The DOI matches its Crossref record; 35 of the 35 references it cites were found in a registry or an index.
Failure of MBNL1-dependent post-natal splicing transitions in myotonic dystrophy
Abstract
In myotonic dystrophy (DM), expression of RNA containing expanded CUG or CCUG repeats leads to misregulated alternative splicing of pre-mRNA. The repeat-bearing transcripts accumulate in nuclear foci, together with proteins in the muscleblind family, MBNL1 and MBNL2. In transgenic mice that express expanded CUG repeats, we show that the splicing defect selectively targets a group of exons that share a common temporal pattern of developmental regulation. These exons undergo a synchronized splicing switch between post-natal day 2 and 20 in wild-type mice. During this post-natal interval, MBNL1 protein translocates from a predominantly cytoplasmic to nuclear distribution. In the absence of MBNL1, these physiological splicing transitions do not occur. The splicing defect induced by expanded CUG repeats in mature muscle fibers is closely reproduced by deficiency of MBNL1 but not by deficiency of MBNL2. A parallel situation exists in human DM type 1 and type 2. MBNL1 is depleted from the muscle nucleoplasm because of sequestration in nuclear foci, and the associated splicing defects are remarkably similar to those observed in MBNL1 knockout mice. These results indicate that MBNL1 participates in the post-natal remodeling of skeletal muscle by controlling a key set of developmentally regulated splicing switches. Sequestration of MBNL1, and failure to maintain these splicing transitions, has a pivotal role in the pathogenesis of muscle disease in DM.
Overview
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“In myotonic dystrophy, CTG or CCTG repeat expansions in expressed RNAs sequester MBNL proteins from their normal binding sites, altering MBNL-dependent splicing patterns101–105.”
From The neurogenetics of alternative splicing (2016) · cites this paper as [102]
Citations
Cites
Brook, J. D., McCurrach, M. E., Harley, H. G., Buckler, A., Church, D. M., Aburatani, H., Hunter, K. W., Stanton, V. P., Thirion, J., Hudson, T. J., et al. (1992) · Cell · doi:10.1016/0092-8674(92)90154-5 · Cited by 2,754
Ultraconserved Elements in the Human Genome
Bejerano, G., Pheasant, M., Makunin, I., Stephen, S., Kent, W. J., Mattick, J. S., & Haussler, D. (2004) · Science · doi:10.1126/science.1098119 · Cited by 1,732
Myotonic Dystrophy Type 2 Caused by a CCTG Expansion in Intron 1 of ZNF9
Liquori, C. L., Ricker, K., Moseley, M. L., Jacobsen, J. F., Kreß, W., Naylor, S. L., Day, J., & Ranum, L. P. W. (2001) · Science · doi:10.1126/science.1062125 · Cited by 1,254
Recruitment of human muscleblind proteins to (CUG)n expansions associated with myotonic dystrophy
Miller, J. W., Urbinati, C. R., Teng‐umnuay, P., Stenberg, M. G., Byrne, B. J., Thornton, C. A., & Swanson, M. S. (2000) · The EMBO Journal · doi:10.1093/emboj/19.17.4439 · Cited by 937
Self-citationDisruption of Splicing Regulated by a CUG-Binding Protein in Myotonic Dystrophy
Philips, A. V., Timchenko, L., & Cooper, T. A. (1998) · Science · doi:10.1126/science.280.5364.737 · Cited by 818
The Polo kinase Plk4 functions in centriole duplication
Habedanck, R., Stierhof, Y., Wilkinson, C. J., & Nigg, E. A. (2005) · Nature Cell Biology · doi:10.1038/ncb1320 · Cited by 809
Savkur, R. S., Philips, A. V., & Cooper, T. A. (2001) · Nature Genetics · doi:10.1038/ng704 · Cited by 795
A Muscleblind Knockout Model for Myotonic Dystrophy
Kanadia, R. N., Johnstone, K. A., Mankodi, A., Lungu, C., Thornton, C. A., Esson, D., Timmers, A. M., Hauswirth, W. W., & Swanson, M. S. (2003) · Science · doi:10.1126/science.1088583 · Cited by 743
Self-citationMyotonic Dystrophy in Transgenic Mice Expressing an Expanded CUG Repeat
Mankodi, A. K., Logigian, E. L., Callahan, L. M., McClain, C., White, R. J., Henderson, D., Krym, M., & Thornton, C. A. (2000) · Science · doi:10.1126/science.289.5485.1769 · Cited by 738
Self-citationMankodi, A. K., Takahashi, M. P., Jiang, H. N., Beck, C. L., Bowers, W. J., Moxley, R. T., Cannon, S. C., & Thornton, C. A. (2002) · Molecular Cell · doi:10.1016/s1097-2765(02)00563-4 · Cited by 672
Self-citation
Cited by
Sorted by citations
Cooper, T. A., Wan, L., & Dreyfuss, G. (2009) · Cell · doi:10.1016/j.cell.2009.02.011 · Cited by 1,198
“In one of two pathogenic effects of the RNA, MBNL1 colocalizes with the RNA foci and is depleted from the nucleoplasm more than 2-fold, resulting in aberrant regulation of MBNL1-sensitive splicing events (Figure 3B) (Lin et al., 2006).”
InfluentialZamponi, G. W., Striessnig, J., Koschak, A., & DOLPHIN, A. C. (2015) · Pharmacological Reviews · doi:10.1124/pr.114.009654 · Cited by 1,158
“Small interfering RNA studies in mice suggested that two splicing factors previously implicated in DM1, MBNL1, and CUGBP1 (Philips et al., 1998; Lin et al., 2006), regulate exon 29 splicing.”
BackgroundSplicing in disease: disruption of the splicing code and the decoding machinery
Wang, G., & Cooper, T. A. (2007) · Nature Reviews Genetics · doi:10.1038/nrg2164 · Cited by 1,077
A postnatal switch of CELF and MBNL proteins reprograms alternative splicing in the developing heart
Kalsotra, A., Xiao, X., Ward, A. J., Castle, J. C., Johnson, J. M., Burge, C. B., & Cooper, T. A. (2008) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0809045105 · Cited by 508
“MBNL1 has been shown to undergo a cytoplasmic to nuclear transition during the first 3 weeks of postnatal skeletal muscle development (25).”
BackgroundResultInfluentialTranscriptome-wide Regulation of Pre-mRNA Splicing and mRNA Localization by Muscleblind Proteins
Wang, E. T., Cody, N. A. L., Jog, S., Biancolella, M., Wang, T. T., Treacy, D. J., Luo, S., Schroth, G. P., Housman, D. E., Reddy, S., et al. (2012) · Cell · doi:10.1016/j.cell.2012.06.041 · Cited by 490
“This reverses the normal developmental accumulation of Mbnls, shifting splicing toward fetal isoforms (Lin et al., 2006).”
Targeting nuclear RNA for in vivo correction of myotonic dystrophy
Wheeler, T. M., Leger, A. J., Pandey, S., MacLeod, A. R., Nakamori, M., Cheng, S. H., Wentworth, B. M., Bennett, C. F., & Thornton, C. A. (2012) · Nature · doi:10.1038/nature11362 · Cited by 521
Self-citationThe myotonic dystrophies: molecular, clinical, and therapeutic challenges
Udd, B., & Krahe, R. (2012) · The Lancet Neurology · doi:10.1016/s1474-4422(12)70204-1 · Cited by 493
Shapiro, I. M., Cheng, A. W., Flytzanis, N. C., Balsamo, M., Condeelis, J. S., Oktay, M. H., Burge, C. B., & Gertler, F. B. (2011) · PLoS Genetics · doi:10.1371/journal.pgen.1002218 · Cited by 476
Kuyumcu-Martinez, N. M., Wang, G., & Cooper, T. A. (2007) · Molecular Cell · doi:10.1016/j.molcel.2007.07.027 · Cited by 445
“However, CUGBP1 mRNA levels do not exhibit a corresponding decrease, suggesting that protein steady-state levels are regulated at the level of translation or protein stability (Ladd et al., 2005; Lin et al., 2006).”
BackgroundInfluentialWard, A. J., & Cooper, T. A. (2009) · The Journal of Pathology · doi:10.1002/path.2649 · Cited by 436
“The alternative splicing regulator MBNL1 has a high affinity for expanded CUG- and CCUG-repeat RNA and colocalizes with the nuclear foci, depleting MBNL1 from the nucleoplasm [74].”
BackgroundReversal of RNA Dominance by Displacement of Protein Sequestered on Triplet Repeat RNA
Wheeler, T. M., Sobczak, K., Lueck, J. D., Osborne, R. J., Lin, X., Dirksen, R. T., & Thornton, C. A. (2009) · Science · doi:10.1126/science.1173110 · Cited by 404
Self-citationThornton, C. A. (2014) · Neurologic Clinics · doi:10.1016/j.ncl.2014.04.011 · Cited by 382
Self-citationKanadia, R., Shin, J., Yuan, Y., Beattie, S. G., Wheeler, T. M., Thornton, C. A., & Swanson, M. S. (2006) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0604970103 · Cited by 372
Self-citationThe neurogenetics of alternative splicing
Vuong, C. K., Black, D. L., & Zheng, S. (2016) · Nature Reviews Neuroscience · doi:10.1038/nrn.2016.27 · Cited by 340
Meola, G., & Cardani, R. (2014) · Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease · doi:10.1016/j.bbadis.2014.05.019 · Cited by 347
“While myopathy and myotonia associated with CLCN1 splicing alteration were detected in one line [180], the other line appeared to be overtly normal [100].”
BackgroundInfluentialFratta, P., Mizielinska, S., Nicoll, A. J., Zloh, M., Fisher, E., Parkinson, G. N., & Isaacs, A. M. (2012) · Scientific Reports · doi:10.1038/srep01016 · Cited by 345
Du, H., Cline, M. S., Osborne, R. J., Tuttle, D. L., Clark, T. A., Donohue, J. P., Hall, M. P., Shiue, L., Swanson, M. S., Thornton, C. A., et al. (2010) · Nature Structural & Molecular Biology · doi:10.1038/nsmb.1720 · Cited by 332
“Among these, the contribution of splicing perturbations is most clear given the physiological relevance of several splicing alterations that occur when CUG exp RNA is expresse”
Self-citationCharizanis, K., Lee, K.-Y., Batra, R., Goodwin, M., Zhang, C., Yuan, Y., Shiue, L., Cline, M., Scotti, M. M., Xia, G., et al. (2012) · Neuron · doi:10.1016/j.neuron.2012.05.029 · Cited by 346
“While >90% of human multiexon genes produce alternatively spliced transcripts, the complex network of dynamic interactions between multiple cell types that characterizes the central nervous system (CNS) suggests that alternative splicing regulation is particularly critical for the developing brain (Li et al., 2007; Li…”
BackgroundResultInfluentialSelf-citationPathogenic mechanisms of myotonic dystrophy
Lee, J. E., & Cooper, T. A. (2009) · Biochemical Society Transactions · doi:10.1042/bst0371281 · Cited by 321
Batra, R., Charizanis, K., Manchanda, M., Mohan, A., Li, M., Finn, D. J., Goodwin, M., Zhang, C., Sobczak, K., Thornton, C. A., et al. (2014) · Molecular Cell · doi:10.1016/j.molcel.2014.08.027 · Cited by 292
“Immunofluorescence of transverse sections of 4- month-old FVB quadriceps showed a diffuse nucleoplasmic localization pattern for Mbnl1 in WT FVB while Mbnl1 relocalized into nuclear CUGexp foci in HSALR muscle (Figure 4B) as described previously (Lin et al., 2006).”
MethodSelf-citationMisregulation of miR-1 processing is associated with heart defects in myotonic dystrophy
Rau, F., Freyermuth, F., Fugier, C., Villemin, J.-P., Fischer, M., Jost, B., Dembélé, D., Gourdon, G., Nicole, A., Duboc, D., et al. (2011) · Nature Structural & Molecular Biology · doi:10.1038/nsmb.2067 · Cited by 300
“MBNL1 and CUGBP1 are splicing regulators, and their alterations in people with myotonic dystrophy result in misregulation of the alternative splicing of several pre-mRNA”
BackgroundRNA Gain-of-Function in Spinocerebellar Ataxia Type 8
Daughters, R. S., Tuttle, D. L., Gao, W., Ikeda, Y., Moseley, M. L., Ebner, T. J., Swanson, M. S., & Ranum, L. P. W. (2009) · PLoS Genetics · doi:10.1371/journal.pgen.1000600 · Cited by 278
“PLoS Genetics | www.plosgenetics.org 2 August 2009 | Volume 5 | Issue 8 | e1000600 PLoS Genetics | www.plosgenetics.org 3 August 2009 | Volume 5 | Issue 8 | e1000600 MBNL1 activity in DM1, we tested the hypothesis that RNA gainof-function effects in SCA8 contribute to the motor deficits in SCA8 BAC-EXP mice via Mbnl1…”
BackgroundResultInfluentialSelf-citationSplicing biomarkers of disease severity in myotonic dystrophy
Nakamori, M., Sobczak, K., Puwanant, A., Welle, S., Eichinger, K. J., Pandya, S., Dekdebrun, J., Heatwole, C. R., McDermott, M., Chen, T., et al. (2013) · Annals of Neurology · doi:10.1002/ana.23992 · Cited by 259
“We also compared 5 splice events regulated by MBNL1 but not CELF1 (CLCN1, TTN, MBNL1 exon 7, MBNL2 exon 7, and PDLIM3 exon 5).(18,26,34) CLCN1 splicing was affected in nearly all subjects, whereas MBNL1 and MBNL2 mis-splicing were mainly present in the severely affected subjects (see Supplementary Fig 9B).”
BackgroundMethodResultInfluentialSelf-citationPentamidine reverses the splicing defects associated with myotonic dystrophy
Warf, M. B., Nakamori, M., Matthys, C. M., Thornton, C. A., & Berglund, J. A. (2009) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0903234106 · Cited by 265
“RNA extraction and cDNA preparation were performed as described previously (49).”
MethodSelf-citationTriplet-repeat oligonucleotide-mediated reversal of RNA toxicity in myotonic dystrophy
Mulders, S. A. M., van den Broek, W. J. A. A., Wheeler, T. M., Croes, H. J. E., van Kuik‐Romeijn, P., de Kimpe, S. J., Furling, D., Platenburg, G. J., Gourdon, G., Thornton, C. A., et al. (2009) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0905780106 · Cited by 257
“Many embryonic splice modes in skeletal muscle observed in DM1 patients are replicated in HSALR mice (16)—in contrast to DM500 mice, which display hardly any DM1-typical splice modes in skeletal muscle and also RNP foci much less overtly (21).”
BackgroundSelf-citationWheeler, T. M., Lueck, J. D., Swanson, M. S., Dirksen, R. T., & Thornton, C. A. (2007) · Journal of Clinical Investigation · doi:10.1172/jci33355 · Cited by 271
“Previously we showed that homozygous deletion of Mbnl1 exon 3 in mice (Mbnl1ΔE3/ΔE3) resulted in loss of Mbnl1 protein from muscle, spliceopathy similar to that in DM1 patients and HSALR mice, reduction of ClC-1 expression and activity, and myotonia (4, 7, 10).”
BackgroundMethodInfluentialSelf-citationCellular and molecular mechanisms underlying muscular dystrophy
Rahimov, F., & Kunkel, L. M. (2013) · The Journal of Cell Biology · doi:10.1083/jcb.201212142 · Cited by 252
Cellular toxicity of expanded RNA repeats: focus on RNA foci
Wojciechowska, M., & Krzyżosiak, W. J. (2011) · Human Molecular Genetics · doi:10.1093/hmg/ddr299 · Cited by 244
“Experimental evidence has revealed the presence of MBNL-positive CUG and CCUG RNA foci in biopsy tissues from skeletal and smooth muscles and in derived cultured cells (12, 14, 20, 30, 36, 41, 45), as well as in cardiac (29) and neuronal cells (13, 19) (Table S1).”
BackgroundCerebral involvement in myotonic dystrophies
Meola, G., & Sansone, V. (2007) · Muscle & Nerve · doi:10.1002/mus.20800 · Cited by 229
MBNL proteins and their target RNAs, interaction and splicing regulation
Konieczny, P., Stępniak-Konieczna, E., & Sobczak, K. (2014) · Nucleic Acids Research · doi:10.1093/nar/gku767 · Cited by 228
“MBNL1 variants with exons 5 and 7 occur mainly in early differentiation stages and in adult DM tissues [Figure 2A, (16,44)].”
BackgroundOsborne, R. J., & Thornton, C. A. (2006) · Human Molecular Genetics · doi:10.1093/hmg/ddl181 · Cited by 213
“First, it does not reduce the general fidelity of RNA processing or weaken the recognition of constitutive exons (14,33).”
BackgroundInfluentialSelf-citationMuscleblind-like 1 interacts with RNA hairpins in splicing target and pathogenic RNAs
Yuan, Y., Compton, S. A., Sobczak, K., Stenberg, M. G., Thornton, C. A., Griffith, J. D., & Swanson, M. S. (2007) · Nucleic Acids Research · doi:10.1093/nar/gkm601 · Cited by 210
“Loss of MBNL1 function by sequestration correlates with the inhibition of alternative splicing regulation for a specific set of developmentally regulated exons that are misspliced in DM tissues (8,15,20, 36 ).”
BackgroundSelf-citationRegulation of alternative splicing by the core spliceosomal machineryPreprint
Saltzman, A. L., Pan, Q., & Blencowe, B. J. (2011) · Genes & Development · doi:10.1101/gad.2004811 · Cited by 209
“For example, in addition to several reported examples of feedback regulation of splicing components and other RNA-binding proteins (for review, see Lareau et al. 2007a; McGlincy and Smith 2008), cross-regulation through AS-NMD has been found to occur between gene family members and paralogs of auxiliary splicing regul…”
BackgroundFreyermuth, F., Rau, F., Kokunai, Y., Linke, T., Sellier, C., Nakamori, M., Kino, Y., Arandel, L., Jollet, A., Thibault-Carpentier, C., et al. (2016) · Nature Communications · doi:10.1038/ncomms11067 · Cited by 206
“These results are consistent with previous studies where alternative splicing changes in DM resume a MBNL-dependent fetal splicing pattern that persist in adult tissues 26,37 .”
InfluentialSelf-citationThe Unstable Repeats—Three Evolving Faces of Neurological Disease
Nelson, D. L., Orr, H. T., & Warren, S. T. (2013) · Neuron · doi:10.1016/j.neuron.2013.02.022 · Cited by 207
“The discovery that DM2, a very similar autosomal dominant human myotonic dystrophy, resulted from a tetranucleotide (CCTG) repeat expansion in an intronic location of a separate gene (CNBP) (Liquori et al., 2001), added strong support to the toxic gain of function hypothesis, although there remain aspects of the DM1 p…”
Neuronal regulation of pre-mRNA splicing by polypyrimidine tract binding proteins, PTBP1 and PTBP2
Keppetipola, N., Sharma, S., Li, Q., & Black, D. L. (2012) · Critical Reviews in Biochemistry and Molecular Biology · doi:10.3109/10409238.2012.691456 · Cited by 201
“This program is affected by both loss of splicing regulators seen in myoblasts, such as PTB and PTBP2, and the expression of new splicing regulators specific to mature muscle (Charlet et al., 2002; Ladd et al., 2005; Lin et al., 2006; Kalsotra et al., 2008).”
BackgroundWang, G., Kearney, D. L., Biasi, M. D., Taffet, G. E., & Cooper, T. A. (2007) · Journal of Clinical Investigation · doi:10.1172/jci32308 · Cited by 193
“CUGBP1 and CUGBP2 proteins are normally downregulated during heart development to barely detectable levels in adult tissues (5, 24).”
BackgroundCompound loss of muscleblind‐like function in myotonic dystrophy
Lee, K., Li, M., Manchanda, M., Batra, R., Charizanis, K., Mohan, A., Warren, S., Chamberlain, C. M., Finn, D., Hong, H., et al. (2013) · EMBO Molecular Medicine · doi:10.1002/emmm.201303275 · Cited by 193
“While the function of Mbnl2 exon 8 is unknown, Mbnl2 exon 6 (54 nt) is homologous to Mbnl1 exon 7 that may encode a nuclear localization sequence (Lin et al, 2006).”
Self-citationAntagonistic regulation of mRNA expression and splicing by CELF and MBNL proteinsPreprint
Wang, E. T., Ward, A. J., Cherone, J. M., Giudice, J., Wang, T. T., Treacy, D. J., Lambert, N. J., Freese, P., Saxena, T., Cooper, T. A., et al. (2015) · Genome Research · doi:10.1101/gr.184390.114 · Cited by 190
“mRNA levels of Mbnl1 (up 15% in heart, down 10% in muscle) and Mbnl2 (up 9% in heart, down 12% in muscle) by RNA-seq RPKM and did not change inclusion of Mbnl1 exon 5, which can regulate nuclear-cytoplasmic distribution of MBNL1 (Supplemental Fig. S1D,E; Lin et al. 2006).”
Triplet repeat RNA structure and its role as pathogenic agent and therapeutic target
Krzyżosiak, W. J., Sobczak, K., Wojciechowska, M., Fiszer, A., Mykowska, A., & Kozłowski, P. (2011) · Nucleic Acids Research · doi:10.1093/nar/gkr729 · Cited by 191
“Studies have shown that CUGBP1 does not co-localize with mutant transcripts in DM1 cells (99,100).”
BackgroundGareiss, P. C., Sobczak, K., McNaughton, B. R., Palde, P. B., Thornton, C. A., & Miller, B. L. (2008) · Journal of the American Chemical Society · doi:10.1021/ja804398y · Cited by 187
Self-citationReversible model of RNA toxicity and cardiac conduction defects in myotonic dystrophy
Mahadevan, M. S., Yadava, R. S., Yu, Q., et al. (2006) · Nature Genetics · doi:10.1038/ng1857 · Cited by 185
“We also identified another line (5-313) with similar abnormalities.”
Myotonic dystrophy: RNA-mediated muscle disease
Wheeler, T. M., & Thornton, C. A. (2007) · Current Opinion in Neurology · doi:10.1097/wco.0b013e3282ef6064 · Cited by 180
Self-citationTang, Z. Z., Yarotskyy, V., Wei, L., Sobczak, K., Nakamori, M., Eichinger, K. J., Moxley, R. T., Dirksen, R. T., & Thornton, C. A. (2011) · Human Molecular Genetics · doi:10.1093/hmg/ddr568 · Cited by 181
“For example, in DM1, the inclusion of CLCN1 exon 7a (E7a), an exon normally repressed by MBNL1, causes a frameshift and loss of chloride channel function.”
BackgroundInfluentialSelf-citationWarf, M. B., & Berglund, J. A. (2007) · RNA · doi:10.1261/rna.610607 · Cited by 178
Orengo, J. P., Chambon, P., METZGER, D., Mosier, D. R., Snipes, G. J., & Cooper, T. A. (2008) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0708519105 · Cited by 178
“Both proteins normally regulate alternative splicing of exons that are misregulated in DM1 (7, 24).”
BackgroundCUGBP1 and MBNL1 preferentially bind to 3′ UTRs and facilitate mRNA decay
Masuda, A., Andersen, H. S., Doktor, T. K., Okamoto, T., Ito, M., Andresen, B. S., & Ohno, K. (2012) · Scientific Reports · doi:10.1038/srep00209 · Cited by 174
“The expanded CUG repeats in the DMPK mRNA bind to and sequestrate MBNL1 in discrete nuclear foci, which results in depletion of functional MBNL”
BackgroundTranscriptional and post-transcriptional impact of toxic RNA in myotonic dystrophy
Osborne, R. J., Lin, X., Welle, S. L., Sobczak, K., O'Rourke, J. R., Swanson, M. S., & Thornton, C. A. (2009) · Human Molecular Genetics · doi:10.1093/hmg/ddp058 · Cited by 183
“Intriguingly, the gene most highly upregulated in DM1 models encodes sarcolipin, a modulator of Serca1 function.”
BackgroundInfluentialSelf-citationTeplova, M., & Patel, D. J. (2008) · Nature Structural & Molecular Biology · doi:10.1038/nsmb.1519 · Cited by 170
“Postnatal activation of MBNL proteins leads to repression of fetal splicing patterns in numerous terminal muscle-differentiation transcripts and to the expression of adult protein isoform”
BackgroundMechanisms of RNA-induced toxicity in CAG repeat disorders
Nalavade, R., Griesche, N., Ryan, D. P., Hildebrand, S., & Krauß, S. (2013) · Cell Death and Disease · doi:10.1038/cddis.2013.276 · Cited by 175
“Aberrant changes in the splicing patterns of several mRNAs have been observed in DM1 and may be due to a loss -of-function mechanism of the MBNL1 protein because of its sequestration into nuclear foci.(40,41) This hypothesis has been further backed by the observation that MBNL1 knockout mice exhibit characteristic mal…”
BackgroundRNA toxicity in non‐coding repeat expansion disorders
Swinnen, B., Robberecht, W., & Bosch, L. V. D. (2019) · The EMBO Journal · doi:10.15252/embj.2018101112 · Cited by 161
“Essentially, the CCUG repeat RNA leads to an MBNL-CUGBP1 imbalance (Salisbury et al, 2009; Jones et al, 2011), making RNA toxicity the prevailing mechanism.”
InfluentialDaguenet, É., Dujardin, G., & Valcárcel, J. (2015) · EMBO Reports · doi:10.15252/embr.201541116 · Cited by 159
“On the one hand, the repeats, which accumulate in nuclear foci, are bound by and sequester MBNL1, a regulator of AS important for cell differentiation [126].”
Targeting RNA to treat neuromuscular disease
Muntoni, F., & Wood, M. J. A. (2011) · Nature Reviews Drug Discovery · doi:10.1038/nrd3459 · Cited by 156
Global regulation of alternative splicing during myogenic differentiation
Bland, C. S., Wang, E. T., Vu, A. Q., David, M. P., Castle, J. C., Johnson, J. M., Burge, C. B., & Cooper, T. A. (2010) · Nucleic Acids Research · doi:10.1093/nar/gkq614 · Cited by 155
“Furthermore, the well characterized role that MBNL family members play in the pathogenesis of myotonic dystrophy suggest they are important for normal muscle development (29,61).”
BackgroundHuntington's disease–like 2 is associated with CUG repeat‐containing RNA foci
Rudnicki, D. D., Holmes, S. E., Lin, M. W., Thornton, C. A., Ross, C. A., & Margolis, R. L. (2007) · Annals of Neurology · doi:10.1002/ana.21081 · Cited by 153
“MBNL1 is known to regulate the splicing of a large number of primary transcripts.(21) Within DM1 brain, MBNL1 is detectable in RNA foci, and diffuse nuclear MBNL1 appears to be depleted.”
BackgroundSelf-citationVenables, J. P., Lapasset, L., Gadéa, G., Fort, P., Klinck, R., Irimia, M., Vignal, E., Thibault, P., Prinos, P., Chabot, B., et al. (2013) · Nature Communications · doi:10.1038/ncomms3480 · Cited by 153
Koshelev, M., Sarma, S., Price, R. E., Wehrens, X. H. T., & Cooper, T. A. (2010) · Human Molecular Genetics · doi:10.1093/hmg/ddp570 · Cited by 151
There has been an awakening: Emerging mechanisms of C9orf72 mutations in FTD/ALS
Gitler, A. D., & Tsuiji, H. (2016) · Brain Research · doi:10.1016/j.brainres.2016.04.004 · Cited by 155
Roles for RNA-binding proteins in development and disease
Brinegar, A. E., & Cooper, T. A. (2016) · Brain Research · doi:10.1016/j.brainres.2016.02.050 · Cited by 153
“CELF and cytoplasmic MBNL protein levels are high in embryonic mouse skeletal muscle and CELF protein levels decrease while MBNL localizes to the nucleus during postnatal development (Kalsotra et al., 2008; Lin et al., 2006).”
CUGBP1 overexpression in mouse skeletal muscle reproduces features of myotonic dystrophy type 1
Ward, A. J., Rimer, M., Killian, J. M., Dowling, J. J., & Cooper, T. A. (2010) · Human Molecular Genetics · doi:10.1093/hmg/ddq277 · Cited by 146
“To determine whether MDAFrtTA/TRECUGBP1 (+dox, 2 weeks) mouse muscle recapitulated the misregulation of alternative splicing observed in DM1, we analyzed 19 alternative splicing events previously demonstrated to be misregulated in DM1 patient skeletal muscle (20,21,24,31,32).”
BackgroundParkesh, R., Childs‐Disney, J. L., Nakamori, M., Kumar, A., Wang, E. T., Wang, T., Hoskins, J. W., Tran, T. A., Housman, D. E., Thornton, C. A., et al. (2012) · Journal of the American Chemical Society · doi:10.1021/ja210088v · Cited by 144
Self-citationMolecular networks underlying myofibroblast fate and fibrosis
Stempien‐Otero, A., Kim, D., & Davis, J. (2016) · Journal of Molecular and Cellular Cardiology · doi:10.1016/j.yjmcc.2016.05.002 · Cited by 143
“When MBNL1 proteins are functionally sequestered from their normal RNA targets inappropriate maturation of gene products ensue resulting in myotonic dystrophy [121, 122], blocking cardiac myocyte maturation [123], or inhibition of embryonic stem cell differentiation [124].”
BackgroundFautsch, M. P., Wieben, E. D., Baratz, K. H., Bhattacharyya, N., Sadan, A. N., Hafford‐Tear, N. J., Tuft, S. J., & Davidson, A. E. (2020) · Progress in Retinal and Eye Research · doi:10.1016/j.preteyeres.2020.100883 · Cited by 148
“…amyotrophic lateral sclerosis and frontotemporal dementia (C9ORF72 ALS/FTD), and myotonic dystrophy type 1 (DM1) and type 2 (DM2) (Brook et al., 1992; DeJesus-Hernandez et al., 2011; Group, 1993; Kremer et al., 1991; Liquori et al., 2001; Orr and Zoghbi, 2007; Paulson, 2018; Renton et al., 2011).”
An Overview of Alternative Splicing Defects Implicated in Myotonic Dystrophy Type I
López‐Martínez, A., Soblechero‐Martín, P., Ovejero, L. D. L. P., Nogales‐Gadea, G., & Arechavala‐Gomeza, V. (2020) · Genes · doi:10.3390/genes11091109 · Cited by 143
“Nevertheless, this transcript excluding exon 12 has also been described in normal skeletal muscle samples, although at a different rate than in DM1 [52,86].”
BackgroundInfluentialEkström, A., Hakenäs‐Plate, L., Samuelsson, L., Tulinius, M., & Wentz, E. (2008) · American Journal of Medical Genetics Part B: Neuropsychiatric Genetics · doi:10.1002/ajmg.b.30698 · Cited by 136
“…into RNA CUG expansions that accumulate in nuclear foci, alter the activity of RNA-binding proteins and disrupt the splicing of pre-mRNA with abnormal function of different target genes [Mahadevan et al., 1992; Mankodi et al., 2000; Kanadia et al., 2003; Ho et al., 2005; Lin et al., 2006].”
BackgroundTreating pediatric neuromuscular disorders: The future is now
Dowling, J. J., Gonorazky, H. D., Cohn, R. D., & Campbell, C. (2017) · American Journal of Medical Genetics Part A · doi:10.1002/ajmg.a.38418 · Cited by 152
Wilburn, B., Rudnicki, D. D., Zhao, J., Weitz, T. M., Cheng, Y., Gu, X., Greiner, E. R., Park, C. S., Wang, N., Sopher, B. L., et al. (2011) · Neuron · doi:10.1016/j.neuron.2011.03.021 · Cited by 129
“…used to stain NIs in HDL2 models: 3B5H10 (1:1000; Sigma, St. Louis, MO), 1C2 (1:3000; Chemicon, Billerica, MA), CBP (1:3000; A-22 & sc-583, Santa Cruz, Santa Cruz, CA), ubiquitin (1:1000; DakoCytomation, Carpinteria, CA), 3B5H10 (1:2000), MBNL1 antibody (A2764, 1:10000 dilution; Lin et al., 2006).”
Thomas, J. D., Polaski, J. T., Feng, Q., Neef, E. D., Hoppe, E. R., McSharry, M. V., Pangallo, J., Gabel, A. M., Belleville, A. E., Watson, J., et al. (2020) · Nature Genetics · doi:10.1038/s41588-019-0555-z · Cited by 139
“1j,k), as expected 12,23,24 .”
Precise small-molecule cleavage of an r(CUG) repeat expansion in a myotonic dystrophy mouse model
Angelbello, A. J., Rzuczek, S. G., McKee, K., Chen, J. L., Olafson, H. R., Cameron, M. D., Moss, W. N., Wang, E. T., & Disney, M. D. (2019) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1901484116 · Cited by 128
“Thus, MBNL1 exon 5 is dysregulated in DM1-affected cells (26), manifesting as increased exon inclusion in DM1 myotubes (∼50% inclusion) compared with WT (∼15% inclusion).”
BackgroundHuguet-Lachon, A., Medja, F., Nicole, A., Vignaud, A., Guiraud-Dogan, C., Ferry, A., Decostre, V., Hogrel, J., Metzger, F., Hoeflich, A., et al. (2012) · PLoS Genetics · doi:10.1371/journal.pgen.1003043 · Cited by 122
“Mbnl1 ex 5 [53] Forward GCTGCCCAATACCAGGTCAAC m-Ttn ex5 [53] Forward GTGTGAGTCGCTCCAGAA”
BackgroundInfluentialInsulin Receptor Isoforms in Cancer
Vella, V., Milluzzo, A., Scalisi, N. M., Vigneri, P. G., & Sciacca, L. (2018) · International Journal of Molecular Sciences · doi:10.3390/ijms19113615 · Cited by 120
Short Tandem Repeat Expansions and RNA-Mediated Pathogenesis in Myotonic Dystrophy
Sznajder, Ł. J., & Swanson, M. S. (2019) · International Journal of Molecular Sciences · doi:10.3390/ijms20133365 · Cited by 120
“It is unclear if CELF1 is upregulated in DM2 [79,117,120].”
BackgroundSelf-citationRavel‐Chapuis, A., Bélanger, G., Yadava, R. S., Mahadevan, M. S., DesGroseillers, L., Côté, J., & Jasmin, B. J. (2012) · The Journal of Cell Biology · doi:10.1083/jcb.201108113 · Cited by 116
Wagner, S. D., Struck, A. J., Gupta, R., Farnsworth, D. R., Mahady, A. E., Eichinger, K. J., Thornton, C. A., Wang, E. T., & Berglund, J. A. (2016) · PLoS Genetics · doi:10.1371/journal.pgen.1006316 · Cited by 117
Self-citationOverexpression of microRNA-206 in the skeletal muscle from myotonic dystrophy type 1 patients
Gambardella, S., Rinaldi, F., Lepore, S. M., Viola, A., Loro, E., Angelini, C. I., Vergani, L., Novelli, G., & Botta, A. (2010) · Journal of Translational Medicine · doi:10.1186/1479-5876-8-48 · Cited by 113
“The expanded DMPK mRNA play a trans-dominant effect on RNA metabolism through its binding to the Muscleblind-like 1 (MBNL1) splicing regulator, leading to abnormal alternative splicing for a set of genes mainly expressed in skeletal muscle and heart [5,6].”
BackgroundCongenital and childhood myotonic dystrophy: Current aspects of disease and future directions
Ho, G. (2015) · World Journal of Clinical Pediatrics · doi:10.5409/wjcp.v4.i4.66 · Cited by 118
Klein, A. F., Varela, M. A., Arandel, L., Holland, A., Naouar, N., Arzumanov, A. A., Seoane, D., Revillod, L., Bassez, G., Ferry, A., et al. (2019) · Journal of Clinical Investigation · doi:10.1172/jci128205 · Cited by 113
“The skeletal muscle–specific expression of CUGexp RNAs in HSA-LR mice leads to the formation of ribonuclear foci that sequester MBNL1 proteins, resulting in splicing defects and myotonia, as found in DM1 patients (11, 27).”
RNA splicing: disease and therapy
Douglas, A. G. L., & Wood, M. J. A. (2011) · Briefings in Functional Genomics · doi:10.1093/bfgp/elr020 · Cited by 117
Genetic and Chemical Modifiers of a CUG Toxicity Model in Drosophila
García-López, A., Monferrer, L., García-Alcover, I., et al. (2008) · PLoS ONE · doi:10.1371/journal.pone.0001595 · Cited by 112
“Expectation was that flies expressing toxic RNA would show splice abnormalities typical of mbl loss-offunction [10].”
BackgroundResultInfluentialNovel transcriptional profile in wrist muscles from cerebral palsy patients
Smith, L., Pontén, E., Hedström, Y., Ward, S. R., Chambers, H. G., Subramaniam, S., & Lieber, R. L. (2009) · BMC Medical Genomics · doi:10.1186/1755-8794-2-44 · Cited by 106
MBNL and CELF proteins regulate alternative splicing of the skeletal muscle chloride channel CLCN1
Kino, Y., Washizu, C., Oma, Y., et al. (2009) · Nucleic Acids Research · doi:10.1093/nar/gkp681 · Cited by 104
“Indeed, exon 7A of Clcn1 is regulated through muscle development and is preferentially included in neonatal muscle but not in adult muscle (16,47).”
BackgroundESRP2 controls an adult splicing programme in hepatocytes to support postnatal liver maturation
Bhate, A., Parker, D. J., Bebee, T. W., Ahn, J., Arif, W., Rashan, E. H., Chorghade, S., Chau, A., Lee, J.-H., Anakk, S., et al. (2015) · Nature Communications · doi:10.1038/ncomms9768 · Cited by 103
Targeting Toxic RNAs that Cause Myotonic Dystrophy Type 1 (DM1) with a Bisamidinium Inhibitor
Wong, C., Nguyen, L., Peh, J., Luu, L. M., Sanchez, J. S., Richardson, S. L., Tuccinardi, T., Tsoi, H., Chan, W. Y., Chan, H. Y. E., et al. (2014) · Journal of the American Chemical Society · doi:10.1021/ja5012146 · Cited by 104
Antisense Therapy for a Common Corneal Dystrophy Ameliorates TCF4 Repeat Expansion-Mediated Toxicity
Zarouchlioti, C., Sanchez-Pintado, B., Hafford‐Tear, N. J., Klein, P., Lišková, P., Dulla, K., Semo, M., Vugler, A., Muthusamy, K., Ďuďáková, Ľ., et al. (2018) · The American Journal of Human Genetics · doi:10.1016/j.ajhg.2018.02.010 · Cited by 101
Brain pathology in myotonic dystrophy: when tauopathy meets spliceopathy and RNAopathy
Caillet‐Boudin, M., Fernández-Gómez, F.-J., Tran, H., Dhaenens, C., Buée, L., & Sergeant, N. (2014) · Frontiers in Molecular Neuroscience · doi:10.3389/fnmol.2013.00057 · Cited by 107
Molecular mechanisms responsible for aberrant splicing of SERCA1 in myotonic dystrophy type 1
Hino, S., Kondo, S., Sekiya, H., Saito, A., Kanemoto, S., Murakami, T., Chihara, K., Aoki, Y., Nakamori, M., Takahashi, M. P., et al. (2007) · Human Molecular Genetics · doi:10.1093/hmg/ddm239 · Cited by 99
“The alignment of the nucleotide sequence in intron 22 and the location of MBNL1-binding motifs are shown in Figure 1D. Lin et al. ( 27 ) previously reported the splicing misregulation of the SERCA1 exon 22 in MBNL1 knockout mice.”
BackgroundImmortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds
Arandel, L., Micaela, P.-E., Matłoka, M., Audrey, B., Damily, D. D. D., Naouar, N., Rau, F., Jollet, A., Edom‐Vovard, F., Mamchaoui, K., et al. (2017) · Disease Models & Mechanisms · doi:10.1242/dmm.027367 · Cited by 98
“Our results are in accordance with an increasing body of evidence, indicating that functional loss of MBNL1 due to its sequestration into nuclear RNA aggregates results in misregulation of alternative splicing (Cardani et al., 2006; Lin et al., 2006; Mankodi et al., 2001; Milleret al., 2000).”
Disrupted prenatal RNA processing and myogenesis in congenital myotonic dystrophyPreprint
Thomas, J. D., Sznajder, Ł. J., Bardhi, O., Aslam, F. N., Anastasiadis, Z. P., Scotti, M. M., Nishino, I., Nakamori, M., Wang, E. T., & Swanson, M. S. (2017) · Genes & Development · doi:10.1101/gad.300590.117 · Cited by 103
“To date, splicing transitions for DM-relevant transcripts have been described largely as postnatal phenomena (Lin et al. 2006; Brinegar et al. 2017), and, while disruption of these events affects muscle function (Mankodi et al. 2002) and maintenance (Rau et al. 2015), misregulation of postnatal…”
Self-citationMyotonic dystrophy mouse models: towards rational therapy development
Gomes-Pereira, M., Cooper, T. A., & Gourdon, G. (2011) · Trends in Molecular Medicine · doi:10.1016/j.molmed.2011.05.004 · Cited by 95
“Myopathy and myotonia associated with mild Clcn1 missplicing were detected in one line [62], but another independent Mbnl2-deficient mouse was overtly normal [10].”
BackgroundInfluentialMolecular mechanisms in DM1 — a focus on foci
Pettersson, O. J., Aagaard, L., Jensen, T. G., & Damgaard, C. K. (2015) · Nucleic Acids Research · doi:10.1093/nar/gkv029 · Cited by 95
García-López, A., Llamusí, B., Orzáez, M., Pérez‐Payá, E., & Artero, R. D. (2011) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1018213108 · Cited by 95
“Alternative splicing is severely misregulated in DM1 patients and in HSALR mice (11, 12).”
BackgroundKalsotra, A., Singh, R. K., Gurha, P., Ward, A. J., Creighton, C. J., & Cooper, T. A. (2014) · Cell Reports · doi:10.1016/j.celrep.2013.12.025 · Cited by 93
“Celf1 is downregulated during mouse postnatal heart and skeletal muscle development while Mbnl1 activity is upregulated, driving their target alternative splicing events to the adult patterns (Kalsotra et al., 2008; Lin et al., 2006).”
BackgroundDastidar, S., Ardui, S., Singh, K., Majumdar, D., Nair, N., Fu, Y., Reyon, D., Samara-Kuko, E., Gerli, M., Klein, A. F., et al. (2018) · Nucleic Acids Research · doi:10.1093/nar/gky548 · Cited by 104
“The exclusion of SERCA1 exon 22 consistently emerged as the dominant splicing pattern of SERCA1 in DM1 in contrast to the predominant inclusion of the SERCA1 exon 22 in wild-type cells (33,45,64).”
BackgroundRNA-targeted splice-correction therapy for neuromuscular disease
Wood, M. J. A., Gait, M. J., & Yin, H. (2010) · Brain · doi:10.1093/brain/awq002 · Cited by 93
“Together muscleblind-like 1 and CUG binding protein 1 tightly regulate the transition between the expression of embryonic and adult splice variants that occurs in post-natal skeletal muscle, and which is consequently disrupted in DM1 leading to disease (Lin et al., 2006).”
BackgroundRNA Interference Targeting CUG Repeats in a Mouse Model of Myotonic Dystrophy
Sobczak, K., Wheeler, T. M., Wang, W., & Thornton, C. A. (2012) · Molecular Therapy · doi:10.1038/mt.2012.222 · Cited by 95
Self-citationDavis, J., Salomonis, N., Ghearing, N., Lin, S. J., Kwong, J. Q., Mohan, A., Swanson, M. S., & Molkentin, J. D. (2015) · Nature Communications · doi:10.1038/ncomms10084 · Cited by 93
Self-citationWojtkowiak-Szlachcic, A., Taylor, K., Stępniak-Konieczna, E., Sznajder, Ł. J., Mykowska, A., Sroka, J., Thornton, C. A., & Sobczak, K. (2015) · Nucleic Acids Research · doi:10.1093/nar/gkv163 · Cited by 90
“Their functional imbalance leads to embryonic patterns of alternative splicing in adult DM1 tissues (7).”
BackgroundSelf-citationCerro-Herreros, E., Sabater-Arcis, M., Fernández‐Costa, J. M., Moreno, N., Pérez‐Alonso, M., Llamusí, B., & Artero, R. D. (2018) · Nature Communications · doi:10.1038/s41467-018-04892-4 · Cited by 89
RNA-binding proteins in microsatellite expansion disorders: Mediators of RNA toxicity
Echeverria, G. V., & Cooper, T. A. (2012) · Brain Research · doi:10.1016/j.brainres.2012.02.030 · Cited by 88
Targeting deregulated AMPK/mTORC1 pathways improves muscle function in myotonic dystrophy type I
Brockhoff, M., Rion, N., Chojnowska, K., Wiktorowicz, T., Eickhorst, C., Erne, B., Frank, S., Angelini, C. I., Furling, D., Rüegg, M. A., et al. (2017) · Journal of Clinical Investigation · doi:10.1172/jci89616 · Cited by 95
Metadata
- Authors
- Lin, X., Miller, J. W., Mankodi, A., Kanadia, R. N., Yuan, Y., Moxley, R. T., Swanson, M. S., & Thornton, C. A.
- Affiliations
- University of Rochester Medicine (US)
- University of Florida (US)
- Corresponding author
- Thornton, Charles A.
- Venue
- Human Molecular Genetics
- Publisher
- Oxford University Press (OUP)
- Published
- 2006-05-22
- Volume
- 15
- Issue
- 13
- Pages
- 2087-2097
- ISSN
- 0964-6906 (ISSN-L)
- 1460-2083
- OpenAlex
- W2140074138
- Semantic Scholar
- 1b600bfc756195b662624998312e8d206442a550
- Cited by
- 510
- References
- 35
- Citations by year
- 2026: 19 · 2025: 19 · 2024: 20 · 2023: 19 · 2022: 17 · 2021: 27 · 2020: 29 · 2019: 24 · 2018: 27 · 2017: 19 · 2016: 26 · 2015: 27 · 2014: 37 · 2013: 34 · 2012: 36
- FWCI
- 9.66
- Type
- journal article
- Language
- en
- Open access
- closed
- Locations
- Human Molecular Genetics (publishedVersion)
- PubMed (publishedVersion)
- Funders
- National Institutes of Health (n01ar002250-007)
- National Institute of Neurological Disorders and Stroke (NS-48843)
- National Institute of Arthritis and Musculoskeletal and Skin Diseases (AR-48143, R01AR049077, K24AR048143, R01AR046799, AR02250, R01AR046806, AR46806)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › RNA Research and Splicing
- Life Sciences › Neuroscience › Cellular and Molecular Neuroscience › Genetic Neurodegenerative Diseases
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Muscle Physiology and Disorders
- Keywords
- myotonic dystrophy, MBNL1, MBNL2, CUG repeat expansion, alternative splicing, nuclear foci, skeletal muscle development, myotonic dystrophy type 1, myotonic dystrophy type 2
- MeSH terms
- Animals, Cell Nucleus, Humans, Mice, Transgenic, Molecular Sequence Data, Myotonic Dystrophy, Time Factors, Immunoblotting, RNA-Binding Proteins, Alternative Splicing, Mice, Knockout, Muscle, Skeletal, Gene Expression Regulation, Developmental, Trinucleotide Repeat Expansion, Reverse Transcriptase Polymerase Chain Reaction, Mice
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
