Distribution and Content of Class 1 Integrons in Different Vibrio cholerae O-Serotype Strains Isolated in Thailand

Dalsgaard, Anders; Forslund, Anita; Serichantalergs, Oralak; Sandvang, Dorthe

doi:10.1128/aac.44.5.1315-1321.2000

Cited by 118Vibrio bacteria research studiesAntibiotic Resistance in BacteriaSalmonella and Campylobacter epidemiology

Distribution and Content of Class 1 Integrons in Different Vibrio cholerae O-Serotype Strains Isolated in Thailand

Open access

Dalsgaard, Anders, Forslund, Anita, Serichantalergs, Oralak, Sandvang, Dorthe·2000·Antimicrobial Agents and Chemotherapy

DOI 10.1128/aac.44.5.1315-1321.2000PMC PMC89861

Open this paper in CoChat — free account

Abstract

In this study, 176 clinical and environmental Vibrio cholerae strains of different O serotypes isolated in Thailand from 1982 to 1995 were selected and studied for the presence of class 1 integrons, a new group of genetic elements which carry antibiotic resistance genes. Using PCR and DNA sequencing, we found that 44 isolates contained class 1 integrons harboring the aadB , aadA2 , blaP1 , dfrA1 , and dfrA15 gene cassettes, which encode resistance to gentamicin, kanamycin, and tobramycin; streptomycin and spectinomycin; β-lactams; and trimethoprim, respectively. Each cassette array contained only a single antibiotic resistance gene. Although resistance genes in class 1 integrons were found in strains from the same epidemic, as well as in unrelated non-O1, non-O139 strains isolated from children with diarrhea, they were found to encode only some of the antibiotic resistance expressed by the strains. Serotype O139 strains did not contain class 1 integrons. However, the appearance and disappearance of the O139 serotype in the coastal city Samutsakorn in 1992 and 1993 were associated with the emergence of a distinct V. cholerae O1 strain which contained the aadA2 resistance gene cassette. A 150-kb self-transmissible plasmid found in three O1 strains isolated in 1982 contained the aadB gene cassette. Surprisingly, several strains harbored two integrons containing different cassettes. Thus, class 1 integrons containing various resistance gene cassettes are distributed among different V. cholerae O serotypes of mainly clinical origin in Thailand.

Integrity signals

Registry

Crossref · 10.1128/aac.44.5.1315-1321.2000

Cites

60 of 60 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

We couldn’t retrieve this paper’s full text, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

The aadA1 gene confers resistance against aminoglycosides, streptomycin, and spectinomycin.
“the aadA1 gene that confers resistance against aminoglycosides, streptomycin, and spectinomycin (4,5).”
From Class I Integrons and SXT Elements in El Tor Strains Isolated before and after 1992Vibrio choleraeO139 Outbreak, Calcutta, India (2003) · cites this paper as [5]
The ribotype of the pre-O139 O1 Calcutta strains examined in this study was identical to that of the Samutsakorn strains.
“The ribotype of the pre-O139, O1 Calcutta strains examined in this study was identical to that of the Samutsakorn strains (4,5,8).”
From Class I Integrons and SXT Elements in El Tor Strains Isolated before and after 1992Vibrio choleraeO139 Outbreak, Calcutta, India (2003) · cites this paper as [5]
Both pre- and post-O139 isolates in Dalsgaard et al. carried class I integrons with the aadA2 gene cassette.
“Both pre- and post-O139 isolates carried class I integrons with the aadA2 gene cassette.”
From Class I Integrons and SXT Elements in El Tor Strains Isolated before and after 1992Vibrio choleraeO139 Outbreak, Calcutta, India (2003) · cites this paper as [5]
Class I integrons have been detected in V. cholerae O1 strains isolated in Vietnam, Thailand, and Italy.
“Class I integrons have been detected in V. cholerae O1 strains isolated in Vietnam, Thailand, and Italy (4–6).”
From Class I Integrons and SXT Elements in El Tor Strains Isolated before and after 1992Vibrio choleraeO139 Outbreak, Calcutta, India (2003) · cites this paper as [5]
Both pre- and post-O139 O1 strains isolated in Calcutta probably could have moved to other countries and become established there.
“When the data presented in this paper are considered together with the information presented by others (4,5,8,10), it appears that both pre- and post-O139, O1 strains, isolated in Calcutta, probably could have moved to other countries and became established there.”
From Class I Integrons and SXT Elements in El Tor Strains Isolated before and after 1992Vibrio choleraeO139 Outbreak, Calcutta, India (2003) · cites this paper as [5]

Basic local alignment search tool
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990) · Journal of Molecular Biology · doi:10.1006/jmbi.1990.9999 · Cited by 98,669 · see citing works
Antibiotic Susceptibility Testing by a Standardized Single Disk Method
Bauer, A. W., Kirby, W. M. M., Sherris, J. C., & Turck, M. (1966) · American Journal of Clinical Pathology · doi:10.1093/ajcp/45.4_ts.493 · Cited by 18,523 · see citing works
Rapid procedure for detection and isolation of large and small plasmids
Kado, C. I., & Liu, S. T. (1981) · Journal of Bacteriology · doi:10.1128/jb.145.3.1365-1373.1981 · Cited by 2,802 · see citing works
PCR mapping of integrons reveals several novel combinations of resistance genes
Levesque, C. M., Piché, L., Larose, C., & Roy, P. H. (1995) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.39.1.185 · Cited by 1,015 · see citing works
A novel family of potentially mobile DNA elements encoding site‐specific gene‐integration functions: integrons
Stokes, H. W., & Hall, R. M. (1989) · Molecular Microbiology · doi:10.1111/j.1365-2958.1989.tb00153.x · Cited by 889 · see citing works
Mobile gene cassettes and integrons: capture and spread of genes by site‐specific recombination
Hall, R. M., & Collis, C. M. (1995) · Molecular Microbiology · doi:10.1111/j.1365-2958.1995.tb02368.x · Cited by 774 · see citing works
Gene cassettes: a new class of mobile element
Recchia, G. D., & Hall, R. M. (1995) · Microbiology · doi:10.1099/13500872-141-12-3015 · Cited by 668 · see citing works
Photonic detection of bacterial pathogens in living hosts
Contag, C. H., Contag, P. R., Mullins, J. I., Spilman, S. D., Stevenson, D. K., & Benaron, D. A. (1995) · Molecular Microbiology · doi:10.1111/j.1365-2958.1995.mmi_18040593.x · Cited by 652 · see citing works
Vibrio cholerae and cholera : molecular to global perspectives
Wachsmuth, K., Blake, P. A., & Olsvik, Ø. (1994) · ASM Press eBooks · Cited by 442 · see citing works
A new type of conjugative transposon encodes resistance to sulfamethoxazole, trimethoprim, and streptomycin in Vibrio cholerae O139
Waldor, M. K., Tschäpe, H., & Mekalanos, J. J. (1996) · Journal of Bacteriology · doi:10.1128/jb.178.14.4157-4165.1996 · Cited by 391 · see citing works
The 3' conserved segment of integrons contains a gene associated with multidrug resistance to antiseptics and disinfectants
Paulsen, I. T., Littlejohn, T. G., Rådström, P., Sundström, L., Sköld, O., Swedberg, G., & Skurray, R. A. (1993) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.37.4.761 · Cited by 320 · see citing works
Molecular Characterization of an Antibiotic Resistance Gene Cluster of Salmonella typhimurium DT104
Briggs, C. E., & Fratamico, P. M. (1999) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.43.4.846 · Cited by 316 · see citing works
Characterisation of integrons and antibiotic resistance genes in Danish multiresistantSalmonella entericaTyphimurium DT104
Sandvang, D., Aarestrup, F. M., & Jensen, L. B. (1998) · FEMS Microbiology Letters · doi:10.1111/j.1574-6968.1998.tb12887.x · Cited by 275 · see citing works
Self-citation
Site-specific recombination promotes linkage between trimethoprim- and sulfonamide resistance genes. Sequence characterization of dhfrV and sulI and a recombination active locus of Tn21
Sundström, L., Rådström, P., Swedberg, G., & Sköld, O. (1988) · Molecular and General Genetics MGG · doi:10.1007/bf00339581 · Cited by 242 · see citing works
Site‐specific insertion of gene cassettes into integrons
Collis, C. M., Grammaticopoulos, G., Briton, J., Stokes, H. W., & Hall, R. M. (1993) · Molecular Microbiology · doi:10.1111/j.1365-2958.1993.tb01667.x · Cited by 220 · see citing works
Site-specific deletion and rearrangement of integron insert genes catalyzed by the integron DNA integrase
Collis, C. M., & Hall, R. M. (1992) · Journal of Bacteriology · doi:10.1128/jb.174.5.1574-1585.1992 · Cited by 214 · see citing works
Integrons: Novel DNA elements which capture genes by site-specific recombination
Hall, R. M., & Stokes, H. W. (1993) · Genetica · doi:10.1007/bf01435034 · Cited by 209 · see citing works
Emergence of heterogeneous intermediate vancomycin resistance in Staphylococcus aureus isolates in the Dusseldorf area
Geisel, R. (1999) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/43.6.846 · Cited by 182 · see citing works
Extended serotyping scheme forVibrio cholerae
Shimada, T., Arakawa, E., Itoh, K., Okitsu, T., Matsushima, A., Yoshio, A. S. A. I., Yamai, S., Nakazato, T., Nair, G. B., Albert, M. J., et al. (1994) · Current Microbiology · doi:10.1007/bf01571061 · Cited by 177 · see citing works
Epidemic cholera in Ecuador: multidrug–resistance and transmission by water and seafood
Weber, J. T., Mintz, E. D., Cañizares, R., Semiglia, A., Gomez, I., Sempertegui, R., Dávila, A., Greene, K. D., Puhr, N. D., Cameron, D. N., et al. (1994) · Epidemiology and Infection · doi:10.1017/s0950268800057368 · Cited by 171 · see citing works
Glycopeptide susceptibility among Danish Enterococcus faecium and Enterococcus faecalis isolates of animal and human origin and PCR identification of genes within the VanA cluster
Aarestrup, F. M., Ahrens, P., Madsen, M., Pallesen, L., Poulsen, R. L., & Westh, H. (1996) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.40.8.1938 · Cited by 170 · see citing works
Nucleotide sequence of the AAD(2′) aminoglycoside adenylyltransferase determinantaadB. Evolutionary relationship of this region with those surroundingaadAin R538-1 anddhfrllin R388
Cameron, F. H., Obbink, D. J. G., Ackerman, V. P., & Hall, R. M. (1986) · Nucleic Acids Research · doi:10.1093/nar/14.21.8625 · Cited by 167 · see citing works
Molecular Analysis of Non-O1, Non-O139 Vibrio cholerae Associated with an Unusual Upsurge in the Incidence of Cholera-Like Disease in Calcutta, India
Sharma, C., Thungapathra, M., Ghosh, A. R., Mukhopadhyay, A. K., Basu, A., Mitra, R., Basu, I., Bhattacharya, S., Shimada, T., Ramamurthy, T., et al. (1998) · Journal of Clinical Microbiology · doi:10.1128/jcm.36.3.756-763.1998 · Cited by 154 · see citing works
Emergence of Multiply Antibiotic-Resistant Vibrio cholerae in Bangladesh
Glass, R. I., Huq, I., Alim, A. R. M. A., & Yunus, M. (1980) · The Journal of Infectious Diseases · doi:10.1093/infdis/142.6.939 · Cited by 139 · see citing works
Class 1 Integron-Borne Multiple-Antibiotic Resistance Carried by IncFI and IncL/M Plasmids in Salmonella enterica Serotype Typhimurium
Tosini, F., Visca, P., Luzzi, I., Dionisi, A. M., Pezzella, C., Petrucca, A., & Carattoli, A. (1998) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.42.12.3053 · Cited by 136 · see citing works
Characterization of Vibrio cgolerae non-O1 serogroups obtained from an outbreak of diarrhea in Lima, Peru
Dalsgaard, A., Albert, M. J., Taylor, D. N., Shimada, T., Meza, R. A., Serichantalergs, O., & Echeverria, P. D. (1995) · Journal of Clinical Microbiology · doi:10.1128/jcm.33.10.2715-2722.1995 · Cited by 117 · see citing works
Self-citation
Severe hepatitis in three AIDS patients treated with indinavir
Bräu, N., Leaf, H. L., Wieczorek, R. L., & Margolis, D. M. (1997) · The Lancet · doi:10.1016/s0140-6736(05)62700-6 · Cited by 111 · see citing works
The nucleotide sequence of the trimethoprim-resistant dihydrofolate reductase gene harbored by Tn7
Fling, M. E., & Richards, C. A. (1983) · Nucleic Acids Research · doi:10.1093/nar/11.15.5147 · Cited by 108 · see citing works
Epidemic of diarrhea caused by Vibrio cholerae non-O1 that produced heat-stable toxin among Khmers in a camp in Thailand
Bagchi, K., Echeverria, P. D., Arthur, J., Sethabutr, O., Serichantalergs, O., & Hoge, C. W. (1993) · Journal of Clinical Microbiology · doi:10.1128/jcm.31.5.1315-1317.1993 · Cited by 106 · see citing works
Self-citation
Molecular Epidemiology of Integron-Associated Antibiotic Resistance Genes in Clinical Isolates of Enterobacteriaceae
Sallen, B., Rajoharison, A., DESVARENNE, S., & Mabilat, C. (1995) · Microbial Drug Resistance · doi:10.1089/mdr.1995.1.195 · Cited by 105 · see citing works
Widespread occurrence of integrons causing multiple antibiotic resistance in bacteria
Jones, M. E., Peters, E. D. J., Weersink, A. J. L., Fluit, A. C., & Verhoef, J. (1997) · The Lancet · doi:10.1016/s0140-6736(05)62954-6 · Cited by 104 · see citing works
Antibiotic Resistance Conferred by a Conjugative Plasmid and a Class I Integron in Vibrio cholerae O1 El Tor Strains Isolated in Albania and Italy
Falbo, V., Carattoli, A., Tosini, F., Pezzella, C., Dionisi, A. M., & Luzzi, I. (1999) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.43.3.693 · Cited by 101 · see citing works
Temporal shifts in traits of Vibrio cholerae strains isolated from hospitalized patients in Calcutta: a 3-year (1993 to 1995) analysis
Mukhopadhyay, A. K., Garg, S., Mitra, R., Basu, A., Rajendran, K., Dutta, D., Bhattacharya, S., Shimada, T., Takeda, T., Takeda, Y., et al. (1996) · Journal of Clinical Microbiology · doi:10.1128/jcm.34.10.2537-2543.1996 · Cited by 95 · see citing works
Distribution of the antiseptic-resistance genesqacEandqacEΔ1in Gram-negative bacteria
Kazama, H., Hamashima, H., Sasatsu, M., & Arai, T. (1998) · FEMS Microbiology Letters · doi:10.1111/j.1574-6968.1998.tb12857.x · Cited by 80 · see citing works
A high proportion of Vibrio cholerae strains isolated from children with diarrhoea in Bangkok, Thailand are multiple antibiotic resistant and belong to heterogenous non-O1, non-O139 O-serotypes
Dalsgaard, A., Forslund, A., Bodhidatta, L., Serichantalergs, O., PITARANGSI, C., Pang, L. W., SHIMADA, T., & Echeverria, P. D. (1999) · Epidemiology and Infection · doi:10.1017/s0950268899002137 · Cited by 79 · see citing works
Self-citation
Characterisation of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104
Sandvang, D., Aarestrup, F. M., & Jensen, L. B. (2006) · FEMS Microbiology Letters · doi:10.1111/j.1574-6968.1997.tb12770.x · Cited by 76 · see citing works
Self-citation
Cholera in Vietnam: Changes in Genotypes and Emergence of Class I Integrons Containing Aminoglycoside Resistance Gene Cassettes in Vibrio cholerae O1 Strains Isolated from 1979 to 1996
Dalsgaard, A., Forslund, A., Tam, N. V., Vinh, D. X., & Cam, P. D. (1999) · Journal of Clinical Microbiology · doi:10.1128/jcm.37.3.734-741.1999 · Cited by 75 · see citing works
Self-citation
Prevalence of Vibrio cholerae and Salmonella in a major shrimp production area in Thailand
Dalsgaard, A., Huss, H. H., H‐Kittikun, A., & Larsen, J. L. (1995) · International Journal of Food Microbiology · doi:10.1016/0168-1605(94)00165-3 · Cited by 75 · see citing works
Self-citation
The dhfrI trimethoprim resistance gene of Tn7 can be found at specific sites in other genetic surroundings
Sundström, L., & Sköld, O. (1990) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.34.4.642 · Cited by 73 · see citing works
Correlation between aminoglycoside resistance profiles and DNA hybridization of clinical isolates
Shaw, K. J., Hare, R. S., Sabatelli, F., Rizzo, M. F., Cramer, C. A., Naples, L., Kocsi, S., MUNAYYER, H., Mann, P. A., & Miller, G. H. (1991) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.35.11.2253 · Cited by 72 · see citing works
Characterisation of recently emerged multiple antibiotic‐resistant Salmonella enterica serovar typhimurium DT104 and other multiresistant phage types from Danish pig herds
Baggesen, D. L., & Aarestrup, F. M. (1998) · Veterinary Record · doi:10.1136/vr.143.4.95 · Cited by 61 · see citing works
The Potential of Integrons and Connected Programmed Rearrangements for Mediating Horizontal Gene Transfer
Sundström, L. (1998) · Apmis · doi:10.1111/j.1600-0463.1998.tb05646.x · Cited by 61 · see citing works
Isolation and Identification ofVibrio choleraeO1 from Fecal Specimens
Kay, B. A., Bopp, C. A., & Wells, J. G. (2014) · ASM Press eBooks · doi:10.1128/9781555818364.ch1 · Cited by 60 · see citing works
Characterization of the 6'-N-aminoglycoside acetyltransferase gene aac(6')-Im [corrected] associated with a sulI-type integron
Hannecart-Pokorni, E., Depuydt, F., Wit, L. D., Bossuyt, E. V., Content, J., & Vanhoof, R. (1997) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.41.2.314 · Cited by 54 · see citing works
An Epidemic of Vibrio Cholerae el Tor Inaba Resistant to Several Antibiotics with a Conjugative Group C Plasmid Coding for Type II Dihydrofolate Reductase in Thailand
Tabtieng, R., Wattanasri, S., Echeverria, P. D., SERIWATANA, J., Bodhidatta, L., Chatkaeomorakot, A., & Rowe, B. (1989) · American Journal of Tropical Medicine and Hygiene · doi:10.4269/ajtmh.1989.41.680 · Cited by 47 · see citing works
Revised analysis of aadA2 gene of plasmid pSa
Bito, A., & Susani, M. (1994) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.38.5.1172 · Cited by 46 · see citing works
Biotype traits and antibiotic susceptibility ofVibrio choleraeserogroup O1 before, during and after the emergence of the O139 serogroup
Mukhopadhyay, A. K., Garg, S., Nair, G. B., Kar, S., Ghosh, R., Pajni, S., Ghosh, A. R., Shimada, T., Takeda, T., & Takeda, Y. (1995) · Epidemiology and Infection · doi:10.1017/s0950268800058581 · Cited by 41 · see citing works
Tn21-specific structures in gram-negative bacteria from clinical isolates
Zühlsdorf, M. T., & Wiedemann, B. (1992) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.36.9.1915 · Cited by 39 · see citing works
Restriction fragment length polymorphism of the Vibrio anguillarum serovar O1 virulence plasmid
Olsen, J. E., & Larsen, J. L. (1990) · Applied and Environmental Microbiology · doi:10.1128/aem.56.10.3130-3132.1990 · Cited by 38 · see citing works
Isolation and structure of a new integron that includes a streptomycin resistance gene from the R plasmid of Pseudomonas aeruginosa
Kazama, H., Kizu, K., Iwasaki, M., Hamashima, H., Sasatsu, M., & Arai, T. (1995) · FEMS Microbiology Letters · doi:10.1111/j.1574-6968.1995.tb07927.x · Cited by 38 · see citing works
The integron In1 in plasmid R46 includes two copies of the oxa2 gene cassette
Stokes, H. W., & Hall, R. M. (1992) · Plasmid · doi:10.1016/0147-619x(92)90054-e · Cited by 38 · see citing works
Rapid spread of the new clone of Vibrio cholerae O1 biotype El Tor in cholera endemic areas in India
Bag, P. K., Maiti, S., SHARMA, C., Ghosh, A. R., Basu, A., Mitra, R., Bhattacharya, S., NAKAMURA, S., Yamasaki, S., TAKEDA, Y., et al. (1998) · Epidemiology and Infection · doi:10.1017/s0950268898001423 · Cited by 32 · see citing works
Molecular characterization and antibiotic susceptibility ofVibrio choleraenon-O1
Dalsgaard, A., Serichantalergs, O., PITARANGSI, C., & Echeverria, P. D. (1995) · Epidemiology and Infection · doi:10.1017/s0950268800051906 · Cited by 30 · see citing works
Self-citation
Global surveillance of antibiotic sensitivity of Vibrio cholerae.
O'Grady, F., Lewis, M. J., & Pearson, N. J. (1976) · PubMed · Cited by 28 · see citing works
New Trimethoprim-Resistant Dihydrofolate Reductase Cassette, dfrXV , Inserted in a Class 1 Integron
Adrian, P. V., du Plessis, M., Klugman, K. P., & Amyes, S. G. B. (1998) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.42.9.2221 · Cited by 28 · see citing works
Emergence of multiple drug resistance in Vibrio cholerae 01 El Tor from Ecuador
Threlfall, E. J., Said, B., Rowe, B., & Dávalos-Pérez, A. (1993) · The Lancet · doi:10.1016/0140-6736(93)92156-n · Cited by 27 · see citing works
Phenotypic and molecular characterization of Vibrio cholerae O1 isolated in Samutsakorn, Thailand before, during and after the emergence of V. cholerae O139
Dalsgaard, A., Serichantalergs, O., Forslund, A., PITARANGSI, C., & Echeverria, P. D. (1998) · Epidemiology and Infection · doi:10.1017/s0950268898001125 · Cited by 23 · see citing works
Self-citation
Emergence of multiple drug-resistant Vibrio cholerae 01 in San Pedro Sula, Honduras
Palmer, C., Dubón, J. M., Ager, A. L., Shor‐Posner, G., & Baum, M. K. (1997) · The Lancet · doi:10.1016/s0140-6736(05)62699-2 · Cited by 19 · see citing works
Comparison of pulsed-field gel electrophoresis and ribotyping for subtyping ofVibrio choleraeO139 isolated in Thailand
Dalsgaard, A., Skov, M. N., Serichantalergs, O., & Echeverria, P. D. (1996) · Epidemiology and Infection · doi:10.1017/s0950268800001126 · Cited by 18 · see citing works
Self-citation
In vivo formation of a plasmid cointegrate expressing two incompatibility phenotypes
Taylor, D. E., Levine, J. G., & Bradley, D. E. (1981) · Plasmid · doi:10.1016/0147-619x(81)90001-9 · Cited by 18 · see citing works

Flagged first, then by citations

Sorted by citations

Antibiotic resistance genes in water environment
Zhang, X., Zhang, T., & Fang, H. H. P. (2009) · Applied Microbiology and Biotechnology · doi:10.1007/s00253-008-1829-z · Cited by 1,000 · see citing works
Antimicrobial resistance in developing countries. Part I: recent trends and current status
Okeke, I. N., Laxminarayan, R., Bhutta, Z. A., Duse, A. G., Jenkins, P., O'Brien, T. F., Pablos-Mendez, A., & Klugman, K. P. (2005) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(05)70189-4 · Cited by 851 · see citing works
Versatility of Aminoglycosides and Prospects for Their Future
Vakulenko, S. B., & Mobashery, S. (2003) · Clinical Microbiology Reviews · doi:10.1128/cmr.16.3.430-450.2003 · Cited by 641 · see citing works
Antibiotic use in shrimp farming and implications for environmental impacts and human health
Holmström, K. E., Gräslund, S., Wahlström, A., Poungshompoo, S., Bengtsson, B., & Kautsky, N. (2003) · International Journal of Food Science & Technology · doi:10.1046/j.1365-2621.2003.00671.x · Cited by 492 · see citing works
Resistance integrons and super-integrons
Fluit, A. C., & Schmitz, F. (2004) · Clinical Microbiology and Infection · doi:10.1111/j.1198-743x.2004.00858.x · Cited by 420 · see citing works
Resistance integrons: class 1, 2 and 3 integrons
Deng, Y., Bao, X., Ji, L., Chen, L., Liu, J., Miao, J., Chen, D., Bian, H., Li, Y., & Yu, G. (2015) · Annals of Clinical Microbiology and Antimicrobials · doi:10.1186/s12941-015-0100-6 · Cited by 407 · see citing works
“Dalsgaard A, Forslund A, Serichantalergs O, Sandvang D (2000) Distribution and content of class 1 integrons in different Vibrio cholerae O-serotype strains isolated in Thailand.”
Molecular Analysis of Antibiotic Resistance Gene Clusters in Vibrio cholerae O139 and O1 SXT Constins
Hochhut, B., Lotfi, Y., Mazel, D., Faruque, S. M., Woodgate, R., & Waldor, M. K. (2001) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.45.11.2991-3000.2001 · Cited by 318 · see citing works
“found exclusively as a cassette within class 1 and 2 integrons (11, 32).”
Background
Emergence of Salmonella epidemics: The problems related to Salmonella enterica serotyp Enteritidis and multiple antibiotic resistance in other major serotypes
Velge, P., Cloeckaert, A., & Barrow, P. (2005) · Veterinary Research · doi:10.1051/vetres:2005005 · Cited by 266 · see citing works
“cholerae isolated in Thailand and India [36, 142].”
Bacterial resistance evolution by recruitment of super‐integron gene cassettes
Rowe‐Magnus, D. A., Guérout, A.-M., & Mazel, D. (2002) · Molecular Microbiology · doi:10.1046/j.1365-2958.2002.02861.x · Cited by 245 · see citing works
“…the Tn21 transposon family and conjugative plasmids has led to the widespread occurrence of integrons among bacterial populations (Martinez and de la Cruz, 1988; Nesvera et al., 1998; Ploy et al., 1998; Liebert et al., 1999; Naas et al., 1999; Poirel et al., 1999a,b; 2000; Dalsgaard et al., 2000a).”
BackgroundResult
Occurrence of Antibiotic Resistance Gene Cassettes aac ( 6 ′) -Ib , dfrA5 , dfrA12 , and ereA2 in Class I Integrons in Non-O1, Non-O139 Vibrio cholerae Strains in India
Thungapathra, M., Amita, Sinha, K. K., Chaudhuri, S. R., Garg, P., Ramamurthy, T., Nair, G. B., & Ghosh, A. (2002) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.46.9.2948-2955.2002 · Cited by 150 · see citing works
“cholerae O1 strains isolated in Vietnam (8) and Albania and Italy (11), as well as in non-O1, non-O139 strains in Thailand (9).”
BackgroundInfluential
Integrons in the development of antimicrobial resistance: critical review and perspectives
Bhat, B. A., Mir, R. A., Qadri, H., Dhiman, R., Almilaibary, A., Alkhanani, M., & Mir, M. A. (2023) · Frontiers in Microbiology · doi:10.3389/fmicb.2023.1231938 · Cited by 160 · see citing works
VariantSalmonellaGenomic Island 1 Antibiotic Resistance Gene Cluster inSalmonella entericaSerovar Albany
Doublet, B., Lailler, R., Meunier, D., Brisabois, A., Boyd, D. A., Mulvey, M. R., Chaslus-Dancla, E., & Cloeckaert, A. (2003) · Emerging infectious diseases · doi:10.3201/eid0905.020609 · Cited by 146 · see citing works
“cholerae strains showed resistance to trimethoprim-sulfamethoxazole; the strains that acquired the dfrA1 gene cassette likely became predominant through selective pressure (16,24).”
BackgroundInfluential
Antibiotic susceptibility profiles of some Vibrio strains isolated from wastewater final effluents in a rural community of the Eastern Cape Province of South Africa
Okoh, A. I., & Igbinosa, E. O. (2010) · BMC Microbiology · doi:10.1186/1471-2180-10-143 · Cited by 146 · see citing works
“Tabtieng R, Wattanasri S, Echeverria P, Seriwatana J, Bodhidatta L, Chatkaeomorakot A, Rowe B: An epidemic of Vibrio cholerae El Tor Inaba resistant to several antibiotics with a conjugative group C plasmid coding for type II dihydrofolate reductase in Thailand.”
BackgroundInfluential
Molecular Epidemiology of the Integron-Located VEB-1 Extended-Spectrum β-Lactamase in Nosocomial Enterobacterial Isolates in Bangkok, Thailand
Girlich, D., Poirel, L., Leelaporn, A., Karim, A., Tribuddharat, C., Fennewald, M., & Nordmann, P. (2001) · Journal of Clinical Microbiology · doi:10.1128/jcm.39.1.175-182.2001 · Cited by 141 · see citing works
Characterization and quantification of class 1 integrons and associated gene cassettes in sewage treatment plants
Zhang, X., Zhang, T., Zhang, M., Fang, H. H. P., & Cheng, S. (2009) · Applied Microbiology and Biotechnology · doi:10.1007/s00253-009-1886-y · Cited by 132 · see citing works
“…Akinbowale et al. 2007; Jacobs and Chenia 2007), sewage treatment plants (Szczepanowski et al. 2004; Tennstedt et al. 2005; Da Silva et al. 2007; Taviani et al. 2008), surface waters (Poppe et al. 2006; Mukherjee and Chakraborty 2006; Lin and Biyela 2005), and sediments (Dalsgaard et al. 2000).”
Background
Antibiotic Resistance Conferred by a Class I Integron and SXT Constin in Vibrio cholerae O1 Strains Isolated in Laos
Iwanaga, M., Toma, C., Miyazato, T., Insisiengmay, S., Nakasone, N., & Ehara, M. (2004) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.48.7.2364-2369.2004 · Cited by 126 · see citing works
“V. cholerae strains isolated in Thailand and India were also reported to contain a class I integron with various gene cassettes ( 8 , 24).”
Background
In vitro susceptibility to 15 antibiotics of vibrios isolated from penaeid shrimps in Northwestern Mexico
Roque, A., Molina-Aja, A., Bolán-Mejia, C., & Gómez‐Gil, B. (2001) · International Journal of Antimicrobial Agents · doi:10.1016/s0924-8579(01)00308-9 · Cited by 126 · see citing works
Vibrio cholerae O1 outbreak isolates in Mozambique and South Africa in 1998 are multiple-drug resistant, contain the SXT element and the aadA2 gene located on class 1 integrons
Dalsgaard, A. (2001) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/48.6.827 · Cited by 126 · see citing works
Self-citation
Microarray-based detection of genetic heterogeneity, antimicrobial resistance, and the viable but nonculturable state in human pathogenic Vibrio spp.
Vora, G. J., Meador, C. E., Bird, M. M., Bopp, C. A., Andreadis, J. D., & Stenger, D. A. (2005) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0505033102 · Cited by 119 · see citing works
New Cluster of Plasmid-Located Class 1 Integrons in Vibrio cholerae O1 and a dfrA15 Cassette-Containing Integron in Vibrio parahaemolyticus Isolated in Angola
Ceccarelli, D., Salvia, A. M., Sami, J., Cappuccinelli, P., & Colombo, M. M. (2006) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.01310-05 · Cited by 99 · see citing works
“Both dfrA15 and blaP1 integron cassettes showed complete identity to the cassettes in Thailand described previously (11).”
Background
Class 1 integronase gene and tetracycline resistance genes tetA and tetC in different water environments of Jiangsu Province, China
Zhang, X., Wu, B., Zhang, Y., Zhang, T., Yang, L., Fang, H. H. P., Ford, T., & Cheng, S. (2009) · Ecotoxicology · doi:10.1007/s10646-009-0332-3 · Cited by 97 · see citing works
“…strains isolated from animal production or aquaculture facilities (Schmidt et al. 2001; Moura et al. 2007; Akinbowale et al. 2007; Jacobs and Chenia 2007), STPs (Szczepanowski et al. 2004; Taviani et al. 2008), surface water (Mukherjee and Chakraborty 2006) and sediments (Dalsgaard et al. 2000).”
Background
Integrons and β-lactamases—a novel perspective on resistance
Weldhagen, G. F. (2004) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2004.03.007 · Cited by 97 · see citing works
“CTX-M-9 Escherichia coli Spain [21] PSE-1 Vibrio cholerae Thailand [22]”
Background
Italian metallo-β-lactamases: a national problem? Report from the SENTRY Antimicrobial Surveillance Programme
Toleman, M. A., Biedenbach, D. J., Bennett, D. M., Jones, R. N., & Walsh, T. R. (2004) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dkh512 · Cited by 97 · see citing works
Molecular characteristics of class 1 and class 2 integrons and their relationships to antibiotic resistance in clinical isolates of Shigella sonnei and Shigella flexneri
Pan, J., Ye, R., Meng, D.-M., Zhang, W., Wang, H., & Liu, K. (2006) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dkl228 · Cited by 95 · see citing works
“Class 1 integrons were analysed by PCR using three sets of primers as described previously: intI1L and intI1R,(20) inF and inB(21) and qacED1-F and sul1-B.(21) The primers cover the 50-conserved segment (50-CS) (intI1), the cassette region and the 30-CS of class 1 integrons, respectively (Table 2).”
Method
Antimicrobial resistance determinants of Escherichia coli isolates recovered from some rivers in Osun State, South-Western Nigeria: Implications for public health
Titilawo, Y., Obi, L., & Okoh, A. I. (2015) · The Science of The Total Environment · doi:10.1016/j.scitotenv.2015.03.095 · Cited by 94 · see citing works
Environmental Vibrio spp., isolated in Mozambique, contain a polymorphic group of integrative conjugative elements and class 1 integrons
Taviani, E., Ceccarelli, D., Lazaro, N., Bani, S., Cappuccinelli, P., Colwell, R. R., & Colombo, M. M. (2008) · FEMS Microbiology Ecology · doi:10.1111/j.1574-6941.2008.00455.x · Cited by 93 · see citing works
An Ionic Liquid Facilitates the Proliferation of Antibiotic Resistance Genes Mediated by Class I Integrons
Luo, Y., Wang, Q., Lü, Q., Mu, Q., & Mao, D. (2014) · Environmental Science & Technology Letters · doi:10.1021/ez500103v · Cited by 93 · see citing works
Class 1 Integron-Borne, Multiple-Antibiotic Resistance Encoded by a 150-Kilobase Conjugative Plasmid in Epidemic Vibrio cholerae O1 Strains Isolated in Guinea-Bissau
Dalsgaard, A., Forslund, A., Petersen, A., Brown, D., Dias, F., Monteiro, S., Mølbak, K., Aaby, P., Rodrigues, A., & Sandström, A. (2000) · Journal of Clinical Microbiology · doi:10.1128/jcm.38.10.3774-3779.2000 · Cited by 87 · see citing works
Self-citation
Class I Integrons and SXT Elements in El Tor Strains Isolated before and after 1992Vibrio choleraeO139 Outbreak, Calcutta, India
Amita, M., Chowdhury, S. R., Thungapathra, M., Ramamurthy, T., Nair, G. B., & Ghosh, A. (2003) · Emerging Infectious Diseases · doi:10.3201/eid0904.020317 · Cited by 78 · see citing works
“This fact led Dalsgaard et al. to conjecture that this distinct O1 strain might have been transferred between Thailand and Vietnam ( 5 ).”
BackgroundMethodResultInfluential
Class 1 integrons inPseudomonas aeruginosaisolates from clinical settings in Amazon region, Brazil
Fonseca, É. L., Vieira, V. ́. V., Cipriano, R., & Vicente, A. C. P. (2005) · FEMS Immunology & Medical Microbiology · doi:10.1016/j.femsim.2005.01.004 · Cited by 79 · see citing works
“3 0CS of class 1 integron [16]”
Identification and Characterization of Class 1 Integron Resistance Gene Cassettes among Salmonella Strains Isolated from Healthy Humans in China
Zhang, H., Shi, L., Lin, L., Guo, S., Zhang, X., Yamasaki, S., Miyoshi, S., & Shinoda, S. (2004) · Microbiology and Immunology · doi:10.1111/j.1348-0421.2004.tb03473.x · Cited by 76 · see citing works
Global dissemination patterns of common gene cassette arrays in class 1 integrons
Domingues, S., Nielsen, K. M., & Silva, G. (2015) · Microbiology · doi:10.1099/mic.0.000099 · Cited by 66 · see citing works
“Integrons have been found in a permafrost sample (Petrova et al., 2011) and in bacteria isolated years before their characterization as MGEs involved in antibiotic resistance (Dalsgaard et al., 2000; Hedges et al., 1972; Huovinen & Jacoby, 1991; Kazama et al., 1995; Stokes & Hall, 1989).”
Development of pVCR94ΔX from Vibrio cholerae, a prototype for studying multidrug resistant IncA/C conjugative plasmids
Carraro, N., Sauvé, M., Matteau, D., Lauzon, G., Rodrigue, S., & Burrus, V. (2014) · Frontiers in Microbiology · doi:10.3389/fmicb.2014.00044 · Cited by 57 · see citing works
“A draft assembly generated a sequence of 134,484 bp. Initial sequence analyses revealed the presence of only three resistance genes, sul1, sul2, and dfrA15, conferring resistance to cotrimoxazole. sul1 and dfrA15 belong to a class 1 mobile integron devoid of any other integron cassette (Figure 2) Identical integron st…”
BackgroundInfluential
Characterization and Movement of the Class 1 Integron Known as Tn 2521 and Tn 1405
Partridge, S. R., Brown, H. J., & Hall, R. M. (2002) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.46.5.1288-1294.2002 · Cited by 57 · see citing works
Analysis for prevalence and physical linkages amongst integrons, ISEcp1, ISCR1, Tn21 and Tn7 encountered in Escherichia coli strains from hospitalized and non-hospitalized patients in Kenya during a 19-year period (1992–2011)
Kiiru, J., Butaye, P., Goddeeris, B. M., & Kariuki, S. (2013) · BMC Microbiology · doi:10.1186/1471-2180-13-109 · Cited by 55 · see citing works
“Detection of the ISEcp1, ISCR1, Tn21 and Tn7 elements was done as described in published studies [34,35].”
Method
Dissemination of a single Vibrio cholerae clone in cholera outbreaks during 2005 in Iran
Pourshafie, M. R., Bakhshi, B., Ranjbar, R., Sedaghat, M., Sadeghifard, N., Yazdi, J. Z., Parzadeh, M., & Raesi, J. (2007) · Journal of Medical Microbiology · doi:10.1099/jmm.0.47218-0 · Cited by 53 · see citing works
“In the past, the prevalence of V. cholerae resistant to antibiotics was low and routine susceptibility testing was not recommended (Dalsgaard et al., 2000).”
Background
Distribution of phenotypic and genotypic antimicrobial resistance and virulence genes in Vibrio parahaemolyticus isolated from cultivated oysters and estuarine water
Jeamsripong, S., Khant, W., & Chuanchuen, R. (2020) · FEMS Microbiology Ecology · doi:10.1093/femsec/fiaa081 · Cited by 52 · see citing works
“The trimethoprim-resistant genes, dfrA18 and dfrA1, and the sulfamethoxazole-resistant gene, sul2, were observed in our results, and these agreed with a previous study analyzing drugresistant genes in V. cholerae found in Thailand and India (Dalsgaard et al. 2000).”
Influential
Minimum influent concentrations of oxytetracycline, streptomycin and spiramycin in selecting antibiotic resistance in biofilm type wastewater treatment systems
Tian, Z., Palomo, A., Zhang, H., Luan, X., Liu, R., Awad, M., Smets, B. F., Zhang, Y., & Yang, M. (2020) · The Science of The Total Environment · doi:10.1016/j.scitotenv.2020.137531 · Cited by 52 · see citing works
Phenotypic and Genotypic Antimicrobial Resistance Traits of Vibrio cholerae Non-O1/Non-O139 Isolated From a Large Austrian Lake Frequently Associated With Cases of Human Infection
Lepuschitz, S., Baron, S., Larvor, E., Granier, S. A., Pretzer, C., Mach, R. L., Farnleitner, A. H., Ruppitsch, W., Pleininger, S., Indra, A., et al. (2019) · Frontiers in Microbiology · doi:10.3389/fmicb.2019.02600 · Cited by 52 · see citing works
New Carbenicillin-Hydrolyzing β-Lactamase (CARB-7) from Vibrio cholerae Non-O1, Non-O139 Strains Encoded by the VCR Region of the V. cholerae Genome
Melano, R. G., Petroni, A., Garutti, A., Saka, H. A., Mange, L., Pasterán, F. G., Rapoport, M., Rossi, A., & Galas, M. (2002) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.46.7.2162-2168.2002 · Cited by 50 · see citing works
“Integrons from class 1 were already observed in V. cholerae ( 7 , 9). In addition, V. cholerae strains have a large chromosomal region, which acts as an integron-like structure, capturing genes from plasmids or via phages (15).”
Background
Prevalence and characterisation of non-cholerae Vibrio spp. in final effluents of wastewater treatment facilities in two districts of the Eastern Cape Province of South Africa: implications for public health
Okoh, A. I., Sibanda, T., Nongogo, V., Adefisoye, M. A., Osuolale, O., & Nontongana, N. (2014) · Environmental Science and Pollution Research · doi:10.1007/s11356-014-3461-z · Cited by 48 · see citing works
“3 % after the emergence of drug resistance strains in GuineaBissau during the cholera epidemic of 1996–1997 (Dalsgaard et al. 2000).”
BackgroundInfluential
Genetic diversity analyses of class 1 integrons and their associated antimicrobial resistance genes in Enterobacteriaceae strains recovered from aquatic habitats in China
Guo, X., Xia, R., Han, N., & Xu, H. (2011) · Letters in Applied Microbiology · doi:10.1111/j.1472-765x.2011.03059.x · Cited by 46 · see citing works
“…prevalence of integrons and their various gene cassette arrays in an estuary (Rosser and Young 1999), surface water (Mukherjee and Chakraborty 2006), sediments (Dalsgaard et al. 2000) and WWTPs (Moura et al. 2010) and drinking water biofilters in the Jiangsu Province of China (Zhang et al. 2009).”
Background
CARB-9, a Carbenicillinase Encoded in the VCR Region of Vibrio cholerae Non-O1, Non-O139 Belongs to a Family of Cassette-Encoded β-Lactamases
Petroni, A., Melano, R. G., Saka, H. A., Garutti, A., Mange, L., Pasterán, F. G., Rapoport, M., Miranda, M. R., Faccone, D. F., Rossi, A., et al. (2004) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.48.10.4042-4046.2004 · Cited by 46 · see citing works
“cholerae plasmid, class 1 integron (8) AF221899 D.”
Background
Mechanism of Drug Resistance in Clonally Related Clinical Isolates of Vibrio fluvialis Isolated in Kolkata, India
Srinivasan, V. B., Virk, R. K., Kaundal, A., Chakraborty, R., Datta, B., Ramamurthy, T., Mukhopadhyay, A. K., & Ghosh, A. (2006) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.01561-05 · Cited by 46 · see citing works
“3-kb amplicons followed by BLAST analysis revealed 100% sequence identity of these amplicons with the 3 conserved sequence (3 CS) and 5 CS, respectively, of class 1 integrons (8, 12).”
Background
Novel Spectinomycin/Streptomycin Resistance Gene, aadA14 , from Pasteurella multocida
Kehrenberg, C., Catry, B., Haesebrouck, F., de Kruif, A., & Schwarz, Š. (2005) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.49.7.3046-3049.2005 · Cited by 46 · see citing works
“bacterium, uncultured bacterium; V. cholerae, Vibrio cholerae AadA2 ( 5 ).”
Identification and Characterization of Class 1 Integron Resistance Gene Cassettes among Salmonella Strains Isolated from Imported Seafood
Khan, A. A., Ponce‐Rivas, E., Nawaz, M. S., Cheng, C.-M., Khan, J. A., & West, C. S. (2008) · Applied and Environmental Microbiology · doi:10.1128/aem.02054-08 · Cited by 45 · see citing works
“Copenhagen, and Lansing were the same as those reported to occur in integrons of V. cholerae isolated in Thailand and India (7, 24).”
Influential
Class 1 Integrons in Aeromonas hydrophila Isolates from Farmed Nile Tilapia (Oreochromis nilotica)
Lukkana, M., Wongtavatchai, J., & Chuanchuen, R. (2011) · Journal of Veterinary Medical Science · doi:10.1292/jvms.11-0441 · Cited by 44 · see citing works
“All the isolates were originated from the strain collection of Department of Veterinary *CorrespondenCe to: ChuanChuen, R., Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330, Thailand. e-mail: rchuanchuen@yahoo.com ©2012 The Japanese Society of Veterinary Science Medicine, Faculty of Veterinary Sc…”
BackgroundInfluential
Vibrio cholerae non‐O1, non‐O139 strains isolated before 1992 from Varanasi, India are multiple drug resistant, contain int SXT, dfr18 and aadA5 genes
Mohapatra, H., Mohapatra, S. S., Mantri, C. K., Colwell, R. R., & Singh, D. V. (2008) · Environmental Microbiology · doi:10.1111/j.1462-2920.2007.01502.x · Cited by 43 · see citing works
Distribution and characterization of integrons in various serogroups of Vibrio cholerae strains isolated from diarrhoeal patients between 1992 and 2000 in Kolkata, India
Shi, L., Fujihara, K., Sato, T., Ito, H., Garg, P., Chakrabarty, R., Ramamurthy, T., Nair, G. B., Takeda, Y., & Yamasaki, S. (2006) · Journal of Medical Microbiology · doi:10.1099/jmm.0.46339-0 · Cited by 41 · see citing works
“In Thailand, 30% of isolates of these serogroups isolated from children between 1993 and 1995 were positive compared with 58% of the strains from adult patients in 1990 (Dalsgaard et al., 2000a).”
BackgroundMethodResultInfluential
The commensal infant gut meta-mobilome as a potential reservoir for persistent multidrug resistance integrons
Ravi, A., Avershina, E., Foley, S. L., Ludvigsen, J., Storrø, O., Øien, T., Johnsen, R., McCartney, A. L., L'Abée-Lund, T. M., & Rudi, K. (2015) · Scientific Reports · doi:10.1038/srep15317 · Cited by 37 · see citing works
“The mobile nature of integrons-associated MGEs has been previously observed in pathogenic bacteria 39,40 , environmental samples 41 and in hospital environments 42 .”
Aquatic environments: A potential source of antimicrobial-resistant Vibrio spp.
Kumarage, P. M., Silva, L. A. D. S. D., & Heo, G. (2022) · Journal of Applied Microbiology · doi:10.1111/jam.15702 · Cited by 36 · see citing works
“Amongst them, class 1 integron has been regularly detected in V. cholerae isolated from environmental water (Dalsgaard et al., 2000a, 2000b; Dalsgaard, 2001).”
Background
Integrons and antibiotic resistance genes in water-borne pathogens: threat detection and risk assessment
Kaushik, M., Kumar, S., Kapoor, R. K., & Gulati, P. (2019) · Journal of Medical Microbiology · doi:10.1099/jmm.0.000972 · Cited by 36 · see citing works
Antimicrobial Susceptibility of Autochthonous Aquatic Vibrio cholerae in Haiti
Baron, S., Lesne, J., Jouy, É., Larvor, E., Kempf, I., Boncy, J., Rebaudet, S., & Piarroux, R. (2016) · Frontiers in Microbiology · doi:10.3389/fmicb.2016.01671 · Cited by 37 · see citing works
“The sul1/2 genes have been detected in class 1 integrons or/and in plasmids in V. cholerae O1 (Dalsgaard et al., 2001; Iwanaga et al., 2004; Ceccarelli et al., 2006) and in non-O1/non-O139 serogroups (Dalsgaard et al., 2000).”
Background
Distribution of Class I Integron and Sulfamethoxazole Trimethoprim Constin in Vibrio cholerae Isolated from Patients in Iran
Adabi, M., Bakhshi, B., Goudarzi, H., Zahraei, S. M., & Pourshafie, M. R. (2009) · Microbial Drug Resistance · doi:10.1089/mdr.2009.0885 · Cited by 35 · see citing works
“3%) R R R S R S R S S S 6 2005 (2, 3, 4) 3 (5%) R R R S R S S S S S 7 2005 (2, 3, 4) 5 (8.”
Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital
Kiddee, A., Henghiranyawong, K., Yimsabai, J., Tiloklurs, M., & Niumsup, P. R. (2013) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2013.05.009 · Cited by 33 · see citing works
Molecular characterisation of Vibrio cholerae O1 strains carrying an SXT/R391-like element from cholera outbreaks in Kenya: 1994-2007
Kiiru, J., Saidi, S. M., Goddeeris, B. M., Wamae, N., Butaye, P., & Kariuki, S. (2009) · BMC Microbiology · doi:10.1186/1471-2180-9-275 · Cited by 33 · see citing works
“[30].”
Genetic diversity and antibiotic resistance of clinical and environmental Vibrio cholerae suggests that many serogroups are reservoirs of resistance
Campos, L. C., Zahner, V., Avelar, K. E. S., Alves, R. M., PEREIRA, D. S. G., Vital-Brazil, J. M., Freitas, F. S., Salles, C. A., & Karaolis, D. K. R. (2004) · Epidemiology and Infection · doi:10.1017/s0950268804002705 · Cited by 32 · see citing works
“PCR were performed as described previously [21].”
BackgroundInfluential
Antimicrobial Resistant Bacteria in Shrimp and Shrimp Farms of Bangladesh
Khan, M., Paul, S. I., Rahman, M. M., & Lively, J. A. A. (2022) · Water · doi:10.3390/w14193172 · Cited by 31 · see citing works
Antimicrobial resistance of Shigella spp isolated from diarrheal patients between 1989 and 1998 in Vietnam.
Anh, N. T. V., Cam, P. D., & Dalsgaard, A. (2001) · PubMed · Cited by 31 · see citing works
Self-citation
Molecular characterization of ICEVchVie0 and its disappearance inVibrio choleraeO1 strains isolated in 2003 in Vietnam
Bani, S., Mastromarino, P. N., Ceccarelli, D., Van, A. L., Salvia, A. M., Viet, Q. T. N., Hai, D. H., Bacciu, D., Cappuccinelli, P., & Colombo, M. M. (2006) · FEMS Microbiology Letters · doi:10.1111/j.1574-6968.2006.00518.x · Cited by 30 · see citing works
Carbapenem Resistance in Clonally Distinct Clinical Strains ofVibrio fluvialisIsolated from Diarrheal Samples
Chowdhury, G., Pazhani, G. P., Sarkar, A., Rajendran, K., Mukhopadhyay, A. K., Bhattacharya, M. K., Ghosh, A., & Ramamurthy, T. (2016) · Emerging infectious diseases · doi:10.3201/eid2210.151612 · Cited by 28 · see citing works
A molecular survey on virulence associated genotypes of non-O1 non-O139 Vibrio cholerae in aquatic environment of Tehran, Iran
Bakhshi, B., Barzelighi, H. M., Adabi, M., Lari, A. R., & Pourshafie, M. R. (2008) · Water Research · doi:10.1016/j.watres.2008.12.025 · Cited by 28 · see citing works
Antibiotic Resistance in Aeromonas hydrophila and Vibrio alginolyticus Isolated from a Wound Infection: A Case Report
Horii, T., Morita, M., Muramatsu, H., Monji, A., Miyagishima, D., Kanno, T., & Maekawa, M. (2005) · The Journal of Trauma: Injury, Infection, and Critical Care · doi:10.1097/01.ta.0000066381.33339.c0 · Cited by 26 · see citing works
Molecular characterisation of class 1 integrons in Salmonella enterica serovar Choleraesuis isolates from southern Taiwan
Lee, M.-F., Chen, Y., & Peng, C. (2008) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2008.09.017 · Cited by 25 · see citing works
Characterization of Antimicrobial Resistance, Plasmids, and Gene Cassettes in Shigella spp. from Patients in Vietnam
Iversen, J., Sandvang, D., Srijan, A., Cam, P. D., & Dalsgaard, A. (2003) · Microbial Drug Resistance · doi:10.1089/107662903322541856 · Cited by 24 · see citing works
“However, aadA gene cassettes are very common in class 1 integrons in Enterobactericeae, 5,25,27 and the most commonly found gene cassette in our study.”
Self-citation
Molecular Adaptations and Antibiotic Resistance in Vibrio cholerae : A Communal Challenge
Narendrakumar, L., Gupta, S. S., Johnson, J. B., Ramamurthy, T., & Thomas, S. (2019) · Microbial Drug Resistance · doi:10.1089/mdr.2018.0354 · Cited by 22 · see citing works
Prevalence of virulence and extended‐spectrum β‐lactamase (ESBL) genes harbouring Vibrio spp. isolated from cockles ( Tegillarca granosa ) marketed in Korea
Dahanayake, P. S., Hossain, S., Wickramanayake, M. V. K. S., & Heo, G. (2019) · Letters in Applied Microbiology · doi:10.1111/lam.13232 · Cited by 22 · see citing works
“The aadA1 is known to confer resistance to streptomycin and spectinomycin in V. cholerae (Dalsgaard et al. 2000).”
Background
Vibrio cholerae infection, novel drug targets and phage therapy
Fazil, M. H. U. T., & Singh, D. V. (2011) · Future Microbiology · doi:10.2217/fmb.11.93 · Cited by 22 · see citing works
Distribution of class 1 integrons among enteropathogenicEscherichia coli
NAJIBI, S., Bakhshi, B., Fallahzad, S., Pourshafie, M. R., Katouli, M., Sattari, M., Alebouyeh, M., & Tajbakhsh, M. (2012) · Canadian Journal of Microbiology · doi:10.1139/w2012-035 · Cited by 21 · see citing works
Providencia in retail meats from Guangzhou, China and Osaka, Japan: prevalence, antimicrobial resistance and characterization of classes 1, 2 and 3 integrons
Di, H., Liang, S.-S., Li, Q., Shi, L., Shima, A., Meng, H., He, Y. A. N., & Yamasaki, S. (2018) · Journal of Veterinary Medical Science · doi:10.1292/jvms.18-0037 · Cited by 21 · see citing works
“INT-1U GTTCGGTCAAGGTTCTG intI1 923 50 [36] INT-1D GCCAACTTTCAGCACATG INT-2U ATGTCTAACAGTCCATTTT intI2 450 50 [13] INT-2D AAATCTTTAACCCGCAAAC INT-3U ATCTGCCAAACCTGACTG intI3 921 55 [15] INT-3D CGAATGCCCCAACAACTC qacEΔ1-F ATCGCAATAGTTGGCGAAGT qacEΔ1+sul1 (3′-CS of class 1 integron) 800 56 [12] sul1-B GCAAGGCGGAAACCCGCGC…”
Background
Emergence of Tetracycline ResistantVibrio choleraeO1 Biotype El Tor Serotype Ogawa with ClassicalctxBGene from a Cholera Outbreak in Odisha, Eastern India
Jain, M., Kumar, P., & Goel, A. K. (2016) · Journal of Pathogens · doi:10.1155/2016/1695410 · Cited by 21 · see citing works
“The presence of gene cassettes for aadA2 (encoding resistance for streptomycin and spectinomycin), strA (encoding resistance for streptomycin), blaP1 (encoding resistance for β-lactams), floR (encoding resistance for chloramphenicol), and dfrA1 (encoding resistance for trimethoprim) was determined by PCR as described…”
BackgroundMethod
Occurrence and composition of class 1 and class 2 integrons in clinical and environmental O1 and non-O1/non-O139 Vibrio cholerae strains from the Brazilian Amazon
de Sá, L. L. C., da Fonseca, E. L., Pellegrini, M., Freitas, F. S., Loureiro, E. C. B., & Vicente, A. C. P. (2010) · Memórias do Instituto Oswaldo Cruz · doi:10.1590/s0074-02762010000200021 · Cited by 20 · see citing works
Genomic characterization of antibiotic resistance‐encoding genes in clinical isolates of Vibrio cholerae non‐O1/non‐O139 strains from Kolkata, India: generation of novel types of genomic islands containing plural antibiotic resistance genes
Morita, D., Takahashi, E., Morita, M., Ohnishi, M., Mizuno, T., Miyoshi, S., Dutta, D., Ramamurthy, T., Chowdhury, G., Mukhopadhyay, A. K., et al. (2020) · Microbiology and Immunology · doi:10.1111/1348-0421.12790 · Cited by 18 · see citing works
Class 1 integrons and SXT elements conferring multidrug resistance in Vibrio cholerae O1 strains associated with a recent large cholera outbreak in Orissa, Eastern India
Jain, M., Kumar, P., Goel, A. K., Kamboj, D. V., & Singh, L. (2008) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2008.05.003 · Cited by 18 · see citing works
Clonal Dissemination of a Single Vibrio cholerae O1 Biotype El Tor Strain in Sistan–Baluchestan Province of Iran During 2013
Bakhshi, B., Mahmoudi-Aznaveh, A., & Khorashad, A. S. (2015) · Current Microbiology · doi:10.1007/s00284-015-0806-x · Cited by 16 · see citing works
Antibiotic resistance determinants and clonal relationships among multidrug-resistant isolates of Klebsiella pneumoniae
Singh, S. K., Mishra, M., Sahoo, M., Patole, S., Sahu, S., Misra, S. R., & Mohapatra, H. (2017) · Microbial Pathogenesis · doi:10.1016/j.micpath.2017.06.013 · Cited by 16 · see citing works
High prevalence of atypical class 1 integrons and class 2 integrons in multi-drug resistance Shigella flexneri isolated from China
Wen, X.-M., Wu, Y.-G., Bian, F.-Z., Yu-guo, S., Zheng, X.-F., Zhang, Y., Jiang, C., & Yuan, G. (2012) · African Journal of Microbiology Research · doi:10.5897/ajmr12.1130 · Cited by 15 · see citing works
Epidemiological cutoff values and genetic antimicrobial resistance of Lactococcus garvieae and L. petauri
Öztürk, R. Ç., Ustaoğlu, D., Türe, M., Bondavalli, F., Colussi, S., Pastorino, P., Vela, A. I., Kotzamanidis, C., Fernández‐Garayzábal, J. F., Bitchava, K., et al. (2024) · Aquaculture · doi:10.1016/j.aquaculture.2024.741340 · Cited by 14 · see citing works
The Roles of Lateral Gene Transfer and Vertical Descent in Vibrio Evolution
Boucher, Y., & Stokes, H. W. (2014) · ASM Press eBooks · doi:10.1128/9781555815714.ch7 · Cited by 14 · see citing works
Évolution de la sensibilité de Vibrio cholerae 01 après utilisation prolongée d'antibiotiques en traitement et en prophylaxie au cours de l'épidémie de choléra de Douala (Cameroun) 2004
Guévart, É., Sollé, J., Mouangue, A., Noeske, J., Bita, A., Fonkoua, M., & Wouafo, M. (2006) · Médecine et Maladies Infectieuses · doi:10.1016/j.medmal.2005.11.020 · Cited by 13 · see citing works
Characterization of Vibrio cholerae from deep ground water in a cholera endemic area in Central India
Tamrakar, A. K., Jain, M., Goel, A. K., Kamboj, D. V., & Singh, L. (2009) · Indian Journal of Microbiology · doi:10.1007/s12088-009-0043-8 · Cited by 11 · see citing works
“qacEΔ1-F ATCGCAATAGTTGGCGAAGT 800 bp 10 pmol [19]”
ANTIBIOTIC SUSCEPTIBILITY AND ITS GENETIC ANALYSIS OF VIBRIO CHOLERAE NON-O1, NON-O139 FROM ENVIRONMENTAL SOURCES IN LAO PEOPLE'S DEMOCRATIC REPUBLIC
Miyazato, T., Tamaki, Y., Sithivong, N., Phantouamath, B., Insisiengmay, S., Higa, N., Toma, C., Nakasone, N., & Iwanaga, M. (2004) · Tropical Medicine and Health · doi:10.2149/tmh.32.245 · Cited by 9 · see citing works
Molecular Characterization of Enterohemorrhagic Escherichia coli Isolates from Cattle
Bakhshi, B., NAJIBI, S., & Sepehriseresht, S. (2014) · Journal of Veterinary Medical Science · doi:10.1292/jvms.13-0237 · Cited by 6 · see citing works
Spread of Antibiotic Resistance in the Environment: Impact on Human Health
Broszat, M., & Grohmann, E. (2013) · Springer eBooks · doi:10.1007/978-94-007-7890-0_7 · Cited by 5 · see citing works
Genomic evidence of two-staged transmission of the early seventh cholera pandemic
Luo, Y., Payne, M., Kaur, S., Octavia, S., & Lan, R. (2024) · Nature Communications · doi:10.1038/s41467-024-52800-w · Cited by 5 · see citing works
“AMR genes such as aadA, dfrA, qacE and cmlA were often found on integrons 45 .”
Diversity of Enteropathogens in River Narmada and Their Environmental and Health Implications
Sharma, A., Bhattacharya, A., Bora, C. R., Shukla, V., & Parihar, P. (2011) · Springer eBooks · doi:10.1007/978-94-007-2229-3_2 · Cited by 5 · see citing works
Molecular detection and antibiogram profiles of Escherichia coli and Vibrio cholerae isolated from raw vegetables in the northern district of Bangladesh
Rana, A. H., Bose, P., Sobur, K. A., Hossen, M., Mowdood, S., Hossain, M. K., Afroz, F., Rumi, N. A., Hasan, M., Jahan, N., et al. (2024) · Journal of Bioscience and Environment Research · doi:10.69517/jber.2024.01.01.0006 · Cited by 4 · see citing works
Transfer patterns of integron-associated and antibiotic resistance genes in S. flexneri during different time intervals in Tianjin, China
Wang, J., Liang, F., Wu, X.-M., & Qi, W. (2014) · Indian Journal of Medical Microbiology · doi:10.4103/0255-0857.136556 · Cited by 4 · see citing works
26 Miscellaneous antibacterial drugs
Imhof, A., & Laffer, R. (2007) · Side effects of drugs annual · doi:10.1016/s0378-6080(06)29026-3 · Cited by 4 · see citing works
Analysis of clonally related environmental Vibrio cholerae O1 El Tor isolated before 1992 from Varanasi, India reveals origin of SXT‐ICEs belonging to O139 and O1 serogroups
Mohapatra, S. S., Mantri, C. K., Mohapatra, H., Colwell, R. R., & Singh, D. V. (2009) · Environmental Microbiology Reports · doi:10.1111/j.1758-2229.2009.00051.x · Cited by 4 · see citing works
“cholerae O1 and O139 serogroups (Waldor et al., 1996; Falbo et al., 1999; Dalsgaard et al., 2000; Hochhut et al., 2001; Faruque et al., 2003; Iwanaga et al., 2004; Burrus et al., 2006a; Mazel, 2006).”
Antibiotic Resistance Conferred by Class 1 Integron in Vibrio Cholerae Strains: A Meta-analysis
Zuberi, Z., & Sillo, A. J. (2022) · East African Health Research Journal · doi:10.24248/eahrj.v6i2.690 · Cited by 3 · see citing works
Antibiotic Resistance and Integron of Vibrio cholerae Detection from School Street Foods in Jakarta
DEASHINTA, N., Waturangi, D. E., & Yogiara, Y. (2007) · HAYATI Journal of Biosciences · doi:10.4308/hjb.14.2.71 · Cited by 3 · see citing works
“Some information and studies are available for the distribution and importance of class 1 integrons in encoding antibiotic resistance in V. cholerae (Falbo et al. 1999; Dalsgaard et al. 2000a; Dalsgaard et al. 2000b; Dalsgaard et al. 2001).”
Background
Trimethoprim Resistance by Class I Integron in Vibrio parahaemolyticus from a Fish Farm
Yu, H., Park, K., Oh, E., Lee, T.-S., Shin, S.-B., Kwon, J.-Y., Kim, J., & Son, K.-T. (2010) · Korean Journal of Fisheries and Aquatic Sciences · doi:10.5657/kfas.2010.43.2.125 · Cited by 3 · see citing works
Study on the association between drug‑resistance and gene mutations of the active efflux pump acrAB‑tolC gene and its regulatory genes
Ma, Q., Su, L., Liu, J., Yao, M., & Yuan, G. (2018) · Molecular Medicine Reports · doi:10.3892/mmr.2018.8916 · Cited by 3 · see citing works
“The primers and primer sequences were synthesized in the accordance with relative reports (6-9), as in Table I.”
Method
Antimicrobial-Resistant Food-Borne Pathogens in Imported Food
Zhao, S. (2014) · ASM Press eBooks · doi:10.1128/9781555815745.ch6 · Cited by 3 · see citing works
Molecular Characterization of Antimicrobial Resistance of Vibrio Species Isolated from Fish in Egypt
Gobarah, D. E. A., Helmy, S., Mahfouz, N., Fahmy, H. A., Zeid, M. A. M. A., & Moustafa, E. M. (2023) · Journal of the Hellenic Veterinary Medical Society · doi:10.12681/jhvms.24078 · Cited by 2 · see citing works
Mechanism of Antibiotic Resistance and Pathogenicity of Vibrio cholerae
Saha, S., & Singh, D. V. (2020) · Springer eBooks · doi:10.1007/978-981-15-1695-5_15 · Cited by 2 · see citing works
Cholera in Lao P. D. R.: Past and Present
Nakamura, S., Midorikawa, Y., Nakatsu, M., Watanabe, T., Phethsouvanh, R., Vongphrachanh, P., Akkhavong, K., & Brey, P. T. (2012) · InTech eBooks · doi:10.5772/37605 · Cited by 2 · see citing works
Role of Temperate Bacteriophage 139 in Changing Cholera Toxin Production in Vibrio cholerae Classical Biovar
Yeroshenko, G. A., & Smirnova, N. I. (2004) · Russian Journal of Genetics · doi:10.1023/b:ruge.0000024970.58355.69 · Cited by 2 · see citing works
Prevalence and Characterisation of Non-Cholerae Vibrio spp. in Final Effluents of Wastewater Treatment Facilities in Two Districts of the Eastern Cape Province of South Africa: Implications for Public Health
Okoh, A. I., Sibanda, T., Nongogo, V., Adefisoye, M. A., Osuolale, O., & Nontongana, N. (2015) · Apple Academic Press eBooks · doi:10.1201/b18649-4 · Cited by 2 · see citing works

Distribution and characterization of integrons in various serogroups of Vibrio cholerae strains isolated from diarrhoeal patients between 1992 and 2000 in Kolkata, India
Shi, L., Fujihara, K., Sato, T., Ito, H., Garg, P., Chakrabarty, R., Ramamurthy, T., Nair, G. B., Takeda, Y., & Yamasaki, S. (2006) · Journal of Medical Microbiology · doi:10.1099/jmm.0.46339-0 · Cited by 41 · see citing works
Distribution of drug-resistance related integrons of Vibrio cholerae isolated between 1993 and 2000
Lian-sheng, Y. (2007) · Zhonghua chuanranbing zazhi
Occurrence and composition of class 1 and class 2 integrons in clinical and environmental O1 and non-O1/non-O139 Vibrio cholerae strains from the Brazilian Amazon
de Sá, L. L. C., da Fonseca, E. L., Pellegrini, M., Freitas, F. S., Loureiro, E. C. B., & Vicente, A. C. P. (2010) · Memórias do Instituto Oswaldo Cruz · doi:10.1590/s0074-02762010000200021 · Cited by 20 · see citing works
The Amplification and Distribution of Integron Class in Vibrio cholerae O_1 and O_(139) Serotype
Yushan, H. (2004) · Practical Preventive Medicine
Prevalence of aadA1 and dfrA15 class 1 integron cassettes and SXT circulation in Vibrio cholerae O1 isolates from Africa
Ceccarelli, D., Bani, S., Cappuccinelli, P., & Colombo, M. M. (2006) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dkl352 · Cited by 25 · see citing works

Authors: Dalsgaard, A., Forslund, A., Serichantalergs, O., & Sandvang, D.
Affiliations: Department of Veterinary Microbiology, Royal Veterinary and Agricultural University, Frederiksberg, DK-1870 Frederiksberg C,1 and
Armed Forces Research Institute of Medical Science (TH)
ORCID: Dalsgaard, Anders
Venue: Antimicrobial Agents and Chemotherapy
Publisher: American Society for Microbiology
Published: 2000-05
Volume: 44
Issue: 5
Pages: 1315-1321
ISSN: 0066-4804 (ISSN-L)
1098-6596
DOI: 10.1128/aac.44.5.1315-1321.2000
PMC: PMC89861
OpenAlex: W2141939691
Cited by: 118
References: 60
Citations by year: 2026: 2 · 2024: 3 · 2023: 2 · 2022: 3 · 2021: 1 · 2020: 7 · 2019: 4 · 2018: 3 · 2017: 1 · 2016: 3 · 2015: 6 · 2014: 7 · 2013: 3 · 2012: 3
FWCI: 3.76
Type: journal article
Language: en
Open access: green
europepmc.org
Licence: journals.asm.org/non-commercial-tdm-license (tdm)
Locations: Antimicrobial Agents and Chemotherapy (publishedVersion)
Europe PMC (PubMed Central) (publishedVersion)
PubMed Central (publishedVersion)
PubMed (publishedVersion)
Research at the University of Copenhagen (University of Copenhagen) (submittedVersion)
Technical University of Denmark, DTU Orbit (Technical University of Denmark, DTU) (submittedVersion)
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Endocrinology › Vibrio bacteria research studies
Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Medicine › Antibiotic Resistance in Bacteria
Life Sciences › Agricultural and Biological Sciences › Food Science › Salmonella and Campylobacter epidemiology
Keywords: class 1 integron, Vibrio cholerae, O serotypes, antibiotic resistance genes, aadB, aadA2, dfrA1, serotype O1, self-transmissible plasmids, gene cassettes, clinical and environmental isolates, Thailand
MeSH terms: Animals, Anti-Bacterial Agents, Drug Resistance, Microbial, Environmental Microbiology, Food Contamination, Food Microbiology, Genes, Bacterial, Humans, Microbial Sensitivity Tests, Thailand, Vibrio cholerae, Seafood, Decapoda

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Distribution and Content of Class 1 Integrons in Different Vibrio cholerae O-Serotype Strains Isolated in Thailand

Abstract

Integrity signals

Claims the paper makes

Claims other papers make about this one

Cites

Cited by

Related

Record

About these checks