Wang, Y., Yang, G., & Han, Y. (2025) · Inflammation Research · doi:10.1007/s00011-025-02063-y · Cited by 4
Sun, D., Wang, C., Fan, Q., Zhan, Y., Cheng, X., Zhang, J., Wang, Q., Li, Y., Li, Q., Xiong, Y., et al. (2025) · Food Frontiers · doi:10.1002/fft2.70109 · Cited by 3
Self-citationHuan, Y., Zhang, W., Xue, L., Tang, Q., Wang, Y., Xu, J., & Xue, C. (2025) · Food Bioscience · doi:10.1016/j.fbio.2025.107547 · Cited by 3
Toward indole postbiotics precision therapy via AI-powered drug delivery technologies
Puccetti, M., Pariano, M., Anna, W. P., Maurizio, R., & Giovagnoli, S. (2025) · Current Opinion in Immunology · doi:10.1016/j.coi.2025.102692 · Cited by 4
Ahmed, H., Sher, A. A., Bell, J. A., & Mansfield, L. S. (2025) · International Journal of Molecular Sciences · doi:10.3390/ijms262311670 · Cited by 3
“AHR is a ligand-activated transcription factor known for its role in xenobiotic metabolism but increasingly recognized for its regulatory effects on intestinal barrier homeostasis and immune responses [32,33].”
Dai, Z., Bao, X., Jiang, H., Zhang, Y., Shen, Q., & Xue, Y. (2025) · Journal of Advanced Research · doi:10.1016/j.jare.2025.12.010 · Cited by 5
“Indole metaboli tes have been found to act on intestinal AhR in a ligand-specific manner, regulating intestinal epithelial cell renewal, barrier integrity, and many immune cell types, which are essential for intestinal homeostasis [23,63].”
Shimizu, H., & Niwa, T. (2026) · Toxins · doi:10.3390/toxins18020072 · Cited by 3
Wang, Z., Hu, Y., Zhu, M., Yang, X., Huang, Q., Zhang, A., Wang, X., & Zhou, H. Y. (2026) · Fish & Shellfish Immunology · doi:10.1016/j.fsi.2026.111268 · Cited by 3
Insights into the gut microbiome-metabolite dynamics in breast cancer
Manzoor, H., & Kayani, M. U. R. (2025) · Gut microbes reports · doi:10.1080/29933935.2025.2483446 · Cited by 3
Drosophila AHR limits tumor growth and stem cell proliferation in the intestine
Tsai, M.-S., Sun, J., Alexandre, C., Shapiro, M., Franchet, A., Li, Y., Gould, A. P., Vincent, J., Stockinger, B., & Diny, N. (2023) · bioRxiv · doi:10.12688/wellcomeopenres.23515.3 · Cited by 3
“The proper insertion of GFP before the stop codon was confirmed by PCR using genomic DNA from ssGFP candidates using the following primers: scr geno ss5’armF= gtggctactacacggattatccc, scr eGFPR= cgggcagctt-gccggtggtgc, scr CHEF= cagtacgaacgcgccgaggg, scr geno ss3’armR= ttggcgctacaaaccgaagcc.”
InfluentialSelf-citationHuang, X., Wu, L., Zhang, Y., Lai, X., & Sun, D. (2025) · Endocrine Connections · doi:10.1530/ec-25-0162 · Cited by 3
“TLRs change the dynamics of intestinal epithelial crypts by changing the proliferation and apoptosis of stem cells (86, 87, 88, 89).”
Xu, Y., Shi, J., Mok, H. L., Lyu, C., Chen, J., Huang, C., Qin, H., Lin, C., Tan, H., & Bian, Z. (2025) · Advanced Science · doi:10.1002/advs.202502993 · Cited by 3
Maier, M. L. V., Siddens, L. K., Pennington, J. M., Uesugi, S. L., Tilton, S. C., Vertel, E. A., Anderson, K. A., Tidwell, L. G., Ognibene, T. J., Turteltaub, K. W., et al. (2023) · Toxicology and Applied Pharmacology · doi:10.1016/j.taap.2023.116377 · Cited by 3
Garcia-Vilarato, E., Bomstein, Z. S., Allred, K. F., Callaway, E. S., Safe, S. H., Chapkin, R. S., Jayaraman, A., & Allred, C. D. (2024) · International Journal of Molecular Sciences · doi:10.3390/ijms251810153 · Cited by 3
“As one of many chemokines secreted by stromal cells during cytokine stimulation, CXCL13 is particularly important in B-cell attraction during TLT initiation.”
BackgroundYagishita, Y., Joshi, T. V., Kensler, T. W., & Wakabayashi, N. (2023) · Molecular and Cellular Biology · doi:10.1080/10985549.2022.2160610 · Cited by 3
“restricted stem cell proliferation and maintained stem cell homeostasis in the mutagen model.(54) Our study using in vivo and intestinal organoids models demonstrated that”
Phytochemical-Mediated Ah Receptor Activity Is Dependent on Dietary Context
Dong, F., Annalora, A. J., Murray, I. A., Chakraborty, D., Coslo, D. M., Marcus, C. B., Patterson, A. D., & Perdew, G. H. (2025) · Nutrients · doi:10.3390/nu17050876 · Cited by 2
“In addition, the concept that CYP1A1 inhibitors/substrates in the diet can dramatically alter the level of AHR activation in tissues, especially in the lung, has been established, such as was observed here with the combination of parsley and broccoli in the diet.”
InfluentialLi, R., Zheng, M., Zhai, Y., Li, L., Li, W., Li, S., Zuo, X., & Li, Y. (2025) · International Immunopharmacology · doi:10.1016/j.intimp.2025.115614 · Cited by 2
Self-citationZhang, J., Li, M., Guo, Y., Jiang, X., Li, W., Huang, J., Yang, Y., Ou, Z., Cai, Y., Kong, Y., et al. (2026) · Environment International · doi:10.1016/j.envint.2026.110128 · Cited by 2
Vaginal dysbiosis dominated by miscellaneous bacteria correlates with more severe clinical symptoms
Zhou, Z., Tang, W., Ou, J., Li, P., Ling, Y., Lv, Y., Zhou, H., & Chen, M. (2019) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2019.104138 · Cited by 2
Garcia-Villatoro, E. L., Ufondu, A., Callaway, E. S., Allred, K. F., Safe, S. H., Chapkin, R. S., Jayaraman, A., & Allred, C. D. (2024) · American Journal of Physiology-Gastrointestinal and Liver Physiology · doi:10.1152/ajpgi.00274.2023 · Cited by 2
Bacteria, stem cells and cancer
Pani, G. (2025) · Cancer Gene Therapy · doi:10.1038/s41417-025-00876-x · Cited by 2
Arih2 gene influences immune response and tissue development in chicken
Wu, G., Xu, S., Zhang, W., Liu, Y., Wang, Q., & Man, C. (2019) · Bioscience Reports · doi:10.1042/bsr20190933 · Cited by 2
Drosophila AHR limits tumor growth and stem cell proliferation in the intestine
Tsai, M., Sun, J., Alexandre, C., Shapiro, M., Franchet, A., Li, Y., Gould, A. P., Vincent, J., Stockinger, B., & Diny, N. L. (2025) · Wellcome Open Research · doi:10.12688/wellcomeopenres.23515.2 · Cited by 2
Self-citationTryptophan catabolism by gut microbiota : A bridge connecting food science and human nutrition
Huang, Z. (2023) · doi:10.18174/583090 · Cited by 2
RNF43 is a gatekeeper for colitis-associated cancerPreprint
Dietl, A., Ralser, A., Taxauer, K., Dregelies, T., Sterlacci, W., Stadler, M., Olayo-Alarcón, R., Margaryan, S., Skerhut, M., Groll, T., et al. (2024) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2024.01.30.577936 · Cited by 2
Shatova, O. P., Shestopalov, A. V., Zlatnik, E. Y., Novikova, I. A., Гончарова, А. С., & Maksimov, A. Y. (2025) · Biomeditsinskaya Khimiya · doi:10.18097/pbmcr1554 · Cited by 1
Korcari, A., Tauc, H. M., Duggan, J., Wehbe, F., Darmanis, S., Modrusan, Z. D., Yun, J., Pappu, R., Garfield, D., Jasper, H., et al. (2026) · Aging Cell · doi:10.1111/acel.70495 · Cited by 1
“Inflammatory challenges to the healthy adult intestine, such as infection with pathogens, activate the innate and adaptive immune systems (Metidji et al. 2018; Buschor et al. 2017; Silberger et al. 2017).”
Wang, A. R., Tucker, M., Goodson, M. L., Ehrlich, A. K., & Cummings, B. P. (2025) · Physiological Reports · doi:10.14814/phy2.70524 · Cited by 1
“In intestinal epithelial cells, AhR activation results in regulation of crypt stem cells and epithelial cell turnover, as well as stabilization of tight junctions and maintenance of barrier integrity (Choi et al., 2017; Metidji et al., 2018).”
Gwak, M.-G., Kim, M.-S., Park, S., Oh, S., Kim, Y., Kim, J., & Chang, S. (2025) · Inflammatory Bowel Diseases · doi:10.1093/ibd/izaf155 · Cited by 2
Rothia mucilaginosa membrane vesicles stabilize labile iron to alleviate UVB-induced ferroptosis
Fan, S., Cai, X., Wang, W., Wu, M., Huang, X., Ding, F., Guo, H., Dou, G., Luo, H., Shao, S., et al. (2026) · Cell Host & Microbe · doi:10.1016/j.chom.2025.12.008 · Cited by 1
Osteoblastic USP26 regulates B lymphopoiesis by endogenous tryptophan metabolites
Ye, W., Tang, G., Tang, J., Chang, L., Dan, Z., Xu, Y., Qi, J., Li, C., Dong, S., Deng, L., et al. (2026) · Journal of Advanced Research · doi:10.1016/j.jare.2026.02.010 · Cited by 1
The different meanings of tolerating the gut microbiome
Vidal, V. M., Montes‐Cobos, E., Canto, F. B., & Bozza, M. T. (2026) · mBio · doi:10.1128/mbio.01736-24 · Cited by 1
“AhR activation orchestrates a multi-faceted program that drives xenobiotic detoxification response (246), reinforces barrier integrity (247–250), and supports generation/function of several cells, including Foxp3 + T REG cells (251, 252), Foxp3 - Tr1 cells (246, 252, 253), Tγδ intraepithelial lym…”
饶江燕, Li, N., Xiao, H., Zhang, Y., Xiong, M., Yang, H., & Yu, M. (2026) · International Journal of Biological Macromolecules · doi:10.1016/j.ijbiomac.2026.152765 · Cited by 1
Aryl hydrocarbon receptor pharmacology—mechanisms, ligands, and therapeutic potential
Bobrovs, R., Olafsen, N. E., Åhrling, S. S., & Matthews, J. B. (2026) · Pharmacological Reviews · doi:10.1016/j.pharmr.2026.100146 · Cited by 2
“169,312 Loss of Ahr increases the risk of colorectal cancer because of chronic intestinal inflammation in mice.”
Delaroque, C., O’Mahony, L., Krohn, I. K., Mortz, C. G., Ollert, M. W., & Desai, M. S. (2026) · Allergy · doi:10.1111/all.70426 · Cited by 1
“Conversely, AhR deficiency in the gut compromises barrier integrity, through loss of mature IECs such as goblet cells as well as reduced tight junction expression, and increases bacterial translocation [140, 141].”
Mahdiabadi, M., Moghaddam, A., & Erfanian, N. (2026) · MicrobiologyOpen · doi:10.1002/mbo3.70386 · Cited by 2
“Overall, these effects sustain long‐term epithelial renewal and mucosal healing (Lindemans et al. 2015; Metidji et al. 2018; Sato et al. 2011) (Figure 1).”
Xu, X., Taha, R., Chu, C., Li, X., Wang, T., Wang, X., Huang, X., Jiang, Z., & Sun, L. (2024) · Xenobiotica · doi:10.1080/00498254.2023.2297745 · Cited by 1
“…and intestinal tract (Harrill et al. 2013; Qian et al. 2022); in the intestinal tract, AhR is mainly expressed in intestinal epithelial cells (Metidji et al. 2018; Qian et al. 2022), and intestinal epithelial cells also show high AchE expression (Sine et al. 1991; Xiang et al. 2008; Pickett…”
BackgroundHeine, S., Alessandrini, F., Grosch, J., Graß, C., Heldner, A., Schnautz, B., Grosch, J., Buters, J., Slusarenko, B. O., Krappmann, D., et al. (2024) · Frontiers in Immunology · doi:10.3389/fimmu.2024.1397072 · Cited by 1
Microbiome in Defence Against Pathogens
Ramanathan, J. (2024) · Springer eBooks · doi:10.1007/978-3-031-70088-0_16 · Cited by 2
Drosophila AHR limits tumor growth and stem cell proliferation in the intestine
Tsai, M., Sun, J., Alexandre, C., Shapiro, M., Franchet, A., Li, Y., Gould, A. P., Vincent, J., Stockinger, B., & Diny, N. L. (2025) · Wellcome Open Research · doi:10.12688/wellcomeopenres.23515.1 · Cited by 1
Self-citationGhosh, S., Erickson, D. L., Chua, M. J., Collins, J., & Jala, V. R. (2023) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2023.07.24.550342 · Cited by 1
“to the proliferation of intestinal epithelial cells (50, 51).”
BackgroundZheng, Y. (2019) · Scholarly Commons (University of the Pacific)
Oğuz, V., & Bozkır, Ç. (2021) · Journal of Nutrition and Dietetics · doi:10.33076/2021.bdd.1480
[Suplemental laboratory studies in the diagnosis and prognosis of rheumatic fever].
Kreutzer, E. A., & Cossio, P. (1972) · PubMed
Intestinal SARS-CoV-2 infection and the importance of breastfeedingPreprint
da Costa, A. V., Goes, C. P., & Gama, P. (2020) · doi:10.22541/au.159188546.62058055
“Accordingly, in the intestine, tryptophan is converted into serotonin, acting in the regulation of motility of the gastrointestinal tract, in the microbiota homeostasis and as anti-inflammatory agent through AHR receptors (Metidji et al., 2018).”
Reviewing not Homer’s Iliad, but “Kai Bao Ben Cao”: indigo dye—the past, present, and future
Yoshimatsu, Y., Sujino, T., & Kanai∥, T. (2022) · Intestinal Research · doi:10.5217/ir.2022.00018
“Recent Western technologies revealed that AhR ligands lead to innovative treatments that promote the regeneration of mucosal epithelial cells.(27,28) Of note, IN causes adverse effects, such as headaches, gastrointestinal symptoms, mild liver dysfunction, nonspecific enteritis, bowel intussusception, and pulmonary art…”
BackgroundTodoric, J., Umemura, A., Taniguchi, K., & Karin, M. (2022) · Wiley eBooks · doi:10.1002/9781119000822.hfcm027.pub2
Aoki, R., & Ayako, A. O. K. I. (2022) · KAGAKU TO SEIBUTSU · doi:10.1271/kagakutoseibutsu.60.189
Dietary environmental factors shape the immune defence against Cryptosporidium infectionPreprint
Maradana, M. R., Marzook, N. B., Diaz, O. E., Mkandawire, T. T., Diny, N. L., Li, Y., Liebert, A., Shah, K., Tolaini, M., Kváč, M., et al. (2023) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2023.03.30.534739
“AHR deficiency or depletion of AHR ligands increases susceptibility to bacterial infection in the colon (Stockinger et al., 2021) and also contributes to colon tumorigenesis (Metidji et al., 2018).”
BackgroundSelf-citationVeland, N., Gleneadie, H. J., Brown, K. E., Sardini, A., Pombo, J., Dimond, A., Burns, V., Sarkisyan, K. S., Schiering, C., Webster, Z., et al. (2023) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2023.05.30.542862
Self-citationMORPHO-FUNCTIONAL FEATURES OF THE INTESTINAL BARRIER OF THE LARGE INTESTINE
Rozova, K. V., Kovalchuk, O. I., Raskaley, T. Y., Раскалєй, В. Б., Khmelnytska, Y. K., Petrushchenkova, M. S., & Malyuga, S. S. (2024) · Bulletin of Problems Biology and Medicine · doi:10.29254/2077-4214-2024-3-174-76-86
The Aryl Hydrocarbon Receptor and Immunity
Ehrlich, A. K., & Sulentic, C. E. W. (2024) · Elsevier eBooks · doi:10.1016/b978-0-323-95488-4.00144-3
Selective Modulation of Aryl Hydrocarbon Receptor by Coptisine in MAFLDPreprint
Zhu, X., Liu, Q., Cheng, Z., & Luo, Y. (2024) · Research Square · doi:10.21203/rs.3.rs-5201468/v1
Progress of Gut Flora and Its Metabolites in the Immunotherapy of Colorectal Cancer
张, 一. (2024) · Journal of Clinical Personalized Medicine · doi:10.12677/jcpm.2024.34381
Host–Microbe Metabolic Axis Regulates Redox-Mediated Ferroptosis Via a Novel I3a-Ahr–Jnk SignalingPreprint
Guo, Z., Yao, R., Cui, L., Lin, Y., Wang, Z., Jin, H., Guo, H., Xie, C., Lin, L., Huang, P., et al. (2025) · SSRN Electronic Journal · doi:10.2139/ssrn.5369542
A Case of Developing Pulmonary Hypertension during Treatment of Ulcerative Colitis with Qing-Dai
Sowa, H., Minatsuki, S., Hatano, M., & Komuro, I. (2024) · Nihon Naika Gakkai Zasshi · doi:10.2169/naika.113.1428
Li, W., Wang, X., Zhang, Y., Yang, H., Wang, X., Meng, W., Hu, T., Zhang, W., Zhu, Y., Wang, J., et al. (2025) · Animal nutrition · doi:10.1016/j.aninu.2025.09.008
Wang, X.-G., Zhang, M., Chen, T., Ma, J., Li, Z.-L., Wang, F., Tang, X., & Zhao, W.-X. (2025) · Phytomedicine Plus · doi:10.1016/j.phyplu.2025.100930
Wang, J., Jia, B., Miao, J., Li, D., Wang, Y., Han, L., Yuan, Y., Zhang, Y., Wang, Y., Guo, L., et al. (2024) · Figshare · doi:10.6084/m9.figshare.26182196
Cao, B., Zhao, R.-Y., Li, H.-H., Xu, X.-M., Cui, H., Deng, H., Chen, L., & Wei, B. (2022) · Figshare · doi:10.6084/m9.figshare.20236158
Cao, B., Zhao, R.-Y., Li, H.-H., Xu, X.-M., Cui, H., Deng, H., Chen, L., & Wei, B. (2022) · Figshare · doi:10.6084/m9.figshare.20236161
Ehrlich, A. M., Pacheco, A. R., Henrick, B. M., Taft, D. H., Xu, G., Huda, M. N., Mishchuk, D. O., Goodson, M. L., Slupsky, C., Barile, D., et al. (2020) · Figshare · doi:10.6084/m9.figshare.13279691
Landsiedel, R., Hahn, D., Ossig, R., Ritz, S., Sauer, L., Buesen, R., Rehm, S. R., Wohlleben, W., Groeters, S., Strauss, V., et al. (2022) · Figshare · doi:10.6084/m9.figshare.19408079
Wang, J., Jia, B., Miao, J., Li, D., Wang, Y., Han, L., Yuan, Y., Zhang, Y., Wang, Y., Guo, L., et al. (2024) · Figshare · doi:10.6084/m9.figshare.26182330
Generation and Validation of an Aryl Hydrocarbon Receptor Knockout Human Embryonic Stem Cell Line
Gang, N., Nian, C., Filatov, E., Zhang, D., Hoyeck, M. P., Laforest, B., Lynn, F. C., & Bruin, J. E. (2026) · Endocrinology · doi:10.1210/endocr/bqaf189
Zhang, Y., Liu, F.-D., Xu, C., Wang, L., Yang, Y., Xiong, M., Zhao, B., Yu, M., & Yang, H. (2026) · Inflammation Research · doi:10.1007/s00011-025-02182-6
“…that the aryl hydrocarbon receptor (AhR), functioning as a ligand-dependent transcription factor and environmental sensor, can participate in the control of intestinal mucosal barrier protection when highly activated, and is associated with better outcomes in intestinal inflammation [ 14].”
Interkingdom glycine conjugates of indole-3-carboxylates are Ah receptor ligandsPreprint
Morgan, E. W., Annalora, A. J., Coslo, D. M., Gowda, K., Desai, D. H., Dong, F., Davis, E. W., Murray, I. A., Hao, F., Koo, I., et al. (2026) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.64898/2026.02.13.705761
Xu, S., Hou, X., Xu, Y., Wang, X., Xu, L., & He, L. (2026) · Journal of Ethnopharmacology · doi:10.1016/j.jep.2026.121387
CYP1A1 as a conserved metabolic circuit linking environmental sensing to immune regulation
Sailis, A. B. (2026) · Archives of Toxicology · doi:10.1007/s00204-026-04384-1
“In lymphoid compartments, AhR activation biases immune lineage commitment and polarization (Bahman et al. 2024; Esser and Rannug 2015; Metidji et al. 2018).”
Role of environmental factors on intestinal barrier dysfunctions reported in obesity
Postal, B. G. (2019) · theses.fr (ABES) · doi:10.70675/4b9e7a12ze552z46bez8767z3241d10852d3
Gut mucosal barrier: the frontline of bidirectional regulation of the gut-X axis
Xu, X. W., Hu, Y., Ruan, S., Peng, C., Han, T., Yan, P., Chan, F. K. L., & Li, J. (2026) · Medical Review · doi:10.1515/mr-2026-0009
“In contrast, the loss of epithelial AHR or PXR signaling will lead to impaired barrier integrity and increased epithelial permeability, which highlights the essential role of indole induction in maintaining mucosal homeosis [117, 118].”
The role of mitochondria in the gut-kidney axis: implications for kidney health
Hu, Q., Jin, H., Hu, L., & Li, X. (2026) · Frontiers in Pharmacology · doi:10.3389/fphar.2026.1851705
“This synergistically maintains the functions of Treg and ILC3, promoting the resolution of inflammation (Metidji et al., 2018).”
Bai, X., Ihara, E., & Akiho, H. (2026) · Elsevier eBooks · doi:10.1016/b978-0-443-40306-4.00016-8
High‐Salt Diet Links Gut Microbiota, Intestinal Barrier Function, and Macrophage Responses
Abdulkadyrov, A., Diefenbach-Wilke, M.-L., Mass, E., & Viola, M. F. (2026) · European Journal of Immunology · doi:10.1002/eji.70234
“…and barrier-regulatory functions, including tryptophan-derived indole catabolites, which can modulate epithelial integrity and innate immune tone via the aryl hydrocarbon receptor, and trimethylamine N-oxide (TMAO), a co-metabolite linked to cardiovascular and inflammatory pathology [ 75–77 ].”
Bajić, D., Todorović, N., Lalic-Popovic, M. N., Vučković, J., Mihajlović, A., Slavić, D., Tapavički, B., Stojsic, M., & Milosevic, N. P. (2026) · Medical Sciences · doi:10.3390/medsci14040438
“This is also one reason NLRP3 attenuation has emerged as a mechanistically important theme, since inflammasome activation occupies a convergence point between mitochondrial stress, oxidative injury, and inflammatory amplification [4,6,33].”
Li, L., & Wang, G. (2026) · Frontiers in Immunology · doi:10.3389/fimmu.2026.1925490
Ma, Y., Diao, X., & Wang, Z.-L. (2026) · Frontiers in Endocrinology · doi:10.3389/fendo.2026.1872670
Oka, A., Bongers, G., Mishima, Y., Baltus, A. E., Gray, S. M., Liu, B., Herzog, J., Benedetto, J. R., Fan, T.-J., Jang, J., et al. (2026) · Cell Host & Microbe · doi:10.1016/j.chom.2026.08.003 · Cited by 1
Charlet, R., Lecointe, K., plu, O., Cordier, C., Bortolus, C., Popczyk, P., Dubar, F., Grec, S., & Sendid, B. (2026) · Virulence · doi:10.1080/21505594.2026.2707757
“A second study showed that the AhR receptor is capable of strongly influencing the regeneration of intestinal epithelial cells after inflammatory damage, by maintaining homeostasis and the intestinal barrier integrity [57].”
Ma, R., Ding, K., Guan, J., Li, M., Chen, Q., & Lu, J. (2026) · International Immunopharmacology · doi:10.1016/j.intimp.2026.117468
Bogdon, R., Roark, K. L., & Busbee, P. B. (2026) · Frontiers in Neuroscience · doi:10.3389/fnins.2026.1851943
Thind, M. K., Flanagan, M., de Wit, S., Glembocki, A. I., Pan, J., Cuinat, C., Sharon, L., Shaima, S. N., Sghayare, H., Usmani, K., et al. (2026) · PLoS ONE · doi:10.1371/journal.pone.0335322
“Additionally, mucus production by goblet cells helps to prevent systemic dissemination of bacteria [78,79], but was not explored in this study.”
Wnt signaling arranges the fate of lipid metabolism: The role of gut microbes
He, C., 刘春忻, Li, Y., Yin, J., Ma, J., & Yin, Y. (2026) · The Innovation Nutrition · doi:10.59717/j.xinn-nutri.2026.100039
Self-citationEmerging links between gut dysbiosis, aryl hydrocarbon receptor activation, and Parkinson’s disease
Aziz, N. F., & Kortagere, S. (2026) · Communications Biology · doi:10.1038/s42003-026-11156-1
Metadata
- Authors
- Metidji, A., Omenetti, S., Crotta, S., Li, Y., Nye, E., Ross, E., Li, V., Maradana, M. R., Schiering, C., & Stockinger, B.
- Affiliations
- The Francis Crick Institute (GB)
- University of London (GB)
- Corresponding author
- Schiering, Chris
- Stockinger, Brigitta
- ORCID
- Venue
- Immunity
- Publisher
- Elsevier BV
- Published
- 2018-08
- Volume
- 49
- Issue
- 2
- Pages
- 353-362.e5
- ISSN
- 1074-7613 (ISSN-L)
- PMC
- PMC6104739
- OpenAlex
- W2887221348
- Cited by
- 402
- References
- 45
- Citations by year
- 2026: 37 · 2025: 50 · 2024: 56 · 2023: 63 · 2022: 55 · 2021: 60 · 2020: 50 · 2019: 30
- FWCI
- 12.45
- Type
- journal article
- Language
- en
- Update notices
- erratum (2019-06-18)
- Open access
- hybrid
- doi.org
- Licence
- Locations
- Immunity (publishedVersion, cc-by)
- Europe PMC (PubMed Central) (publishedVersion, cc-by)
- PubMed Central (publishedVersion, cc-by)
- PubMed (publishedVersion)
- Figshare (submittedVersion, cc-by)
- Funders
- Cancer Research UK (FC001105, FC001159, 103156/B/13/Z, 19691)
- Fondation Acteria
- Medical Research Council
- Wellcome Trust (100910/Z/13/Z)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Wnt/β-catenin signaling in development and cancer
- Health Sciences › Medicine › Gastroenterology › Inflammatory Bowel Disease
- Life Sciences › Immunology and Microbiology › Immunology › IL-33, ST2, and ILC Pathways
- Keywords
- aryl hydrocarbon receptor, intestinal stem cells, intestinal barrier integrity, intestinal homeostasis, intestinal inflammation, RNF43, ZNRF3, Wnt/β-catenin signaling, E3 ubiquitin ligase, stem cell niche, intestinal tumorigenesis
- MeSH terms
- Animals, Cell Differentiation, Cell Line, Enterobacteriaceae Infections, Epithelial Cells, Humans, Intestinal Mucosa, Mice, Inbred C57BL, Stem Cells, Receptors, Aryl Hydrocarbon, Mice, Knockout, Tight Junctions, Citrobacter rodentium, Ubiquitin-Protein Ligases, Cell Proliferation, Mice, Basic Helix-Loop-Helix Proteins, Basic Helix-Loop-Helix Transcription Factors, HEK293 Cells, Wnt Signaling Pathway, Carcinogenesis
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
