Cited by 113Estrogen and related hormone effectsCell Adhesion Molecules ResearchNeutrophil, Myeloperoxidase and Oxidative Mechanisms

The DOI matches its Crossref record; 61 of the 62 references it cites were found in a registry or an index.

Mechanisms of glucocorticoid-induced down-regulation of neutrophil L-selectin in cattle: evidence for effects at the gene-expression level and primarily on blood neutrophils

Weber, Patty S D, Toelboell, Trine, Chang, Ling-Chu, Tirrell, Janelle Durrett, Saama, Peter M, Smith, George W, Burton, Jeanne L·2004·Journal of Leukocyte Biology

DOI 10.1189/jlb.1003505

Open this paper in CoChat — free account

Abstract

One anti-inflammatory action of glucocorticoids is down-regulation of surface L-selectin on circulating neutrophils. However, it is unclear if this is a result of release of affected bone marrow neutrophils or if the steroid has direct effects on L-selectin expression in existing blood neutrophils. We recently demonstrated that circulating neutrophils from cattle with high blood concentrations of endogenous glucocorticoid had reduced L-selectin mRNA, suggesting that the steroid interrupted L-selectin gene expression. In the current study, dexamethasone (DEX) was administered to cattle in vivo, and blood and bone marrow neutrophils were studied simultaneously within the animal to determine which pool of cells responds to glucocorticoids with inhibited L-selectin expression. Purified blood neutrophils were also treated with DEX ± RU486 in vitro, and glucocorticoid effects on L-selectin expression were determined. Our results indicate that glucocorticoid-induced suppression of L-selectin, which accompanies neutrophilia, is likely mediated by direct effects of glucocorticoid receptor activation on intracellular reservoirs of L-selectin mRNA and protein in cattle, predominantly in blood neutrophils.

Integrity signals

Registry

Crossref · 10.1189/jlb.1003505

Cites

61 of 61 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

This paper’s full text isn’t openly available, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method
Livak, K. J., & Schmittgen, T. D. (2001) · Methods · doi:10.1006/meth.2001.1262 · Cited by 180,860
A Multiple Comparison Procedure for Comparing Several Treatments with a Control
Dunnett, C. W. (1955) · Journal of the American Statistical Association · doi:10.1080/01621459.1955.10501294 · Cited by 6,097
An Essential Role for Ectodomain Shedding in Mammalian Development
Peschon, J. J., Slack, J. L., Reddy, P., Stocking, K. L., Sunnarborg, S. W., Lee, D. C., Russell, W. E., Castner, B. J., Johnson, R. S., Fitzner, J. N., et al. (1998) · Science · doi:10.1126/science.282.5392.1281 · Cited by 1,622
Selectins and their ligands: Current concepts and controversies
Kansas, G. (1996) · Blood · doi:10.1182/blood.v88.9.3259.bloodjournal8893259 · Cited by 1,415
Stress Hormones, Proinflammatory and Antiinflammatory Cytokines, and Autoimmunity
ELENKOV, I. J., & CHROUSOS, G. P. (2002) · Annals of the New York Academy of Sciences · doi:10.1111/j.1749-6632.2002.tb04229.x · Cited by 983
The selecting: vascular adhesion molecules
Tedder, T. F., Steeber, D. A., Chen, A., & Engel, P. (1995) · The FASEB Journal · doi:10.1096/fasebj.9.10.7542213 · Cited by 925
Molecular Determinants of Glucocorticoid Receptor Function and Tissue Sensitivity to Glucocorticoids
Bamberger, C. M., Schulte, H. M., & Chrousos, G. P. (1996) · Endocrine Reviews · doi:10.1210/edrv-17-3-245 · Cited by 912
MULTIPLE COMPARISON PROCEDURES UPDATED
Ludbrook, J. (1998) · Clinical and Experimental Pharmacology and Physiology · doi:10.1111/j.1440-1681.1998.tb02179.x · Cited by 622
Opposing effects of glucocorticoids on the rate of apoptosis in neutrophilic and eosinophilic granulocytes
Meagher, L., Cousin, J. M., Seckl, J. R., & Haslett, C. (1996) · The Journal of Immunology · doi:10.4049/jimmunol.156.11.4422 · Cited by 608
Glucocorticoids inhibit apoptosis of human neutrophils
Liles, W. C., Dale, D., & Klebanoff, S. J. (1995) · Blood · doi:10.1182/blood.v86.8.3181.3181 · Cited by 315

Show all 62 references

Sorted by citations

The HPA â€“ Immune Axis and the Immunomodulatory Actions of Glucocorticoids in the Brain
Bellavance, M.-A., & Rivest, S. (2014) · Frontiers in Immunology · doi:10.3389/fimmu.2014.00136 · Cited by 419
Invited review: Microbiota of the bovine udder: Contributing factors and potential implications for udder health and mastitis susceptibility
Derakhshani, H., Fehr, K. B., Sepehri, S., Francoz, D., Buck, J. D., Barkema, H. W., Plaizier, J. C., & Khafipour, E. (2018) · Journal of Dairy Science · doi:10.3168/jds.2018-14860 · Cited by 289
Gene expression signatures in neutrophils exposed to glucocorticoids: A new paradigm to help explain “neutrophil dysfunction” in parturient dairy cows
Burton, J. L., Madsen‐Bouterse, S. A., Chang, L., Weber, P. S. D., Buckham, K. R., van Dorp, R., Hickey, M. C., & Earley, B. (2005) · Veterinary Immunology and Immunopathology · doi:10.1016/j.vetimm.2005.02.012 · Cited by 207
“We did not have access to cows’ bone marrow in our parturition experiments and turned instead to our steer model of glucocorticoid challenge ( Weber et al., 2004 ) to perform a second microarray experiment.”
BackgroundMethodResultInfluentialSelf-citation
Regulatory and Mechanistic Actions of Glucocorticoids on T and Inflammatory Cells
Liberman, A. C., Budziñski, M. L., Sokn, C., Gobbini, R. P., Steininger, A., & ARZT, E. S. (2018) · Frontiers in Endocrinology · doi:10.3389/fendo.2018.00235 · Cited by 190
Infection-related complications during treatment for childhood acute lymphoblastic leukemia
Inaba, H., Pei, D., Wolf, J., Howard, S. C., Hayden, R. T., Go, M., Varechtchouk, O., Hahn, T., Buaboonnam, J., Metzger, M. L., et al. (2016) · Annals of Oncology · doi:10.1093/annonc/mdw557 · Cited by 172
Cumulative Physiological Events Influence the Inflammatory Response of the Bovine Udder to Escherichia coli Infections During the Transition Period
Burvenich, C., Bannerman, D. D., Lippolis, J. D., Peelman, L. J., Nonnecke, B. J., Kehrli, M. E., & Paape, M. J. (2007) · Journal of Dairy Science · doi:10.3168/jds.2006-696 · Cited by 170
“Glucocorticoid receptor down-regulation in neutrophils may be involved in periparturient neutrophil dysregulation and may cause an increased susceptibility to clinical mastitis (Weber et al., 2004).”
Background
Acute phase proteins in cattle after exposure to complex stress
Lomborg, S. R., Nielsen, L. R., Heegaard, P. M. H., & Jacobsen, S. (2008) · Veterinary Research Communications · doi:10.1007/s11259-008-9057-7 · Cited by 159
“Glucocorticoids released during stressful events are known to cause the observed changes in the leukogram (Weber et al. 2004), and leukocyte changes have previously been demonstrated in calves after transportation (Kent and Ewbank 1983,”
Background
Failure of Respiratory Defenses in the Pathogenesis of Bacterial Pneumonia of Cattle
Caswell, J. (2013) · Veterinary Pathology · doi:10.1177/0300985813502821 · Cited by 158
Cellular softening mediates leukocyte demargination and trafficking, thereby increasing clinical blood counts
Fay, M. E., Myers, D. R., Kumar, A., Turbyfield, C., Byler, R., Crawford, K., Mannino, R. G., Laohapant, A., Tyburski, E. A., Sakurai, Y., et al. (2016) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1508920113 · Cited by 113
“Furthermore, L- and P-selectin-deficient mice exhibit no abnormalities in leukocyte margination compared with wild type, suggesting additional mechanisms are likely involved (18, 19).”
Background
Gene Expression Control by Glucocorticoid Receptors during Innate Immune Responses
Xavier, A. M., Anunciato, A. K. O., Rosenstock, T. R., & Glezer, I. (2016) · Frontiers in Endocrinology · doi:10.3389/fendo.2016.00031 · Cited by 104
Review: Relationships between metabolism and neutrophil function in dairy cows in the peripartum period
LeBlanc, S. J. (2020) · animal · doi:10.1017/s1751731119003227 · Cited by 100
Depressed DHEA and increased sickness response behaviors in lame dairy cows with inflammatory foot lesions
de Almeida, P. E., Weber, P. S. D., Burton, J. L., & Zanella, A. J. (2007) · Domestic Animal Endocrinology · doi:10.1016/j.domaniend.2006.11.006 · Cited by 106
Self-citation
Effects of a Concentrated Lidocaine Solution on the Acute Phase Stress Response to Dehorning in Dairy Calves
Doherty, T. J., Kattesh, H. G., Adcock, R. J., Welborn, M. G., Saxton, A. M., Morrow, J. L., & Dailey, J. W. (2007) · Journal of Dairy Science · doi:10.3168/jds.2007-0080 · Cited by 89
“The increase in the neutrophil count in the early phase of glucocorticoid or stress-induced neutrophilia results primarily from the demargination of segmented neutrophils from blood vessels as a result of downregulation of surface adhesion molecule expression (Weber et al., 2004).”
Background
Transportation stress in young bulls alters expression of neutrophil genes important for the regulation of apoptosis, tissue remodeling, margination, and anti-bacterial function
Sporer, K. R. B., Burton, J. L., Earley, B., & Crowe, M. A. (2007) · Veterinary Immunology and Immunopathology · doi:10.1016/j.vetimm.2007.04.002 · Cited by 90
Self-citation
Glucocorticoid-loaded liposomes induce a pro-resolution phenotype in human primary macrophages to support chronic wound healing
Gauthier‐Kemper, A., Fisch, A., Seuwen, K., Baumgarten, B. U., Ruffner, H., Aebi, A., Rausch, M., Kiessling, F. M., Bartneck, M., Weiskirchen, R., et al. (2018) · Biomaterials · doi:10.1016/j.biomaterials.2018.04.006 · Cited by 80
Bovine neutrophils in health and disease
Bassel, L., & Caswell, J. (2018) · Cell and Tissue Research · doi:10.1007/s00441-018-2789-y · Cited by 81
“Glucocorticoids downregulated L-selectin expression in blood neutrophils through the glucocorticoid receptor (Weber et al. 2004).”
Background
Mastitis in Post‐Partum Dairy Cows
Pyörälä, S. (2008) · Reproduction in Domestic Animals · doi:10.1111/j.1439-0531.2008.01170.x · Cited by 76
“2002), and this loss has been associated with the elevated cortisol levels (Weber et al. 2004).”
Background
Endogenous glucocorticoids control neutrophil mobilization from bone marrow to blood and tissues in non‐inflammatory conditions
Cavalcanti, D. M. D. H., Lotufo, C. M. C., Borelli, P., Ferreira, Z. S., Markus, R. P., & Farsky, S. H. P. (2007) · British Journal of Pharmacology · doi:10.1038/sj.bjp.0707512 · Cited by 76
“…involved in these conditions seems to be related to a change in the longevity of the cell in the circulation induced by altering apoptosis (Chang et al., 2004; Madsen-Bouterse et al., 2006) or by impairing the synthesis and expression of L-selectin (Nakagawa et al., 1999; Weber et al., 2001, 2004).”
Background
Neutrophils in cardiovascular disease: warmongers, peacemakers, or both?
Sreejit, G., Johnson, J., Jaggers, R. M., Dahdah, A., Murphy, A. J., Hanssen, N. M. J., & Nagareddy, P. R. (2021) · Cardiovascular Research · doi:10.1093/cvr/cvab302 · Cited by 84
Emerging roles of neutrophil-borne S100A8/A9 in cardiovascular inflammation
Sreejit, G., Abdel‐Latif, A., Murphy, A. J., & Nagareddy, P. R. (2020) · Pharmacological Research · doi:10.1016/j.phrs.2020.105212 · Cited by 74
“The mechanisms that promotes demargination are unclear but likely involves shedding of L-selectin (CD62L)(42) on the surface of neutrophils by Adam17, a cysteine metalloproteinase(43, 44).”
Background
Examination of the bovine leukocyte environment using immunogenetic biomarkers to assess immunocompetence following exposure to weaning stress
O’Loughlin, A., McGee, M., Waters, S. M., Doyle, S., & Earley, B. (2011) · BMC Veterinary Research · doi:10.1186/1746-6148-7-45 · Cited by 73
Neutrophils Are Not Less Sensitive Than Other Blood Leukocytes to the Genomic Effects of Glucocorticoids
Hirsch, G., Lavoie‐Lamoureux, A., Beauchamp, G., & Lavoie, J. (2012) · PLoS ONE · doi:10.1371/journal.pone.0044606 · Cited by 62
“These findings are in agreement with, and extent the previous findings that GCs inhibits pro-inflammatory gene expression in neutrophils in different species [14,15,16,17,18,19,20].”
BackgroundResult
Effects of glucocorticoids on Fas gene expression in bovine blood neutrophils
Chang, L., Madsen‐Bouterse, S. A., Toelboell, T., Weber, P. S. D., & Burton, J. L. (2004) · Journal of Endocrinology · doi:10.1677/joe.1.05822 · Cited by 56
“Purification of bovine blood neutrophils Neutrophils were isolated from whole blood of all animals by Percoll density gradient centrifugation (Weber et al. 2001, 2004).”
MethodInfluentialSelf-citation
Saussurea lappa Ethanolic Extract Attenuates Triamcinolone Acetonide-Induced Pulmonary and Splenic Tissue Damage in Rats via Modulation of Oxidative Stress, Inflammation, and Apoptosis
El-Rahman, G. I. A., Behairy, A., Elseddawy, N. M., Batiha, G. E., Hozzein, W. N., Khodeer, D. M., & Abd‐Elhakim, Y. M. (2020) · Antioxidants · doi:10.3390/antiox9050396 · Cited by 55
“In addition, TA could delay neutrophils transmigration to the inflammatory sites via inhibition of leukocyte adhesion molecules [65].”
Background
Use of gene profiling to evaluate the effects of a feed additive on immune function in periparturient dairy cattle
Wang, Y., Puntenney, S. B., Burton, J. L., & Forsberg, N. E. (2008) · Journal of Animal Physiology and Animal Nutrition · doi:10.1111/j.1439-0396.2007.00780.x · Cited by 53
Self-citation
Transportation stress alters the circulating steroid environment and neutrophil gene expression in beef bulls
Sporer, K. R. B., Xiao, L., Tempelman, R. J., Burton, J. L., Earley, B., & Crowe, M. A. (2007) · Veterinary Immunology and Immunopathology · doi:10.1016/j.vetimm.2007.10.010 · Cited by 52
Self-citation
Differential expression analysis of proteins from neutrophils in the periparturient period and neutrophils from dexamethasone-treated dairy cows
Lippolis, J. D., Peterson-Burch, B. D., & Reinhardt, T. A. (2006) · Veterinary Immunology and Immunopathology · doi:10.1016/j.vetimm.2005.12.001 · Cited by 49
“Gene expression data have shown that mRNA from bovine neutrophils were differentially regulated at 0, 0.25 and 1 day postpartum (Burton et al., 2005; Madsen et al., 2004; Weber et al., 2004) with a trend that suggests return to normal levels by the time point we measured at day 3.”
BackgroundInfluential
Transcriptomic analysis of the stress response to weaning at housing in bovine leukocytes using RNA-seq technology
O’Loughlin, A., Lynn, D. J., McGee, M., Doyle, S., McCabe, M. S., & Earley, B. (2012) · BMC Genomics · doi:10.1186/1471-2164-13-250 · Cited by 49
“It has previously been reported that stress-induced cortisol surges inhibit CD62L (L-selectin) expression on bovine neutrophils, thus reducing endothelial adhesion and subsequent migration to sites of infection [19,44,45].”
Background
Ability of a commercial feed additive to modulate expression of innate immunity in sheep immunosuppressed with dexamethasone
Wang, Y., Puntenney, S. B., Burton, J. L., & Forsberg, N. E. (2007) · animal · doi:10.1017/s1751731107000365 · Cited by 49
Self-citation
Glucocorticoid Modulation of Bcl-2 Family Members A1 and Bak during Delayed Spontaneous Apoptosis of Bovine Blood Neutrophils
Madsen‐Bouterse, S. A., Rosa, G. J. M., & Burton, J. L. (2006) · Endocrinology · doi:10.1210/en.2006-0142 · Cited by 48
Self-citation
Analysis of the bovine neutrophil transcriptome during glucocorticoid treatment
Weber, P. S. D., Madsen‐Bouterse, S. A., Rosa, G. J. M., Sipkovsky, S., Ren, X., de Almeida, P. E., Kruska, R., Halgren, R. G., Barrick, J. L., & Burton, J. L. (2006) · Physiological Genomics · doi:10.1152/physiolgenomics.00094.2006 · Cited by 41
“AC-15: ab6276; Abcam) as the laneloading control (41, 73).”
BackgroundMethodInfluentialSelf-citation
Heterophil functional responses to dietary immunomodulators vary in genetically distinct chicken lines
Chuammitri, P., Redmond, S. B., Kimura, K., Andreasen, C. B., Lamont, S. J., & Palić, D. (2011) · Veterinary Immunology and Immunopathology · doi:10.1016/j.vetimm.2011.05.019 · Cited by 39
Adrenal deficiency alters mechanisms of neutrophil mobilization
Cavalcanti, D. M. D. H., Lotufo, C. M. C., Borelli, P., Tavassi, A. M. C., Pereira, A. L. M., Markus, R. P., & Farsky, S. H. P. (2006) · Molecular and Cellular Endocrinology · doi:10.1016/j.mce.2006.01.007 · Cited by 40
Effects of Ambient Temperature on Growth Performance, Blood Metabolites, and Immune Cell Populations in Korean Cattle Steers
Kang, H. J., Lee, I. K., Piao, M. Y., Gu, M. J., Yun, C., Kim, H. J., Kim, K. H., & Baik, M. (2016) · Asian-Australasian Journal of Animal Sciences · doi:10.5713/ajas.15.0937 · Cited by 39
Modulation of innate immune function and phenotype in bred dairy heifers during the periparturient period induced by feeding an immunostimulant for 60 days prior to delivery
Nace, E. L., Nickerson, S. C., Kautz, F. M., Breidling, S., Wochele, D. M., Ely, L. O., & Hurley, D. J. (2014) · Veterinary Immunology and Immunopathology · doi:10.1016/j.vetimm.2014.08.013 · Cited by 38
Neutrophil–lymphocyte ratio for the prediction of histological chorioamnionitis in cases of preterm premature rupture of membranes: a case-control study
Balčiūnienė, G., Kvederaite‐Budre, G., Gulbinienė, V., Dumalakienė, I., Vilienė, R., Pilypienė, I., Drąsutienė, G., & Ramašauskaitė, D. (2021) · BMC Pregnancy and Childbirth · doi:10.1186/s12884-021-04101-z · Cited by 37
The influence of reproductive physiology and nutrient supply on the periparturient relaxation of immunity to the gastrointestinal nematode Trichostrongylus colubriformis in Merino ewes
Beasley, A. M., Kahn, L., & Windon, R. G. (2012) · Veterinary Parasitology · doi:10.1016/j.vetpar.2012.03.022 · Cited by 34
Relationship between season, lactation number and incidence of clinical mastitis in different stages of lactation in a Holstein dairy farm.
Moosavi, M., Mirzaei, A., Ghavami, M., & Tamadon, A. (2014) · Europe PMC (PubMed Central) · Cited by 34
Gene expression profiling of peripheral mononuclear cells in lame dairy cows with foot lesions
de Almeida, P. E., Weber, P. S. D., Burton, J. L., Tempelman, R. J., Steibel, J. P., & Zanella, A. J. (2007) · Veterinary Immunology and Immunopathology · doi:10.1016/j.vetimm.2007.06.028 · Cited by 33
Self-citation
Genomic and non-genomic effects of dexamethasone on equine peripheral blood neutrophils
Lecoq, L., Vincent, P., Lavoie‐Lamoureux, A., & Lavoie, J. (2008) · Veterinary Immunology and Immunopathology · doi:10.1016/j.vetimm.2008.10.303 · Cited by 32
Dexamethasone Depletes γδT Cells and Alters the Activation State and Responsiveness of Bovine Peripheral Blood Lymphocyte Subpopulations
Menge, C., & Dean-Nystrom, E. A. (2008) · Journal of Dairy Science · doi:10.3168/jds.2007-0937 · Cited by 31
“Burton and colleagues discovered that DEX down-regulates CD18 and CD62L adhesion molecules on blood neutrophils in vivo by acting at the pretranslational level (Burton et al., 1995; Weber et al., 2001; Weber et al., 2004 ).”
Background
Endothelial cells: major players in acute myeloid leukaemia
Fodil, S., Arnaud, M., Vaganay, C., Puissant, A., Lengliné, É., Mooney, N., Itzykson, R., & Zafrani, L. (2022) · Blood Reviews · doi:10.1016/j.blre.2022.100932 · Cited by 29
Differential Ability of Bovine Antimicrobial Cathelicidins to Mediate Nucleic Acid Sensing by Epithelial Cells
Baumann, A., Kiener, M., Haigh, B., Perreten, V., & Summerfield, A. (2017) · Frontiers in Immunology · doi:10.3389/fimmu.2017.00059 · Cited by 29
An intensive milk replacer feeding program benefits immune response and intestinal microbiota of lambs during weaning
Zhang, Q., Li, C., Niu, X., Zhang, Z., Li, F., & Li, F. (2018) · BMC Veterinary Research · doi:10.1186/s12917-018-1691-x · Cited by 29
“Yet our findings are distinct from these studies [12, 38], in that the expression of CD62L significantly increased in all the experimental lambs after weaning.”
BackgroundResult
Down-regulation of NOD1 in neutrophils of periparturient dairy cows
Tan, X., Li, W., Guo, J., & Zhou, J. (2012) · Veterinary Immunology and Immunopathology · doi:10.1016/j.vetimm.2012.09.004 · Cited by 29
Effects of feeding an immunomodulatory supplement to heat-stressed or actively cooled cows during late gestation on postnatal immunity, health, and growth of calves
Skibiel, A. L., Fabris, T. F., Corrá, F. N., Torres, Y. M., McLean, D. J., Chapman, J. D., Kirk, D. J., Dahl, G. E., & Laporta, J. (2017) · Journal of Dairy Science · doi:10.3168/jds.2017-12619 · Cited by 28
“Leukocytosis is aided by a protein, Lselectin, on neutrophil cell surfaces that allows the cells to interact with vascular endothelial cells and migrate to the infected site (Weber et al., 2004).”
The effect of dexamethasone on clock gene mRNA levels in bovine neutrophils and lymphocytes
Nebzydoski, S. J., Pozzo, S., Nemec, L. M., Rankin, M. K., & Gressley, T. F. (2010) · Veterinary Immunology and Immunopathology · doi:10.1016/j.vetimm.2010.07.017 · Cited by 28
Effects of road transportation on metabolic and immunological responses in Holstein heifers
Kang, H., Lee, I. K., Piao, M. Y., Kwak, C. W., Gu, M. J., Yun, C., Kim, H., Ahn, H., Kim, H., Kim, G., et al. (2016) · Animal Science Journal · doi:10.1111/asj.12604 · Cited by 23
The Interaction of Vitamin D and Corticosteroids: A Mortality Analysis of 26,508 Veterans Who Tested Positive for SARS-CoV-2
Efird, J. T., Anderson, E. J., Jindal, C., Redding, T. S., Thompson, A. D., Press, A. M., Upchurch, J., Williams, C. D., Choi, Y. M., & Suzuki, A. (2021) · International Journal of Environmental Research and Public Health · doi:10.3390/ijerph19010447 · Cited by 23
Immune Response in Young Thoroughbred Racehorses under Training
Cappelli, K., Amadori, M., Mecocci, S., Miglio, A., Antognoni, M. T., & Razzuoli, E. (2020) · Animals · doi:10.3390/ani10101809 · Cited by 24
“Further studies on the expression levels of L-selectin in granulocytes will help characterize this haematological feature, in agreement with an established model in cattle [62].”
Result
Alterations in cortisol concentrations and expression of certain genes associated with neutrophil functions in cows developing retention of fetal membranes
Pathak, R., Prasad, S., Kumaresan, A., Kaur, M., Manimaran, A., & Dang, A. K. (2015) · Veterinary Immunology and Immunopathology · doi:10.1016/j.vetimm.2015.09.003 · Cited by 22
Effects of experimental immunosuppression in cattle with persistently high antibody levels to SalmonellaDublin lipopolysaccharide O-antigens
Lomborg, S. R., Agerholm, J. S., Jensen, A. L., & Nielsen, L. R. (2007) · BMC Veterinary Research · doi:10.1186/1746-6148-3-17 · Cited by 20
“Consequently, their migration into tissues is hindered and extravascular immunodepression develops [ 19 ].”
Differential Stress Responses among Newly Received Calves: Variations in Reductant Capacity and Hsp Gene Expression
Eitam, H., Vaya, J., Brosh, A., Orlov, A., Khatib, S., Izhaki, I., & Shabtay, A. (2010) · Cell Stress and Chaperones · doi:10.1007/s12192-010-0195-9 · Cited by 19
Low-dose antenatal betamethasone treatment achieves preterm lung maturation equivalent to that of the World Health Organization dexamethasone regimen but with reduced endocrine disruption in a sheep model of pregnancy
Usuda, H., Fee, E. L., Carter, S. W. D., Furfaro, L. L., Takahashi, T., Takahashi, Y., Newnham, J. P., Milad, M. A., Saito, M., Jobe, A. H., et al. (2022) · American Journal of Obstetrics and Gynecology · doi:10.1016/j.ajog.2022.06.058 · Cited by 19
The mechanics of myeloid cells
Bashant, K. R., Toepfner, N., Day, C. J., Mehta, N. N., Kaplan, M. J., Summers, C., Guck, J. R., & Chilvers, E. R. (2020) · Biology of the Cell · doi:10.1111/boc.201900084 · Cited by 19
“Historically, this phenomenon has been attributed to down-regulation of selectins and other adhesion molecules [Weber et al., 2004], though some evidence refutes this [Doyle et al., 1997; Jilma and Stohlawetz, 1998].”
Result
Effect of Bosentan on Plasma Markers of Endothelial Cell Activity in Patients with Secondary Pulmonary Hypertension Related to Connective Tissue Diseases
Cella, G., Vianello, F., Cozzi, F., Marotta, H., Tona, F., Saggiorato, G., Iqbal, O. J., & Fareed, J. (2009) · The Journal of Rheumatology · doi:10.3899/jrheum.080542 · Cited by 18
Genetic Variation in Bovine Mononuclear Leukocyte Responses to Dexamethasone
Saama, P. M., Jacob, J. B., Kehrli, M. E., Freeman, A. E., Kelm, S. C., Kuck, A. L., Tempelman, R. J., & Burton, J. L. (2004) · Journal of Dairy Science · doi:10.3168/jds.s0022-0302(04)73532-8 · Cited by 17
“…trafficking patterns of blood B cells, γδ T cells, and neutrophils (Oldham and Howard, 1992; Burton and Kehrli, 1996; Anderson et al., 1999) and profoundly affect the expression of neutrophil CD62L and CD18 adhesion molecules (Cronstein et al., 1992; Burton et al., 1995; Weber et al., 2001, 2004).”
BackgroundInfluentialSelf-citation
Host genetics and tumor environment determine the functional impact of neutrophils in mouse tumor models
van Elsas, M. J., Kleinovink, J. W., Moerland, M., Feiss, G. L., Beyrend, G., Arens, R., Mei, H., Nibbering, P. H., Jirka, S. M. G., van Hall, T., et al. (2020) · Journal for ImmunoTherapy of Cancer · doi:10.1136/jitc-2020-000877 · Cited by 15
Dietary L-Carnitine Affects Leukocyte Count and Function in Dairy Cows Around Parturition
Kononov, S. U., Meyer, J., Frahm, J., Kersten, S., Kluess, J., Bühler, S., Wegerich, A., Rehage, J., Meyer, U., Huber, K., et al. (2022) · Frontiers in Immunology · doi:10.3389/fimmu.2022.784046 · Cited by 14
“A glucocorticoid induced downregulation of surface adhesion molecule expression (31, 41) may thus also be involved in the observed neutrophilia.”
Background
Effects of dexamethasone treatment and respiratory vaccination on rectal temperature, complete blood count, and functional capacities of neutrophils in beef steers
Hughes, H. D., Carroll, J. A., Sanchez, N. C. B., Roberts, S. L., Broadway, P. R., May, N. D., Ballou, M., & Richeson, J. T. (2017) · Journal of Animal Science · doi:10.2527/jas.2017.1374 · Cited by 14
Blood leukocyte composition and function in periparturient ewes kept on different dietary magnesium supply
Ahmed, M. H., Wilkens, M. R., Möller, B., Ganter, M., Breves, G., & Schuberth, H. (2020) · BMC Veterinary Research · doi:10.1186/s12917-020-02705-9 · Cited by 12
Short Communication: A Potential Antiapoptotic Phenotype in Neutrophils of Cows Milked Once Daily in Early Lactation
Keane, C., Hanlon, A. J., Roche, J. F., Burton, J. L., Mee, J. F., O’Doherty, J. V., & Sweeney, T. (2006) · Journal of Dairy Science · doi:10.3168/jds.s0022-0302(06)72168-3 · Cited by 12
“et al., 2004; Weber et al., 2004 ) and other stressful situations (Yagi et al., 2004), blood cortisol concentrations were not correlated (P > 0.05) with the gene expression changes or blood neutrophil counts we observed in the current study.”
BackgroundMethodResultInfluentialSelf-citation
Pretreatment neutrophil-to-lymphocyte ratio as an important prognostic marker in stage III locally advanced non-small cell lung cancer: confirmatory results from the PROCLAIM phase III clinical trial
Biswas, T., Gawdi, R., Jindal, C., Iyer, S., Kang, K. H., Bajor, D. J., Machtay, M. X., Choi, Y. M., & Efird, J. T. (2021) · Journal of Thoracic Disease · doi:10.21037/jtd-21-1018 · Cited by 14
Target gene expression signatures in neutrophils and lymphocytes from cattle administered with dexamethasone at growth promoting purposes
Lopparelli, R. M., Giantin, M., Pozza, G., Stefani, A. L., Ravarotto, L., Montesissa, C., & Dacasto, M. (2011) · Research in Veterinary Science · doi:10.1016/j.rvsc.2011.07.004 · Cited by 11
Glucocorticoids: Inflammation and Immunity
Petrillo, M. G., Bortner, C. D., & Cidlowski, J. A. (2016) · Springer eBooks · doi:10.1007/978-3-319-45950-9_3 · Cited by 10
L-selectin gene polymorphism and its association with clinical mastitis, somatic cell score, and milk production in Polish Holstein-Friesian cattle
Dusza, M., Pokorska, J., Makulska, J., Kułaj, D., & Cupiał, M. (2018) · Czech Journal of Animal Science · doi:10.17221/96/2017-cjas · Cited by 10
“It was proved that inhibiting or modifying the L-selectin expression on neutrophils has negative effect on progression of the inflammatory response during bacterial infection (Weber et al. 2004).”
Background
Neutropaenia in early rheumatoid arthritis: frequency, predicting factors, natural history and outcome
Fragoulis, G. E., Paterson, C., Gilmour, A., Derakhshan, M. H., McInnes, I. B., Porter, D. R., & Siebert, S. (2018) · RMD Open · doi:10.1136/rmdopen-2018-000739 · Cited by 10
“Data analysis and interpretation: geF, cP, ag, MHD, iBM, DP, SS. Drafting the article: geF, cP, ag, MHD. critical revision of the article: iBM, DP, SS. Final approval of the version to be published: geF, cP, ag, MHD, iBM, DP, SS.”
Effect of intramammary infusion of rbGM-CSF on SCC and expression of polymorphonuclear neutrophil adhesion molecules in subclinical mastitis cows
Ozawa, T., Kiku, Y., Mizuno, M., Inumaru, S., Kushibiki, S., Shingu, H., Matsubara, T., Takahashi, H., & Hayashi, T. (2011) · Veterinary Research Communications · doi:10.1007/s11259-011-9506-6 · Cited by 10
Exercise duration modulates upper and lower respiratory fluid cellularity, antiviral activity, and lung gene expression
Elkhatib, S. K., Alley, J., Jepsen, M., Smeins, L., Barnes, A., Naik, S., Ackermann, M. R., Verhoeven, D. E., & Kohut, M. L. (2021) · Physiological Reports · doi:10.14814/phy2.15075 · Cited by 10
“Glucocorticoids have metabolic effects, yet glucocorticoids may also downregulate L- selectin, or enhance L- selectin shedding, contributing to increased circulating neutrophils (Weber et al., 2004).”
Background
Trapped Neutrophil Syndrome in a Border Collie
Hegler, A. K., Grooters, A. M., Dehghanpir, S. D., Gallaher, R. A., & Gaschen, L. E. (2020) · Journal of the American Animal Hospital Association · doi:10.5326/jaaha-ms-6981 · Cited by 9
Lymphocyte Counts are Dynamic and Associated with Survival after Transcatheter Aortic Valve Replacement
Al-Kindi, S. G., Attizzani, G. F., DeCicco, A. E., Alkhalil, A., Nmai, C., Longenecker, C. T., Parikh, S. A., Lederman, M. M., Dalton, J. E., & Zidar, D. A. (2018) · Structural Heart · doi:10.1080/24748706.2018.1522680 · Cited by 8
Multiorgan neutrophilic inflammation in a Border Collie with “trapped” neutrophil syndrome
Zoto, A., Stecklein, C., Scott, M. A., Bauer, T. R., Lucidi, C. A., & Cridge, H. (2022) · Journal of Veterinary Internal Medicine · doi:10.1111/jvim.16567 · Cited by 8
Immune System Remodelling by Prenatal Betamethasone: Effects on β-Cells and Type 1 Diabetes
Perna‐Barrull, D., Gieras, A., Rodríguez-Fernández, S., Tolosa, E., & Vives‐Pi, M. (2020) · Frontiers in Endocrinology · doi:10.3389/fendo.2020.00540 · Cited by 9
Combined approaches to reduce stress and improve livestock well-being: A review
Shabtay, A. (2025) · Cell Stress and Chaperones · doi:10.1016/j.cstres.2025.100091 · Cited by 10
Simmental × Holstein crossbred: comparison of immunological traits with parental breeds during peripartum and early lactation period
Scatà, M. C., Grandoni, F., Barile, V. L., Catillo, G., & MATTEIS, G. D. (2020) · Journal of Dairy Research · doi:10.1017/s0022029920000928 · Cited by 7
“During peripartum period, hormonal and physiological changes reduce their cellular activity, as well as the migration to infection sites with consequent increase in peripheral blood (Weber et al., 2004; Meglia et al., 2005).”
Background
Bovine Surgery of the Skin
Miesner, M. D. (2008) · Veterinary Clinics of North America Food Animal Practice · doi:10.1016/j.cvfa.2008.06.001 · Cited by 6
Gene Expression and Resistance to Glucocorticoid-Induced Apoptosis in Acute Lymphoblastic Leukemia: A Brief Review and Update
Lambrou, G. Ι., Adamaki, M., Hatziagapiou, K., & Vlahopoulos, S. (2020) · Current Drug Research Reviews · doi:10.2174/2589977512666200220122650 · Cited by 6
Prenatal Betamethasone interferes with immune system development and alters target cells in autoimmune diabetes
Perna‐Barrull, D., Rodríguez-Fernández, S., Pujol‐Autonell, I., Gieras, A., Ampudia, R. M., Villalba, A., Glau, L., Tolosa, E., & Vives‐Pi, M. (2019) · Scientific Reports · doi:10.1038/s41598-018-37878-9 · Cited by 6
The Correlation between Play Behavior, Serum Cortisol and Neutrophil-to-Lymphocyte Ratio in Welfare Assessment of Dairy Calves within the First Month of Life
Ogi, A., Campera, M., Ienco, S., Bonelli, F., Mariti, C., & Gazzano, A. (2021) · Dairy · doi:10.3390/dairy3010001 · Cited by 5
“In fact, it is well established that stressful events cause a glucocorticoids release which is responsible for leukogram changes [37,38].”
Background
Integumentary and Dental Surgery
Miesner, M. D., Niehaus, A. J., Nichols, S., & Anderson, D. E. (2013) · Elsevier eBooks · doi:10.1016/b978-1-4377-2352-6.00063-8 · Cited by 3
Effects of dexamethasone on leukocytic responses in pregnant Yankasa ewes and Sahel does in Maiduguri, Nigeria
Yahi, D., Ojo, N., Mshelia, G. D., Maina, V. A., & Mahre, M. B. (2017) · Sokoto Journal of Veterinary Sciences · doi:10.4314/sokjvs.v14i3.6 · Cited by 2
Edematous Bullae: An Atypical Presentation of Reperfusion Injury. A Discussion of Ischemic-reperfusion Injury and Presentation of an Atypical Case
Saran, M. S., & Malarkey, S. (2019) · Cureus · doi:10.7759/cureus.5376 · Cited by 2
Neuroendocrinology of Inflammatory Disorders
Marketon, J. I. W., & Sternberg, E. M. (2007) · Neuroimmune biology · doi:10.1016/s1567-7443(07)00217-7 · Cited by 2
Hematological and iron-related parameters in a dual-purpose local cattle breed compared to the specialized Italian Friesian breed during transition and lactation periods
Petrera, F., & Abeni, F. (2018) · Comparative Clinical Pathology · doi:10.1007/s00580-018-2675-8 · Cited by 2
“…surface expression of adhesion molecules (Burton et al. 1995; Weber et al. 2004; Cavalcanti et al. 2007) and accelerating NEUmaturation in the bone marrow and their transfer in the peripheral compartments (Lee and Kehrli Jr 1998; Meglia et al. 2001; Weber et al. 2004; Cavalcanti et al. 2006, 2007).”
Background
Anisocytosis and leukocytosis are independently related to survival after transcatheter aortic valve replacement
Attizzani, G. F., Al-Kindi, S. G., Dalton, J. E., Alkhalil, A., DeCicco, A. E., Mayuga, M., Funderburg, N., Blackstone, E. H., Parikh, S. A., Longenecker, C. T., et al. (2018) · Journal of Cardiovascular Medicine · doi:10.2459/jcm.0000000000000624 · Cited by 2
Prepartum maternal cortisol concentrations on postnatal cortisol concentration and immunoglobulin absorption in neonatal dairy calves
Wooley, D. (2010) · doi:10.31390/gradschool_theses.4124 · Cited by 2
“Glucocorticoid-induced suppression of L-selectin, which accompanies neutrophila, is likely mediated by a direct effect of glucocorticoid receptor activation on intracellular reservoirs of L-selectin mRNA, occurring predominantly in blood neutrophils (Weber et al., 2004).”
Background
Neutrophil-Derived S100A8/A9 in Cardiovascular Disease and Beyond
Rao, R. S., Panbhukarasu, S., Waleed, M., Raichel, C. R. C., Rahman, K., Sivakumar, K., & Athmanathan, B. (2023) · Current Pharmacology Reports · doi:10.1007/s40495-023-00328-w · Cited by 1
“However, the exact mechanisms which induce demargination remain unclear, but found ectodomain shedding of L-selectin (CD62L) on the surface of neutrophils by Adam 17, a disintegrin and cysteine metalloproteinase [24–26].”
Background
The effect of 1 year of trilostane treatment on peripheral lymphocyte subsets in dogs with pituitary-dependent hyperadrenocorticism
Oda, H., Mori, A., Shono, S., Onozawa, E., & Sako, T. (2016) · Journal of Veterinary Medical Science · doi:10.1292/jvms.15-0410 · Cited by 1
“In addition, endogenous glucocorticoids accelerate neutrophil maturation in the bone marrow and transference into the peripheral compartment, resulting in neutrocytosis [5, 22].”
Background
Effects of Dexamethasone on Pulmonary Oxygenation Impairments in Therapeutic Hypothermia for Patients with Traumatic Brain Injury
Umakoshi, M. A. K. (2013) · Journal of Neurology & Neurophysiology · doi:10.4172/2155-9562.1000164 · Cited by 1
“Glucocorticoids, including dexamethasone, have been traditionally recognized as immunosuppressive hormones [21], and they downregulate the expression of genes involved in neutrophil trafficking to inflamed tissues [22, 23].”
ACTH impairs the migratory and secretory profile of mononuclear cells during proestrus in cattle
Etchevers, L., Renna, M. S., Belotti, E. M., Díaz, P. U., Salvetti, N. R., Ortega, H. H., & Amweg, A. N. (2023) · Research in Veterinary Science · doi:10.1016/j.rvsc.2023.105031 · Cited by 1
Physiological and Immunological Tools and Techniques for the Assessment of Cattle Welfare
Earley, B., Sporer, K. R. B., O’Loughlin, A., & Johnston, D. (2023) · Animal welfare · doi:10.1007/978-3-031-21020-4_3 · Cited by 1
Effects of genetic background and dietary immunomodulators on chicken heterophil function and Salmonella resistance
Chuammitri, P. (2010) · Iowa State University Digital Repository (Iowa State University) · doi:10.31274/etd-180810-1847 · Cited by 1
Physiological genomics special issue on animal functional genomics
Burton, J. L., & Rosa, G. J. M. (2006) · Physiological Genomics · doi:10.1152/physiolgenomics.00220.2006 · Cited by 1
“Physiol Genomics • VOL 28 • www.physiolgenomics.org on August 24, 2007 physiolgenomics.physiology.org Downloaded from glucocorticoid-challenged cattle (9, 72, 73 ).”
BackgroundMethodInfluentialSelf-citation
Animal Transport: Developing optimum animal handling procedures and effective transport strategies in the food production chain to improve animal welfare and food quality
Earley, B., Murray, M., & Prendiville, D. J. (2007) · Arrow@dit (Dublin Institute of Technology) · Cited by 1
Alternative strategies and new insights into immunology, health, and performance of dairy cattle
da Silva, T. H. (2021) · doi:10.11606/t.74.2021.tde-03052021-141531 · Cited by 1
Examination of the effect of weaning stress on the physiological and molecular regulation of immune function in circulating bovine leukocytes
O’Loughlin, A. (2011) · Maynooth University ePrints and eTheses Archive (Maynooth University) · Cited by 1
Effect of single versus group housing from the first week of life on the performance, immune responses, and well-being of Holstein calves.
Cobb, C. J. (2012) · ThinkTech (Texas Tech University)
Mecanismos moleculares da ação dos glicocorticóides endógenos e da anexina-A1 sobre o tráfego de neutrófilos: caracterização da ação sobre os eixos SDF-1α/CXCR4 e IL-17/IL-23/G-CSF
Machado, I. D. (2013) · Digital Library of Theses and Dissertations (Universidade de São Paulo) · doi:10.11606/t.9.2013.tde-27022014-105135
Efeitos dos ligantes de TSPO sobre a migração leucocitária: participação de receptores de glicorticóides
de Lima, C. B. (2012) · Digital Library of Theses and Dissertations (Universidade de São Paulo) · doi:10.11606/t.9.2012.tde-11042013-170253
Effect of Relocation on Parlor Behaviors and Stress in Jerseys and Holsteins
Wilkes, C. O., McGilliard, M. L., Bečvář, O., Knowlton, K. F., & Gwazdauskas, F. C. (2009) · The Professional Animal Scientist · doi:10.15232/s1080-7446(15)30728-2
“BE663861 TFAR-19 TC228511 0.0100 Forward: CCAACAAACAGAAAAGAAAACAACA 128 ( 73 )”
BackgroundMethodInfluential

Authors: Weber, P. S. D., Toelboell, T., Chang, L.-C., Tirrell, J. D., Saama, P. M., Smith, G. W., & Burton, J. L.
Affiliations: Immunogenetics Laboratory , East Lansing
Michigan State University (US)
Corresponding author: Burton, Jeanne L
ORCID: Chang, Ling-Chu
Venue: Journal of Leukocyte Biology
Publisher: Oxford University Press (OUP)
Published: 2004-02-03
Volume: 75
Issue: 5
Pages: 815-827
ISSN: 0741-5400 (ISSN-L)
1938-3673
DOI: 10.1189/jlb.1003505
OpenAlex: W2162667045
Cited by: 113
References: 62
Citations by year: 2025: 1 · 2023: 3 · 2022: 4 · 2021: 7 · 2020: 15 · 2019: 4 · 2018: 10 · 2017: 5 · 2016: 7 · 2015: 1 · 2014: 5 · 2013: 4 · 2012: 8
FWCI: 3.56
Type: journal article
Language: en
Open access: closed
Licence: academic.oup.com/pages/standard-publication-reuse-rights (vor)
Locations: Journal of Leukocyte Biology (publishedVersion)
PubMed (publishedVersion)
Funders: USDA-NRI (#01-35204-10798)
Michigan Agricultural Experiment Station (#MICL 01836)
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Endocrinology › Estrogen and related hormone effects
Health Sciences › Medicine › Immunology and Allergy › Cell Adhesion Molecules Research
Life Sciences › Immunology and Microbiology › Immunology › Neutrophil, Myeloperoxidase and Oxidative Mechanisms
Keywords: glucocorticoids, L-selectin, neutrophils, cattle, dexamethasone, glucocorticoid receptor, gene expression regulation, neutrophilia, bone marrow neutrophils, anti-inflammatory activity, RU486, mRNA expression
MeSH terms: Animals, Blood Cells, Cattle, Dexamethasone, Glucocorticoids, Neutrophils, Receptors, Glucocorticoid, RNA, Messenger, Transcription, Genetic, Down-Regulation, L-Selectin

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Mechanisms of glucocorticoid-induced down-regulation of neutrophil L-selectin in cattle: evidence for effects at the gene-expression level and primarily on blood neutrophils

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Citations

Cites

Cited by

Related

Metadata

Record

About these checks