Cited by 224T-cell and B-cell ImmunologyUbiquitin and proteasome pathwaysImmune Response and Inflammation

The DOI matches its Crossref record; 73 of the 73 references it cites were found in a registry or an index.

E3 ubiquitin ligases as T cell anergy factors

Mueller, Daniel L·2004·Nature Immunology

Open this paper in CoChat — free account

Abstract

E3 ubiquitin ligases have emerged as key molecular regulators of immune cell function. Three families of proteins with ubiquitin ligase activity have been described (the HECT, RING and U-box proteins), and each may be involved in the regulation of immune responses during infection by targeting specific inhibitory molecules for proteolytic destruction. Several HECT and RING E3 proteins have now also been linked to the induction and maintenance of immune self-tolerance: c-Cbl, Cbl-b, GRAIL, Itch and Nedd4 each negatively regulate T cell growth factor production and proliferation. This review will discuss the relationship between the ubiquitination of select components of the antigen-sensing signaling apparatus in T cells and the development and maintenance of the clonal anergy state.

Integrity signals

Registry

Crossref · 10.1038/ni1106

Cites

73 of 73 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

This paper’s full text isn’t openly available, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Innate immune recognition
Janeway, C. A., & Medzhitov, R. (2002) · Annual Review of Immunology · doi:10.1146/annurev.immunol.20.083001.084359 · Cited by 8,394
The Immunological Synapse: A Molecular Machine Controlling T Cell Activation
Grakoui, A., Bromley, S. K., Sumen, C., Davis, M. M., Shaw, A. S., Allen, P. M., & Dustin, M. L. (1999) · Science · doi:10.1126/science.285.5425.221 · Cited by 3,110
Three-dimensional segregation of supramolecular activation clusters in T cells
Monks, C. R. F., Freiberg, B. A., Kupfer, H., Sciaky, N., & Kupfer, A. (1998) · Nature · doi:10.1038/25764 · Cited by 2,353
Recognition of the polyubiquitin proteolytic signal
Thrower, J. S., Hoffman, L. M., Rechsteiner, M., & Pickart, C. M. (2000) · The EMBO Journal · doi:10.1093/emboj/19.1.94 · Cited by 1,769
CD28-mediated signalling co-stimulates murine T cells and prevents induction of anergy in T-cell clones
Harding, F., McArthur, J. G., Gross, J. A., Raulet, D. H., & Allison, J. P. (1992) · Nature · doi:10.1038/356607a0 · Cited by 1,558
Themes and variations on ubiquitylation
Weissman, A. M. (2001) · Nature Reviews Molecular Cell Biology · doi:10.1038/35056563 · Cited by 1,507
Clonal Expansion Versus Functional Clonal Inactivation: A Costimulatory Signaling Pathway Determines The Outcome Of T Cell Antigen Receptor Occupancy
Mueller, D. L., Jenkins, M. K., & Schwartz, R. H. (1989) · Annual Review of Immunology · doi:10.1146/annurev.iy.07.040189.002305 · Cited by 1,505
Self-citation
T cell anergy
Schwartz, R. H. (2003) · Annual Review of Immunology · doi:10.1146/annurev.immunol.21.120601.141110 · Cited by 1,487
Antigen presentation by chemically modified splenocytes induces antigen-specific T cell unresponsiveness in vitro and in vivo.
Jenkins, M. K., & Schwartz, R. H. (1987) · The Journal of Experimental Medicine · doi:10.1084/jem.165.2.302 · Cited by 1,187
Visualization of peptide-specific T cell immunity and peripheral tolerance induction in vivo.
Kearney, E. R., Pape, K., Loh, D., & Jenkins, M. (1994) · Immunity · doi:10.1016/1074-7613(94)90084-1 · Cited by 1,126

Flagged first, then by citations

Show all 73 references

Research works printed but not linked: 1

Ryals, J. et al. The Arabidopsis NIM1 protein shows homology to the mammalian transcription factor inhibitor IκB. Plant Cell 9, 425–439 (1997).

Sorted by citations

Items 101–200 of 224

Upregulation of GRAIL Is Associated with Impaired CD4 T Cell Proliferation in Sepsis
Aziz, M., Yang, W.-L., Matsuo, S., Sharma, A., Zhou, M., & Wang, P. (2014) · The Journal of Immunology · doi:10.4049/jimmunol.1302160 · Cited by 31
“It has recently become evident that the posttranslational modification of proteins via ubiquitination plays an essential role in the regulatory mechanism of CD4 T cell anergy (12).”
Background
Differentially Expressed Genes in Postperfusion Biopsies Predict Early Graft Dysfunction After Liver Transplantation
Berberat, P. O., Friess, H., Schmied, B. M., Kremer, M., Gragert, S., Flechtenmacher, C., Schemmer, P., Schmidt, J., Kraus, T. W., Uhl, W., et al. (2006) · Transplantation · doi:10.1097/01.tp.0000233377.14174.93 · Cited by 30
“Nedd-4-like ubiquitin-protein ligase (WWP2) degrades VEGF receptor 2 and is a strong negative regulator of T cell growth factor production and proliferation (18).”
Background
Siah2 control of T-regulatory cells limits anti-tumor immunity
Scortegagna, M., Hockemeyer, K., Dolgalev, I., Poźniak, J., Rambow, F., Yan, L., Feng, Y., Tinoco, R., Otero, D. C., Zhang, T., et al. (2020) · Nature Communications · doi:10.1038/s41467-019-13826-7 · Cited by 29
IMMUNOLOGICAL TOLERANCE
Abbas, A. K., Lichtman, A. H., Pillai, S. S., & Baker, D. L. (2010) · Elsevier eBooks · doi:10.1016/b978-1-4160-3123-9.50018-8 · Cited by 28
Notch Ligand Delta-Like 4 Regulates Development and Pathogenesis of Allergic Airway Responses by Modulating IL-2 Production and Th2 Immunity
Jang, S., Schaller, M. A., Berlin, A. A., & Lukacs, N. W. (2010) · The Journal of Immunology · doi:10.4049/jimmunol.1000175 · Cited by 28
Tuberous Sclerosis 1 Promotes Invariant NKT Cell Anergy and Inhibits Invariant NKT Cell–Mediated Antitumor Immunity
Wu, J., Shin, J., Xie, D., Wang, H., Gao, J., & Zhong, X. (2014) · The Journal of Immunology · doi:10.4049/jimmunol.1302076 · Cited by 28
Mapping of PARK2 and PACRG Overlapping Regulatory Region Reveals LD Structure and Functional Variants in Association with Leprosy in Unrelated Indian Population Groups
Chopra, R., Ali, S., Srivastava, A. K., Aggarwal, S., Kumar, B., Manvati, S., Ponnusamy, K., Jena, M., Garg, V. K., Bhattacharya, S. N., et al. (2013) · PLoS Genetics · doi:10.1371/journal.pgen.1003578 · Cited by 27
“Also various E3 ubiquitin ligase proteins act as suppressor molecules that limit IL-2 production and proliferation in anergic Tcell [40].”
Background
GRAIL and Otubain-1 are Related to T Cell Hyporesponsiveness during Trypanosoma cruzi Infection
Stempin, C. C., Márquez, J. D. R., Ana, Y., & Cerbán, F. M. (2017) · PLoS neglected tropical diseases · doi:10.1371/journal.pntd.0005307 · Cited by 27
A Peptide That Ameliorates Lupus Up-Regulates the Diminished Expression of Early Growth Response Factors 2 and 3
Sela, U., Dayan, M., Hershkoviz, R., Lider, O., & Mozes, E. (2008) · The Journal of Immunology · doi:10.4049/jimmunol.180.3.1584 · Cited by 27
“This state is generally reversible upon exposure to exogenous IL-2 (4).”
Background
Adenosine and anergy
Zarek, P. E., & Powell, J. D. (2007) · Autoimmunity · doi:10.1080/08916930701464939 · Cited by 26
“While the E3 ligases appear to play a role in the early inhibition characteristic of T cell anergy their role in the maintenance of the anergic phenotype is unclear [20].”
Background
Cbl- and Nedd4-family ubiquitin ligases: balancing tolerance and immunity
Gay, D. L., Ramón, H. E., & Oliver, P. M. (2008) · Immunologic Research · doi:10.1007/s12026-008-8034-0 · Cited by 24
“tolerance [5–15].”
Mechanisms That Regulate Peripheral Immune Responses to Control Organ-Specific Autoimmunity
Hoyne, G. F. (2011) · Clinical and Developmental Immunology · doi:10.1155/2011/294968 · Cited by 24
“Multiple E3 ubiquitin ligases are required for regulation of lymphocyte development and activation and immune tolerance [34, 35].”
Background
Advantages of Extracellular Ubiquitin in Modulation of Immune Responses
Sujashvili, R. (2016) · Mediators of Inflammation · doi:10.1155/2016/4190390 · Cited by 23
“Ubiquitination of the T cell receptor mediates its downregulation [35].”
Background
Cbl-b deficiency prevents functional but not phenotypic T cell anergy
Nguyen, T. T. T., Wang, Z., Shen, L., Schroeder, A., Eckalbar, W. L., & Weiss, A. (2021) · The Journal of Experimental Medicine · doi:10.1084/jem.20202477 · Cited by 23
“The E3 ubiquitin ligases Cbl proto-oncogene B (Cbl-b) and gene related to anergy in lymphocytes (Grail) are highly expressed in anergic T cells and contribute to establishing the unresponsive state (Fathman and Lineberry, 2007; Lutz-Nicoladoni et al., 2015; Mueller, 2004).”
Background
The use of genomewide ENU mutagenesis screens to unravel complex mammalian traits: identifying genes that regulate organ‐specific and systemic autoimmunity
Hoyne, G. F., & Goodnow, C. C. (2006) · Immunological Reviews · doi:10.1111/j.0105-2896.2006.00363.x · Cited by 22
“A family of ubiquitin ligases, including CBL-B, ITCH, GRAIL, and NEDD4, are involved in the internalization of TCR from the cell surface and the targeting of specific signaling proteins for ubiquitinmediated degradation (33).”
Background
Molecular Architecture of Signal Complexes Regulating Immune Cell Function
Torgersen, K. M., Aandahl, E. M., & Taskén, K. (2008) · Handbook of experimental pharmacology · doi:10.1007/978-3-540-72843-6_14 · Cited by 21
Notch signaling facilitates hepatitis B virus covalently closed circular DNA transcription via cAMP response element-binding protein with E3 ubiquitin ligase-modulation
Wang, Z., Kawaguchi, K., Honda, M., Hashimoto, S., Shirasaki, T., Okada, H., Orita, N., Shimakami, T., Yamashita, T., Sakai, Y., et al. (2019) · Scientific Reports · doi:10.1038/s41598-018-38139-5 · Cited by 21
Functional heterogeneity and adaptation of naive T cells in response to tonic TCR signals
Eggert, J., & Au‐Yeung, B. B. (2021) · Current Opinion in Immunology · doi:10.1016/j.coi.2021.09.007 · Cited by 20
PARK2 and proinflammatory/anti-inflammatory cytokine gene interactions contribute to the susceptibility to leprosy: a case–control study of North Indian population
Chopra, R., Ponnusamy, K., Ali, S., Srivastava, A. K., Aggarwal, S., Garg, V. K., Bhattacharya, S. N., & Bamezai, R. N. K. (2014) · BMJ Open · doi:10.1136/bmjopen-2013-004239 · Cited by 20
Visualizing the Role of Cbl-b in Control of Islet-Reactive CD4 T Cells and Susceptibility to Type 1 Diabetes
Hoyne, G. F., Flening, E., Yabas, M., Teh, C. E., Altin, J. A., Randall, K. L., Thien, C. B. F., Langdon, W. Y., & Goodnow, C. C. (2011) · The Journal of Immunology · doi:10.4049/jimmunol.1002296 · Cited by 20
“In tissue culture, T cell clones that receive a sustained TCR calcium signal in the absence of a CD28 costimulus are rendered unable to synthesize IL-2 and proliferate upon restimulation (38, 39).”
Background
Regulatory T Cells in Transplantation Tolerance
Waldmann, H., Graça, L., Adams, E., Fairchild, P. J., & Cobbold, S. P. (2005) · Springer eBooks · doi:10.1007/3-540-27702-1_11 · Cited by 20
Discovery, Optimization, and Biological Evaluation of Arylpyridones as Cbl-b Inhibitors
Mfuh, A. M., Boerth, J. A., Bommakanti, G., Chan, C., Chinn, A. J., Code, E. L., Fricke, P. J., Giblin, K. A., Gohlke, A., Hansel, C. S., et al. (2024) · Journal of Medicinal Chemistry · doi:10.1021/acs.jmedchem.3c02083 · Cited by 19
E3 ubiquitin ligases in T‐cell tolerance
Paolino, M., & Penninger, J. M. (2009) · European Journal of Immunology · doi:10.1002/eji.200939662 · Cited by 19
STAP-2 Adaptor Protein Regulates Multiple Steps of Immune and Inflammatory Responses
Matsuda, T., & Oritani, K. (2021) · Biological and Pharmaceutical Bulletin · doi:10.1248/bpb.b21-00224 · Cited by 19
Anergic CD4+ T Cells Form Mature Immunological Synapses with Enhanced Accumulation of c-Cbl and Cbl-b
Doherty, M., Osborne, D. G., Browning, D. L., Parker, D. C., & Wetzel, S. A. (2010) · The Journal of Immunology · doi:10.4049/jimmunol.0902285 · Cited by 19
“A polyclonal rabbit Ab to gene related to anergy in lymphocytes (GRAIL) (44) was a kind gift of Dr. Garrison Fathman (Stanford University, Palo Alto, CA).”
BackgroundInfluential
The Biology of A20-Like Molecules
Enesa, K., & Evans, P. C. (2014) · Advances in experimental medicine and biology · doi:10.1007/978-1-4939-0398-6_3 · Cited by 18
Foxp3 controls autoreactive T cell activation through transcriptional regulation of early growth response genes and E3 ubiquitin ligase genes, independently of thymic selection
Chang, X., Chen, L., Wen, J., Godfrey, V., Qiao, G., Hussien, Y., Zhang, J., & Gao, J.-X. (2006) · Clinical Immunology · doi:10.1016/j.clim.2006.07.004 · Cited by 18
“The down-regulation of Egr-2, Egr-3, Cblb, Itch and GRAIL may block the degradation of PKC-u and PLCg1 [26,61], leading to dramatic autoreactive T cell expansion.”
Background
Cyclin-dependent kinases: Molecular switches controlling anergy and potential therapeutic targets for tolerance
Wells, A. D. (2007) · Seminars in Immunology · doi:10.1016/j.smim.2007.02.009 · Cited by 18
“These signals induce the expression and/or activity of anergic, negative regulatory factors, which include E3 ubiquitin ligases and transcriptional repressors (reviewed in [27,28]).”
Background
Loss of a gimap/ian gene leads to activation of NF-κB through a MAPK-dependent pathway
Kupfer, R., Lang, J., Williams-Skipp, C., Nelson, M., Bellgrau, D., & Scheinman, R. I. (2006) · Molecular Immunology · doi:10.1016/j.molimm.2006.02.014 · Cited by 19
Inverse Rap1 and Phospho-ERK Expression Discriminate the Maintenance Phase of Tolerance and Priming of Antigen-Specific CD4+ T Cells In Vitro and In Vivo
Morton, A. M., McManus, B., Garside, P., Mowat, A. M., & Harnett, M. M. (2007) · The Journal of Immunology · doi:10.4049/jimmunol.179.12.8026 · Cited by 17
CRYAB modulates the activation of CD4 + T cells from relapsing–remitting multiple sclerosis patients
Quach, Q. L., Metz, L. M., Thomas, J. C., Rothbard, J. B., Steinman, L., & Ousman, S. S. (2013) · Multiple Sclerosis Journal · doi:10.1177/1352458513489853 · Cited by 20
Role of CTLA4 A49G polymorphism in systemic lupus erythematosus and its geographical distribution
Kailashiya, V., Sharma, H. B., & Kailashiya, J. (2019) · Journal of Clinical Pathology · doi:10.1136/jclinpath-2019-206013 · Cited by 14
Multistrain Genetic Comparisons Reveal CCR5 as a Receptor Involved in Airway Hyperresponsiveness
Walker, J. K. L., Ahumada, A., Frank, B. C., Gaspard, R. M., Berman, K., Quackenbush, J. F., & Schwartz, D. A. (2006) · American Journal of Respiratory Cell and Molecular Biology · doi:10.1165/rcmb.2005-0314oc · Cited by 14
“Several of these E3 ubiquitin ligases negatively regulate T-cell growth factor production and proliferation (35).”
Background
E3 ubiquitin ligases and their control of T cell autoreactivity.
Bonnevier, J. L., Zhang, R., & Mueller, D. L. (2005) · Arthritis Research & Therapy · doi:10.1186/ar1842 · Cited by 14
Self-citation
Upregulation of GRAIL is associated with remission of ulcerative colitis
Egawa, S., Iijima, H., Shinzaki, S., Nakajima, S., Wang, J., Kondo, J., Ishii, S., Yoshio, T., Irie, T., Nishida, T., et al. (2008) · American Journal of Physiology-Gastrointestinal and Liver Physiology · doi:10.1152/ajpgi.90242.2008 · Cited by 14
“E3 ubiquitin ligases, such as GRAIL, Itch, and c-Cbl, have been shown to be involved in the process of T cell anergy in animals (1, 19, 24).”
BackgroundResultInfluential
Anti-HLA-DR-triggered monocytes mediate in vitro T cell anergy
Kriegel, M. A., Adam‐Klages, S., Gabler, C., Blank, N., Schiller, M. R., Scheidig, C., Kalden, J. R., & Lorenz, H. (2008) · International Immunology · doi:10.1093/intimm/dxn019 · Cited by 13
Genetic Disorders of Immune Regulation
Speckmann, C., Borkhardt, A., Gaspar, H. B., Gambineri, E., & Ehl, S. R. (2016) · Springer eBooks · doi:10.1007/978-3-662-52909-6_5 · Cited by 13
T-helper cells flexibility: the possibility of reprogramming T cells fate
Khantakova, J. N., & Sennikov, S. V. (2023) · Frontiers in Immunology · doi:10.3389/fimmu.2023.1284178 · Cited by 13
E3 Ubiquitin Ligases as Immunotherapeutic Target in Atherosclerotic Cardiovascular Disease
Poels, K., Vos, W. G., Lutgens, E., & Seijkens, T. T. P. (2020) · Frontiers in Cardiovascular Medicine · doi:10.3389/fcvm.2020.00106 · Cited by 11
“The RING-type E3 ubiquitin ligase GRAIL is well-known for its role in the regulation of T-cell activity (12, 13, 45).”
Background
Dual Regulation of Host TRAIP Post-translation and Nuclear/Plasma Distribution by Porcine Reproductive and Respiratory Syndrome Virus Non-structural Protein 1α Promotes Viral Proliferation
Shi, P., Su, Y., Li, R., Zhang, L., Chen, C., Zhang, L., Faaberg, K. S., & Huang, J. (2018) · Frontiers in Immunology · doi:10.3389/fimmu.2018.03023 · Cited by 12
“pCMV-nsp1α N(1-167)-R CAGGGATGCCACCCGGGATCCCTACCTCTGCGGGAGCGGCAA”
Immune Dysregulation in Human ITCH Deficiency Successfully Treated with Hematopoietic Cell Transplantation
Patel, T., Henrickson, S. E., Moser, E. K., Field, N. S., Maurer, K., Dawany, N. B., Conrad, M. A., Bunin, N., Freedman, J. L., Heimall, J. R., et al. (2021) · The Journal of Allergy and Clinical Immunology In Practice · doi:10.1016/j.jaip.2021.04.010 · Cited by 11
Diseases of the Immune System
Nayak, R. (2017) · Jaypee Brothers Medical Publishers (P) Ltd. eBooks · doi:10.5005/jp/books/12977_7 · Cited by 11
Regulation of anergy-related ubiquitin E3 ligase, GRAIL, in murine models of colitis and patients with Crohn’s disease
Mukai, A., Iijima, H., Hiyama, S., Fujii, H., Shinzaki, S., Inoue, T., Shiraishi, E., Kawai, S., Araki, M., Hayashi, Y., et al. (2013) · Journal of Gastroenterology · doi:10.1007/s00535-013-0923-x · Cited by 11
Does our current understanding of the molecular basis of immune tolerance predict new therapies for autoimmune disease?
Tarner, I. H., & Fathman, C. G. (2006) · Nature Clinical Practice Rheumatology · doi:10.1038/ncprheum0272 · Cited by 11
“These include the RING finger domain E3 ligases Cbl-c, Cbl-b, and GRAIL (gene related to anergy in lymphocytes)”
Background
Impact of Mycobacterium tuberculosis Glycolipids on the CD4+ T Cell–Macrophage Immunological Synapse
Mwebaza, I., Shaw, R., Li, Q., Fletcher, S., Achkar, J. M., Harding, C. V., Carpenter, S. M., & Boom, W. H. (2023) · The Journal of Immunology · doi:10.4049/jimmunol.2300107 · Cited by 9
Efficient generation of useful monoclonal antibodies reactive with globotriaosylceramide using knockout mice lacking Gb3/CD77 synthase
Kondo, Y., Tokuda, N., Furukawa, K., Ando, R., Uchikawa, M., Zhang, Q., Xiaoyan, F., & Furukawa, K. (2011) · Glycoconjugate Journal · doi:10.1007/s10719-011-9335-4 · Cited by 10
“c-Cbl has been known as an E3 ubiquitin ligase [ 28 ] and to attenuate BCR-mediated signaling by leading molecules such as Syk to degradation by the proteasome system [29].”
Background
Therapeutic Potential of Hyporesponsive CD4+ T Cells in Autoimmunity
Maggi, J., Schäfer, C., Ubilla-Olguín, G., Catalán, D., Schinnerling, K., & Aguillón, J. C. (2015) · Frontiers in Immunology · doi:10.3389/fimmu.2015.00488 · Cited by 10
“, Grail, Cbl-b, and Itch) are required to induce a functional unresponsiveness state through downregulation of TCR signaling by inactivation or degradation of signaling molecules (54).”
Background
E3 ubiquitin ligase: A potential regulator in fibrosis and systemic sclerosis
Huang, X., Zhang, L., Duan, Y., Wang, Y., Zhao, J.-H., & Wang, J. (2016) · Cellular Immunology · doi:10.1016/j.cellimm.2016.07.003 · Cited by 10
Up-regulation of Cbl-b is associated with LSECtin-mediated inhibition of different CD4+ T-cell subsets
Zhao, D., Zhang, M., Wang, M., Liu, B., Wang, X., Yang, J., He, F., & Tang, L. (2012) · Immunobiology · doi:10.1016/j.imbio.2012.07.017 · Cited by 9
Age-related transcriptional modules and TF-miRNA-mRNA interactions in neonatal and infant human thymus
Bertonha, F. B., Bando, S. Y., Ferreira, L., Chaccur, P., Vinhas, C. D. F., Zerbini, M. C. N., Carneiro-Sampaio, M. M. S., & Moreira‐Filho, C. A. (2020) · PLoS ONE · doi:10.1371/journal.pone.0227547 · Cited by 10
“HECT ligases have been linked to the induction of immune self-tolerance[30].”
Background
Diseases of the Immune System
(2010) · Elsevier eBooks · doi:10.1016/b978-1-4377-0792-2.50011-0 · Cited by 10
An adenoviral vector encoding dominant negative Cbl lowers the threshold for T cell activation in post-thymic T cells
Zha, Y., & Gajewski, T. F. (2007) · Cellular Immunology · doi:10.1016/j.cellimm.2007.07.006 · Cited by 10
Increased expression of the Cbl family of E3 ubiquitin ligases decreases Interleukin-2 production in a rat model of peripheral neuropathy
Jeong, J. S., Kim, H. Y., Shin, B. S., Lee, A. R., Yoon, J. H., Hahm, T. S., & Lee, J. E. (2018) · BMC Anesthesiology · doi:10.1186/s12871-018-0555-z · Cited by 9
The E3 Ubiquitin Ligase Cbl-b Regulates Expansion but Not Functional Activity of Self-Reactive CD4 T Cells
Rose, M. S., Qui, H. Z., Bandyopadhyay, S., Mihalyo, M. A., Hagymasi, A. T., Clark, R. B., & Adler, A. J. (2009) · The Journal of Immunology · doi:10.4049/jimmunol.0901243 · Cited by 9
“confer impaired antigenic responsiveness by ubiquitinating specific signaling molecules located downstream of the TCR (38, 39).”
Background
USP53 Exerts Tumor-Promoting Effects in Triple-Negative Breast Cancer by Deubiquitinating CRKL
Liu, Y., Tang, W., & Yao, F. (2023) · Cancers · doi:10.3390/cancers15205033 · Cited by 8
“C-cbl and Cbl-B are E3 ubiquitinating enzymes that both ubiquitinate CRKL and negatively regulate the CRKL–C3G complex [29,30].”
Background
Endogenous antigens shape the transcriptome and TCR repertoire in an autoimmune arthritis model
McCarthy, E. E., Yu, S., Perlmutter, N., Nakao, Y., Naito, R., Lin, C., Riekher, V., DeRisi, J. L., Ye, C., Weiss, A., et al. (2024) · Journal of Clinical Investigation · doi:10.1172/jci174647 · Cited by 8
“However, in arthritogenic SKGNur GFP hi CD4 + T cells, chronic exposure to endogenous antigens led to incomplete induction of tolerance genes following TCR signaling, unlike the more complete induction of negative regulators observed in WT cells.”
Inhibition of Notch signalling has ability to alter the proximal and distal TCR signalling events in human CD3 + αβ T-cells
Dar, A. A., Bhat, S. A., Gogoi, D., Gokhale, A., & Chiplunkar, S. V. (2017) · Molecular Immunology · doi:10.1016/j.molimm.2017.10.013 · Cited by 8
How Suppressor Cells Led to Anergy, Costimulation, and Beyond
Bour-Jordan, H., & Bluestone, J. A. (2009) · The Journal of Immunology · doi:10.4049/jimmunol.0990078 · Cited by 8
Ubiquitylation‐dependent downregulation of Nck regulates its functional activity
Joseph, N., Reicher, B., David, A., Matalon, O., & Barda‐Saad, M. (2014) · FEBS Letters · doi:10.1016/j.febslet.2014.08.033 · Cited by 8
“Similar to Cbl-b, these proteins are well known for their essential role as negative regulators of T-cell activation through the mediation of ubiquitylation and the degradation of several components of TCR-associated signaling complexes, such as phospholipase C gamma1 (PLCc1) and protein kinase C theta (PKCh) [22,31,3…”
Background
Histone Acetylation at the Ifng Promoter in Tolerized CD4 Cells Is Associated with Increased IFN-γ Expression during Subsequent Immunization to the Same Antigen
Long, M., Slaiby, A. M., Wu, S., Hagymasi, A. T., Mihalyo, M. A., Bandyopadhyay, S., Vella, A. T., & Adler, A. J. (2007) · The Journal of Immunology · doi:10.4049/jimmunol.179.9.5669 · Cited by 8
“It therefore appears that there is a degree of independence in the pathways that regulate epigenetic modification of the Ifng locus and the decision to become tolerant (as defined by a blockage in TCR-mediated signaling (36, 37)).”
Background
Cbl-b Deficiency in Mice Results in Exacerbation of Acute and Chronic Stages of Allergic Asthma
Carson, W. F., Guernsey, L. A., Singh, A., Secor, E. R., Wohlfert, E. A., Clark, R. B., Schramm, C. M., Kunkel, S. L., & Thrall, R. S. (2015) · Frontiers in Immunology · doi:10.3389/fimmu.2015.00592 · Cited by 8
“In terms of cellintrinsic pathways, Cbl-b has been shown to play an important role in anergy induction in response to tolerizing signals (31, 32).”
Background
T Cell Anergy: Where It's LAT
Lineberry, N. B., & Fathman, C. G. (2006) · Immunity · doi:10.1016/j.immuni.2006.05.002 · Cited by 8
Cbl-b gene silencing in splenic T lymphocytes as a therapeutic strategy to target the prostate cancer RM-1 cell tumors in immune competent mice.
Zd, S., Xf, L., Hao, L., Zhao, Y., Yx, W., Dong, B.-Z., Wh, C., Zg, Z., Ym, W., Fu, Q., et al. (2014) · PubMed · Cited by 7
The Involvement of Ubiquitination and SUMOylation in Retroviruses Infection and Latency
Liang, T., Li, G., Lu, Y., Hu, M., & Ma, X. (2023) · Viruses · doi:10.3390/v15040985 · Cited by 6
Negative Regulation of TCR Signaling in Immunological Tolerance: Taming Good and Evil
Gatzka, M., & Walsh, C. M. (2008) · Current Immunology Reviews · doi:10.2174/157339508786447968 · Cited by 6
Peripheral blood immune response-related gene analysis for evaluating the potential risk of chronic antibody-mediated rejection
Yamamoto, T., Iwasaki, K., Murotani, K., Takeda, A., Futamura, K., Okada, M., Tsujita, M., Hiramitsu, T., Goto, N., Narumi, S., et al. (2018) · Human Immunology · doi:10.1016/j.humimm.2018.03.012 · Cited by 6
Differentiation Stages and Subsets of Tolerogenic Dendritic Cells
Lutz, M. B. (2006) · Wiley eBooks · doi:10.1002/9783527619696.ch26 · Cited by 6
E3 Ligases in T Helper 2-mediated Pathogenesis
Sahoo, A. (2014) · Immunome Research · doi:10.4172/1745-7580.1000086 · Cited by 5
“Ubiquitin E3 ligases of both RING (Cbl-b, GRAIL) and HECT (Itch) types have emerged as major players in controlling undesired T cell activation [14-18].”
BackgroundInfluential
A Breath of Fresh Aire
Zhang, R., & Turka, L. A. (2013) · Immunity · doi:10.1016/j.immuni.2013.08.022 · Cited by 5
“Recently, TCR-mediated induction of E3 ubiquitin ligases such as Cbl-b, Itch, and Grail has been suggested to mediate inductionandmaintenanceofTcell anergy (Mueller, 2004).”
Background
Mechanisms of self-inactivation in anergic T cells
Valdor, R., & Macián, F. (2010) · Inmunología · doi:10.1016/s0213-9626(10)70008-1 · Cited by 7
Mechanisms of Central and Peripheral T-Cell Tolerance: An Update
Buer, J., Westendorf, A. M., Zeng, A., HeFeng, F. Q., Hansen, W., & Probst‐Kepper, M. (2005) · Transfusion Medicine and Hemotherapy · doi:10.1159/000089128 · Cited by 5
Gastrointestinal Microbiota Do Not Significantly Contribute to T Cell Activation or GI Inflammation in Ndfip1-cKO Mice
Kurzweil, V., Tarangelo, A., & Oliver, P. M. (2012) · PLoS ONE · doi:10.1371/journal.pone.0034478 · Cited by 5
“Itch can promote ubiquitin-mediated degradation of various signaling proteins, thereby suppressing T cell activation and inflammation [4].”
Background
A plague of autoantibodies
Heissmeyer, V., Ansel, K. M., & Rao, A. (2005) · Nature Immunology · doi:10.1038/ni1214 · Cited by 5
Naïve arthritogenic SKG T cells have a defect in anergy and a repertoire pruned by superantigenPreprint
Ashouri, J. F., McCarthy, E. E., Yu, S., Perlmutter, N., Lin, C., DeRisi, J. L., Ye, C., & Weiss, A. (2022) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2022.01.13.476250 · Cited by 5
“Therefore, we sought to examine the expression of candidate genes known to be associated with these two tolerance programs (36-41) in SKGNur and WTNur GFP cells compared to their GFP counterparts within the T.”
Background
Dysregulated protein kinase/phosphatase networks in SLE T cells
Suárez‐Rojas, G., & Crispín, J. C. (2022) · Clinical Immunology · doi:10.1016/j.clim.2022.108952 · Cited by 4
Ascorbic acid improves thrombotic function of platelets during living donor liver transplantation by modulating the function of the E3 ubiquitin ligases c-Cbl and Cbl-b
Kwon, J. H., Kim, D., Cho, H., & Shin, B. S. (2019) · Journal of International Medical Research · doi:10.1177/0300060518817408 · Cited by 4
Immune Tolerance Defects in Lupus
Singh, R. R., Dubey, S., & Pinkhasov, J. (2012) · Elsevier eBooks · doi:10.1016/b978-1-4377-1893-5.00019-4 · Cited by 4
La génétique épidémiologique identifie une nouvelle voie de réponse au bacille de la lèpre
Alcaïs, A., Thuc, N. V., Thai, V. H., & Abel, L. (2005) · Annales de Dermatologie et de Vénéréologie · doi:10.1016/s0151-9638(05)79196-1 · Cited by 4
T cell-Intrinsic Peripheral Tolerance: A Checkpoint Target to Treat Autoimmunity
Gholijani, N., Daryabor, G., & Kahmini, F. R. (2024) · Journal of Cellular Immunology · doi:10.33696/immunology.6.194 · Cited by 3
Deciphering the Selectivity of CBL-B Inhibitors Using All-Atom Molecular Dynamics and Machine Learning
Zhou, F., Du, H., Wang, Y., Fu, W., Zhao, B., Zhou, J., & Zhang, Y. (2024) · ACS Medicinal Chemistry Letters · doi:10.1021/acsmedchemlett.4c00047 · Cited by 2
Making antigen invisible: a coinhibitory molecule regulates the interaction between T cells and dendritic cells
Diepolder, H. M., & Obst, R. (2010) · Expert Review of Vaccines · doi:10.1586/erv.09.164 · Cited by 3
Novel CD 3‐specific antibody induces immunosuppression via impaired phosphorylation of LAT and PLC γ1 following T ‐cell stimulation
Shiheido, H., Aoyama, T., Takahashi, H., Hanaoka, K., Abe, T., Nishida, E., Chen, C., Koga, O., Hikida, M., Shibagaki, Y., et al. (2014) · European Journal of Immunology · doi:10.1002/eji.201344146 · Cited by 3
TCR stimulation without co-stimulatory signals induces expression of “tolerogenic” genes in memory CD4 T cells but does not compromise cell proliferation
Xie, A., Zheng, X., Khattar, M., Schroder, P. M., Stepkowski, S. M., Xia, J., & Chen, W. (2014) · Molecular Immunology · doi:10.1016/j.molimm.2014.09.013 · Cited by 3
The role of ubiquitin ligases in the control of organ specific autoimmunity.
Hoyne, G. F. (2012) · Europe PMC (PubMed Central) · Cited by 2
La lèpre, une maladie éliminée… ou négligée ?
Ranque, B., Abel, L., & Alcaïs, A. (2007) · Antibiotiques · doi:10.1016/s1294-5501(07)88775-9 · Cited by 4
Isoflurane decreases interleukin-2 production by increasing c-Cbl and Cbl-b expression in rat peripheral blood mononuclear cells
Choi, J. W., & Shin, B. S. (2018) · Journal of International Medical Research · doi:10.1177/0300060518770955 · Cited by 3
“Activation of ZAP70 and PLC-c1 results in increased production of IL-2.(16) Therefore, we investigated the effect of isoflurane exposure on ZAP70 and PLC-c1 levels.”
BackgroundInfluential
The Liver and the Immune System
Knolle, P. A. (2006) · Elsevier eBooks · doi:10.1016/b978-1-4160-3258-8.50014-0 · Cited by 2
Investigation of the Involvement of Covalent Binding in Nevirapine-Induced Hepatic and Cutaneous Idiosyncratic Adverse Drug Reactions
Sharma, A. M. (2013) · TSpace (University of Toronto) · Cited by 2
Primary immune deficiency diseases with prominent autoimmunity
Squire, J. D., & Leiding, J. W. (2020) · Elsevier eBooks · doi:10.1016/b978-0-12-816768-7.00027-2 · Cited by 1
Signal-transducing adaptor protein-2 modulates T-cell functions
Matsuda, T., Sasaki, Y., Kagohashi, K., Saitoh, K., Sekine, Y., Kashiwakura, J., & Oritani, K. (2022) · Exploration of Immunology · doi:10.37349/ei.2022.00082 · Cited by 1
The essential elements of adaptive immunity and their relevance to cancer immunology
Bullock, T. N. J. (2023) · Elsevier eBooks · doi:10.1016/b978-0-323-87763-3.00016-2 · Cited by 1
Investigation of T cell signalling events regulating immunity and tolerance in vivo
Morton, A. M. (2008) · Enlighten: Theses (The University of Glasgow) · Cited by 1
E3 Ubiquitin Ligase CBL-B
Tang, J., & Zhang, J. (2017) · Springer eBooks · doi:10.1007/978-3-319-67199-4_101569 · Cited by 1
CD4+ T Cell Responses: A Complex Network of Activating and Tolerizing Signals as Revealed by Gene Expression Analysis: A Dissertation
Brown, D. S. (2005) · eScholarship@UMassChan · doi:10.13028/eqwy-6j58
“c-Cbl expression and activity also correlates with anergy induction and inhibition of peripheral T cell responsiveness, and c-cbl is known to regulate proximal signaling molecules downstream of the TCR including Rap1 and CrkL(86).”
Background
CD8+ T-cell responses in a Th2-polarized inflammatory setting
Kurzweil, V. (2013) · ScholarlyCommons (University of Pennsylvania)
Probing lymphocyte responses to modulation of the F0F1-ATPase by BZ-423
Wang, L. (2009) · Deep Blue (University of Michigan)
Cellular effects of the multi-domain serine/threonine kinase from Yersinia enterocolitica
Zenner, G. (2007) · Elektronische Hochschulschriften der LMU München (Ludwig-Maximilians-Universität München) · doi:10.5282/edoc.6930
Modulierung der NF-KB-Aktivität in T-Zellen durch den Carmal1-Bcl10-Malt1 Komplex
Wegener, E. (2006) · edoc Publication server (Humboldt University of Berlin) · doi:10.18452/15507
Regulation of calcium signaling and cellular localization of NFAT in CD8+ anergic T cells.
Srinivasan, M. (2008) · University Libraries (University of Maryland)
HECT Ubiquitin‐Protein Ligases in Human Disease
Scheffner, M., & Staub, O. (2007) · Wiley eBooks · doi:10.1002/9783527619320.ch4c

Authors: Mueller, D. L.
Affiliations: University of Minnesota (US)
Corresponding author: Mueller, Daniel L
ORCID: Mueller, Daniel L
Venue: Nature Immunology
Publisher: Springer Science and Business Media LLC
Published: 2004-08-27
Volume: 5
Issue: 9
Pages: 883-890
ISSN: 1529-2908 (ISSN-L)
1529-2916
DOI: 10.1038/ni1106
OpenAlex: W2005935110
Cited by: 224
References: 73
Citations by year: 2026: 2 · 2025: 2 · 2024: 5 · 2023: 7 · 2022: 3 · 2021: 7 · 2020: 6 · 2019: 7 · 2018: 7 · 2017: 5 · 2016: 7 · 2015: 5 · 2014: 14 · 2013: 11 · 2012: 7
FWCI: 1.90
Type: journal article
Language: en
Open access: closed
Licence: www.springer.com/tdm (tdm)
Locations: Nature Immunology (publishedVersion)
PubMed (publishedVersion)
Funders: National Institute of General Medical Sciences (R01 GM54706, R01GM054706)
National Institute of Allergy and Infectious Diseases (P01AI50162, P01-AI 35296, P01AI050162, P01AI035296)
Topics: Life Sciences › Immunology and Microbiology › Immunology › T-cell and B-cell Immunology
Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Ubiquitin and proteasome pathways
Life Sciences › Immunology and Microbiology › Immunology › Immune Response and Inflammation
Keywords: E3 ubiquitin ligase, T cell anergy, HECT E3 ligases, RING E3 ligases, ubiquitination, self-tolerance, c-Cbl, Cbl-b, GRAIL, pruritus, NEDD4, T cell proliferation
MeSH terms: Animals, Humans, T-Lymphocytes, Signal Transduction, Self Tolerance, Clonal Anergy, Models, Immunological, Ubiquitin-Protein Ligases

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

E3 ubiquitin ligases as T cell anergy factors

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Citations

Cites

Cited by

Related

Metadata

Record

About these checks