Cited by 298Genomics and Phylogenetic StudiesGut microbiota and healthMicrobial Community Ecology and Physiology

The DOI matches its Crossref record; 39 of the 39 references it cites were found in a registry or an index.

Evaluation of 16S rDNA-Based Community Profiling for Human Microbiome Research

Open access

Jumpstart Consortium Human Microbiome Project Data Generation Working Group·2012·PLoS ONE

DOI 10.1371/journal.pone.0039315PMC PMC3374619

Open this paper in CoChat — free account Open PDF

Abstract

The Human Microbiome Project will establish a reference data set for analysis of the microbiome of healthy adults by surveying multiple body sites from 300 people and generating data from over 12,000 samples. To characterize these samples, the participating sequencing centers evaluated and adopted 16S rDNA community profiling protocols for ABI 3730 and 454 FLX Titanium sequencing. In the course of establishing protocols, we examined the performance and error characteristics of each technology, and the relationship of sequence error to the utility of 16S rDNA regions for classification- and OTU-based analysis of community structure. The data production protocols used for this work are those used by the participating centers to produce 16S rDNA sequence for the Human Microbiome Project. Thus, these results can be informative for interpreting the large body of clinical 16S rDNA data produced for this project.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1371/journal.pone.0039315

Cites

39 of 39 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

The Sequence Alignment/Map format and SAMtools
Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R., & 1000 Genome Project Data Processing Subgroup (2009) · Bioinformatics · doi:10.1093/bioinformatics/btp352 · Cited by 62,041
Fast and accurate short read alignment with Burrows-Wheeler transform
Li, H., & Durbin, R. (2009) · Bioinformatics · doi:10.1093/bioinformatics/btp324 · Cited by 58,607
Introducing mothur: Open-Source, Platform-Independent, Community-Supported Software for Describing and Comparing Microbial Communities
Schloss, P. D., Westcott, S. L., Ryabin, T., Hall, J. R., Hartmann, M., Hollister, E. B., Lesniewski, R. A., Oakley, B. B., Parks, D. H., Robinson, C. J., et al. (2009) · Applied and Environmental Microbiology · doi:10.1128/aem.01541-09 · Cited by 21,481
Naive Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy
Wang, Q., Garrity, G. M., Tiedje, J. M., & Cole, J. R. (2007) · Applied and Environmental Microbiology · doi:10.1128/aem.00062-07 · Cited by 20,145
Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample
Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Lozupone, C., Turnbaugh, P. J., Fierer, N., & Knight, R. D. (2010) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1000080107 · Cited by 9,944
A core gut microbiome in obese and lean twins
Turnbaugh, P. J., Hamady, M., Yatsunenko, T., Cantarel, B. L., Duncan, A., Ley, R. E., Sogin, M. L., Jones, W. J., Roe, B. A., Affourtit, J. P., et al. (2009) · Nature · doi:10.1038/nature07540 · Cited by 7,823
Vaginal microbiome of reproductive-age women
Ravel, J., Gajer, P., Abdo, Z., Schneider, G. M., Koenig, S. S. K., McCulle, S. L., Karlebach, S., Gorle, R., Russell, J., Tacket, C. O., et al. (2011) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1002611107 · Cited by 4,254
Chimeric 16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCR ampliconsPreprint
Haas, B. J., Gevers, D., Earl, A. M., Feldgarden, M., Ward, D. V., Giannoukos, G., Ciulla, D., Tabbaa, D., Highlander, S. K., Sodergren, E. J., et al. (2011) · Genome Research · doi:10.1101/gr.112730.110 · Cited by 3,527
Bacterial Community Variation in Human Body Habitats Across Space and Time
Costello, E. K., Lauber, C. L., Hamady, M., Fierer, N., Gordon, J. I., & Knight, R. (2009) · Science · doi:10.1126/science.1177486 · Cited by 3,231
Topographical and Temporal Diversity of the Human Skin Microbiome
Grice, E. A., Kong, H. H., Conlan, S., Deming, C. B., Davis, J., Young, A. C., Program, N. C. S., Bouffard, G. G., Blakesley, R. W., Murray, P. R., et al. (2009) · Science · doi:10.1126/science.1171700 · Cited by 2,953

Flagged first, then by citations

Show all 38 references

Sorted by citations

Items 201–298 of 298

The Microbiome in Infectious Diseases
Mitreva, M. (2016) · Elsevier eBooks · doi:10.1016/b978-0-7020-6285-8.00008-3 · Cited by 16
The Human Microbiome
Highlander, S. K., Versalovic, J. A., & Petrosino, J. F. (2011) · Wiley eBooks · doi:10.1128/9781555816728.ch13 · Cited by 14
Research on Neonatal Microbiomes: What Neonatologists Need to Know
Sherman, M. P., Minnerly, J. C., Curtiss, W. J., Rangwala, S. H., & Kelley, S. T. (2013) · Neonatology · doi:10.1159/000354944 · Cited by 13
The importance of environmental microbes for Drosophila melanogaster during seasonal macronutrient variability
Davies, L. R., Loeschcke, V., Schou, M. F., Schramm, A., & Kristensen, T. N. (2021) · Scientific Reports · doi:10.1038/s41598-021-98119-0 · Cited by 13
Dynamics of Microbial Communities in Phototrophic Polyhydroxyalkanoate Accumulating Cultures
Almeida, J. R., Fradinho, J. C., Carvalho, G., Oehmen, A., & Reis, M. A. M. (2022) · Microorganisms · doi:10.3390/microorganisms10020351 · Cited by 13
Microbiome analysis – from technical advances to biological relevance
Smith, M. I., Turpin, W., Tyler, A. D., Silverberg, M. S., & Croitoru, K. (2014) · F1000Prime Reports · doi:10.12703/p6-51 · Cited by 12
Feasibility of Co-Treating Olive Mill Wastewater and Acid Mine Drainage
Carlier, J., Luís, A. T., Alexandre, L. M., & Costa, M. C. (2020) · Mine Water and the Environment · doi:10.1007/s10230-020-00719-1 · Cited by 12
“(2012) and using primers (27F: AGA GTT TGA TCC TGG CTC AG and 534R: ATT ACC GCG GCT GCTGG) adapted from the Human Gut Consortium (Ward et al. 2012).”
Method
Two accurate sequence, structure, and phylogenetic template-based RNA alignment systems
Shang, L., Gardner, D. P., Xu, W., Cannone, J. J., Miranker, D. P., Ozer, S., & Gutell, R. R. (2013) · BMC Systems Biology · doi:10.1186/1752-0509-7-s4-s13 · Cited by 12
High diversity of alpha, beta and gamma human papillomaviruses in genital samples from HIV-negative and HIV-positive heterosexual South African men
Meiring, T. L., Mbulawa, Z. Z. A., Lesosky, M., Coetzee, D. J., & Williamson, A. (2017) · Papillomavirus Research · doi:10.1016/j.pvr.2017.05.001 · Cited by 12
Microbial dark matter sequences verification in amplicon sequencing and environmental metagenomics data
Barak, H., Fuchs, N., Liddor-Naim, M., Nir, I., Sivan, A., & Kushmaro, A. (2023) · Frontiers in Microbiology · doi:10.3389/fmicb.2023.1247119 · Cited by 12
Comparison of different cultures and culturing conditions for the biological deterioration of organic load from real saline bilge wastewater: microbial diversity insights and ecotoxicity assessment
Mazioti, A. A., Vasquez, M. I., & Vyrides, I. (2021) · Environmental Science and Pollution Research · doi:10.1007/s11356-021-13153-9 · Cited by 11
Mock Community Analysis
Highlander, S. K. (2014) · Springer eBooks · doi:10.1007/978-1-4614-6418-1_54-1 · Cited by 11
Influence of dietary protein and fiber intake interactions on the human gut microbiota composition and function: a systematic review and network meta-analysis of randomized controlled trials
Mak, I. E. K., Yao, Y., Ng, M. T. T., & Kim, J. E. (2025) · Critical Reviews in Food Science and Nutrition · doi:10.1080/10408398.2025.2452362 · Cited by 13
Integrating the milk microbiome signatures in mastitis: milk-omics and functional implications
Reuben, R. C., & Torres, C. (2025) · World Journal of Microbiology and Biotechnology · doi:10.1007/s11274-024-04242-1 · Cited by 11
Probiotics Do Not Alter the Long-Term Stability of the Supragingival Microbiota in Healthy Subjects: A Randomized Controlled Trial
Lundtorp-Olsen, C., Enevold, C., Twetman, S., & Belstrøm, D. (2021) · Pathogens · doi:10.3390/pathogens10040391 · Cited by 11
The Human Microbiome: An Acquired Organ?
Dhanaraju, R., & Rao, D. N. (2022) · Resonance · doi:10.1007/s12045-022-1312-7 · Cited by 11
Geographic social vulnerability is associated with the alpha diversity of the human microbiome
Farmer, N. M., Maki, K. A., Barb, J. J., Jones, K. K., Yang, L., Baumer, Y., Powell‐Wiley, T. M., & Wallen, G. R. (2023) · mSystems · doi:10.1128/msystems.01308-22 · Cited by 10
Algorithms for inferring multiple microbial networks
Tavakoli, S., & Yooseph, S. (2019) · IEEE International Conference on Bioinformatics and Biomedicine (BIBM) · doi:10.1109/bibm47256.2019.8983194 · Cited by 9
Are all faecal bacteria detected with equal efficiency? A study using next-generation sequencing and quantitative culture of infants' faecal samples
Sjöberg, F., Nookaew, I., Yazdanshenas, S., Gio-Batta, M., Adlerberth, I., & Wold, A. E. (2020) · Journal of Microbiological Methods · doi:10.1016/j.mimet.2020.106018 · Cited by 10
The neonatal microbiome in utero and beyond: perinatal influences and long-term impacts
Hill, L., Sharma, R., Hart, L., Popov, J., Moshkovich, M., & Pai, N. (2021) · Journal of Laboratory Medicine · doi:10.1515/labmed-2021-0131 · Cited by 11
“Genus-level taxonomy is generally the limit of bacterial classification through 16S rRNA sequencing techniques [26].”
Background
Pacific bioscience sequence technology: Review
Aliy, M. A., Bayeta, S., & Takale, W. (2022) · International Journal of Veterinary Science and Research · doi:10.17352/ijvsr.000108 · Cited by 10
Comparative analysis of microbiome measurement platforms using latent variable structural equation modeling
Wu, X., Berkow, K. S., Frank, D. N., Li, E., Gulati, A., & Zhu, W. (2013) · BMC Bioinformatics · doi:10.1186/1471-2105-14-79 · Cited by 9
Potential applications of metagenomics to assess the biological effects of food structure and function
Santiago-Rodríguez, T. M., Cano, R. J., & Jiménez‐Flores, R. (2016) · Food & Function · doi:10.1039/c6fo00317f · Cited by 12
Application of Taxonomic Modeling to Microbiota Data Mining for Detection of Helminth Infection in Global Populations
Torbati, M. E., Mitreva, M., & Gopalakrishnan, V. (2016) · Data · doi:10.3390/data1030019 · Cited by 8
The impact of cefuroxime prophylaxis on human intestinal microbiota in surgical oncological patients
Văcărean-Trandafir, I.-C., Amărandi, R.-M., Ivanov, I. C., Iacob, Ș., Mușină, A.-M., Bărgăoanu, E.-R., & Dimofte, M. (2023) · Frontiers in Microbiomes · doi:10.3389/frmbi.2022.1092771 · Cited by 8
Recovery of microbial community profile information hidden in chimeric sequence reads
Ho, M., Moon, D., Pires-Alves, M., Thornton, P. D., McFarlin, B. L., & Wilson, B. A. (2021) · Computational and Structural Biotechnology Journal · doi:10.1016/j.csbj.2021.08.050 · Cited by 7
“However, the conclusions reached in those reports lack consistency and instead appear to apply only for the samples used in those particular studies, since previous studies noted that discrepancies in abundances for certain phyla were dependent on primer targets [23].”
Result
Isolation Methods of Dental Pulp Stem Cells
Yıldırım, S. (2012) · SpringerBriefs in stem cells · doi:10.1007/978-1-4614-5687-2_5 · Cited by 8
Selection for stress tolerance and longevity in Drosophila melanogaster have strong impacts on microbiome profiles
Kristensen, T. N., Schönherz, A. A., Rohde, P. D., Sørensen, J. G., & Loeschcke, V. (2024) · Scientific Reports · doi:10.1038/s41598-024-68753-5 · Cited by 9
Improved methanization and microbial diversity during batch mode cultivation with repetition of substrate addition using defined organic matter and marine sediment inoculum at seawater salinity
Miura, T., Kita, A., Okamura, Y., Aki, T., Matsumura, Y., Tajima, T., Kato, J., & Nakashimada, Y. (2017) · Bioresource Technology · doi:10.1016/j.biortech.2017.09.009 · Cited by 7
Design and Optimization of Microbial Fuel Cells and Evaluation of a New Air-Breathing Cathode Based on Carbon Felt Modified with a Hydrogel—Ion Jelly®
Carvalho, R. N. L., Monteiro, L., Sousa, S. A., Ramanaiah, S. V., Leitão, J. H., Cordas, C. M., & Fonseca, L. P. (2023) · Energies · doi:10.3390/en16104238 · Cited by 7
Can DNA sequencing show differences between microbial communities in Polish and Danish wastewater treatment plants?
Miłobędzka, A., & Muszyński, A. (2017) · Water Science & Technology · doi:10.2166/wst.2017.015 · Cited by 7
The azithromycin to prevent wheezing following severe RSV bronchiolitis-II clinical trial: Rationale, study design, methods, and characteristics of study population
Srinivasan, M., Bacharier, L. B., Goss, C. W., Zhou, Y., Boomer, J. S., Bram, S., Burgdorf, D., Burnham, C. D., Casper, T. J., Castro, M., et al. (2021) · Contemporary Clinical Trials Communications · doi:10.1016/j.conctc.2021.100798 · Cited by 7
Canine and Feline Microbiomes
Wallis, C. V., Marshall-Jones, Z. V., Deusch, O., & Hughes, K. R. (2017) · Springer eBooks · doi:10.1007/978-981-10-5050-3_17 · Cited by 6
Targeted and Highly Multiplexed Detection of Microorganisms by Employing an Ensemble of Molecular Probes
Xu, W., Krishnakumar, S., Miranda, M., Jensen, M. A., Fukushima, M., Palm, C. J., Fung, E., Davis, R. W., St.Onge, R. P., & Hyman, R. W. (2014) · Applied and Environmental Microbiology · doi:10.1128/aem.00666-14 · Cited by 6
Steps in Metagenomics: Let’s Avoid Garbage in and Garbage Out
Izard, J. (2014) · Elsevier eBooks · doi:10.1016/b978-0-12-410472-3.00001-4 · Cited by 7
Grundlegende Aspekte zum Hautmikrobiom
Mikolajczyk, R., & Roesner, L. M. (2019) · Der Hautarzt · doi:10.1007/s00105-019-4412-x · Cited by 7
International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons
Olson, N. D., Lund, S. P., Zook, J. M., Rojas-Cornejo, F., Beck, B. J., Foy, C. A., Huggett, J. F., Whale, A. S., Sui, Z., Baoutina, A., et al. (2015) · Biomolecular Detection and Quantification · doi:10.1016/j.bdq.2015.01.004 · Cited by 5
Invited Commentary: Improving the Accessibility of Human Microbiome Project Data Through Integration With R/Bioconductor
Griffith, J. C., & Morgan, X. C. (2019) · American Journal of Epidemiology · doi:10.1093/aje/kwz007 · Cited by 5
A Combination of qPCR, RT-qPCR and NGS Provides a New Tool for Analyzing MIC Risk in Pipelines
Thomsen, U. S., Kahns, S., & Oehler, M. C. (2018) · NACE CORROSION Conference · doi:10.5006/c2018-11103 · Cited by 4
Closed aerobic biodegradation kinetics test with activated sludge and low concentration chemical mixtures
Birch, H., Teixeira, A., van Egmond, R., & Mayer, P. (2023) · Chemosphere · doi:10.1016/j.chemosphere.2023.138752 · Cited by 4
Le mycobiome humain : actualités et perspectives
Botterel, F., Angebault, C., & Bougnoux, M. (2015) · Revue Francophone des Laboratoires · doi:10.1016/s1773-035x(15)72823-6 · Cited by 4
The Human Microbiome
Versalovic, J. A., Highlander, S. K., & Petrosino, J. F. (2015) · ASM Press eBooks · doi:10.1128/9781555817381.ch15 · Cited by 4
Microbiome diversity in carriers of fluoroquinolone resistantEscherichia coli
Liss, M. A., Leach, R. J., Rourke, E. J., Sherrill, A., Johnson‐Pais, T. L., Lai, Z., Basler, J. W., White, J. R., & PATTERSON, J. E. (2019) · Korean journal of urology · doi:10.4111/icu.2019.60.2.75 · Cited by 3
Microbiota - The Unseen Players in Adult Asthmatic Airways
Öztürk, A. B., Ranjan, R., Rani, A., Yazıcı, D., & Bavbek, S. (2020) · Turkish Thoracic Journal · doi:10.5152/turkthoracj.2020.19085 · Cited by 3
Temporal Modulation of Gut Microbiome and Metabolome by Morphine
Wang, F. (2015) · University of Minnesota Digital Conservancy (University of Minnesota) · Cited by 3
Strong experimental support for the hologenome hypothesis revealed from Drosophila melanogaster selection linesPreprint
Kristensen, T. N., Schönherz, A. A., Rohde, P. D., Sørensen, J. G., & Loeschcke, V. (2021) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2021.09.09.459587 · Cited by 3
“Bacterial 16S V1-V3 rRNA libraries were prepared using a custom protocol based on Caporaso et al. (2012) and amplified using V1-V3 specific primers: [27F] AGAGTTTGATCCTGGCTCAG and [534R] ATTACCGCGGCTGCTGG [45].”
Method
Engineering artificial biosynthetic pathway enables simultaneous production and in-situ bio-dyeing of indigoids for textiles
Na, Q., Zhang, X., Long, L., Qi, S., Zhang, Z., Zhi, R., Tan, Z., Ying, H., & Zhu, C. (2025) · Nature Communications · doi:10.1038/s41467-025-67935-7 · Cited by 2
Enfoque metagenómico para la caracterización del microbioma de aves corral. Revisión
Mantilla, M. J., & Torres, R. G. (2019) · Revista Colombiana de Biotecnología · doi:10.15446/rev.colomb.biote.v21n2.78390 · Cited by 2
Biofilm thickness restraint carriers enhance free nitrous acid inhibition for partial nitritation
Schopf, A., Christensson, M., Piculell, M., Tian, X., & Delatolla, R. (2022) · Water Quality Research Journal · doi:10.2166/wqrj.2022.025 · Cited by 2
Isolation, Cryopreservation, and Differentiation Methods of DPSC
Yıldırım, S. (2024) · Springer eBooks · doi:10.1007/978-1-0716-4244-3_7 · Cited by 2
The guide through brain-gut-enteric microbiota axis - regulation pathways and related disorders
Kolasińska, K., Kwiatkowski, S., Knap, B., Czerwiński, G., Poniewierka, E., & Waszczuk, E. (2018) · World Scientific News · Cited by 2
Distributions and Interactions in Three Groups of Polar Marine Plankton
Cleary, A. C. (2015) · doi:10.23860/diss-cleary-alison-2015 · Cited by 2
Optimal protocols for sequence-based characterization of the human vaginal microbiomePreprint
Hugerth, L. W., Pereira, M., Zha, Y., Seifert, M., Kaldhusdal, V., Boulund, F., Krog, M. C., Bashir, Z., Hamsten, M., Fransson, E., et al. (2020) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2020.05.05.079996 · Cited by 2
Network analyses unraveled the complex interactions in the rumen microbiota associated with methane emission in dairy cattle
Ye, X., Sahana, G., Lund, M. S., Li, B., & Cai, Z. (2025) · Animal Microbiome · doi:10.1186/s42523-025-00386-z · Cited by 4
CHANGES IN THE HUMAN SKIN MICROBIOME OVER ONE YEAR’S TIME
Hyman (2012) · Current Research in Microbiology · doi:10.3844/ajmsp.2012.18.30 · Cited by 1
Usage of Cultured Human Fecal Microbiota for Colonization of Caenorhabditis elegans to Study Host–Microbe Interaction
Møller, K. V., Wesseltoft, J. B., Malazarte, R., Kousgaard, S. J., Nielsen, H. L., Yashiro, E., & Olsen, A. (2023) · Applied Microbiology · doi:10.3390/applmicrobiol3040078 · Cited by 1
Successful Evolution of a Patient with Obesity, Metabolic Syndrome and Severe Gastro esophageal Reflux after Probiotic Intake
Vázquez, C. (2015) · Advances in Obesity Weight Management & Control · doi:10.15406/aowmc.2015.02.00009 · Cited by 1
Application of 16s rDNA Sequencing in the Analysis of Pathogenic Bacteria in Sputum of Severe Bacterial Pneumonia
Zheng, J., Zhu, J., Chen, B., Chen, L., Gao, T., Chen, X., & Huang, T. (2021) · Advances in Microbiology · doi:10.4236/aim.2021.112008 · Cited by 1
Taxonomic and functional analysis of metagenomes
Barbosa, P. (2013) · Portuguese National Funding Agency for Science, Research and Technology (RCAAP Project by FCT) · Cited by 1
Genetic control of methane emission, feed efficiency and metagenomics in dairy cattle
Difford, G. F. (2018) · doi:10.18174/458036 · Cited by 1
Human Microbiome and Disease
Meštrović, T., & Patterson, J. (2021) · Elsevier eBooks · doi:10.1016/b978-0-12-818731-9.00145-2 · Cited by 1
Mock Community Analysis
Highlander, S. K. (2015) · Springer eBooks · doi:10.1007/978-1-4899-7478-5_54 · Cited by 1
Mapping the Environmental Microbiome
Lim, S. J. (2024) · Elsevier eBooks · doi:10.1016/b978-0-323-95502-7.00242-6 · Cited by 1
Novel method of probe design for characterising unclassified microbial taxa in wastewater
Tan, S. M. (2017) · doi:10.32657/10356/72486
The Bacterial Blood Microbiota/Microbiome
Burd, E. M., & Westblade, L. F. (2017) · doi:10.1128/9781555819811.ch13 · Cited by 1
Development of a novel fertilizer-drawn forward osmosis and anaerobic membrane bioreactor hybrid system for hydroponics
Kim, Y. (2017) · OPUS - Open Publications of UTS Scholars (University of Technology Sydney)
Identifying accurate metagenome and amplicon software via a meta-analysis of sequence to taxonomy benchmarking studiesPreprint
Gardner, P. P., Watson, R. J., Morgan, X. C., Draper, J. L., Finn, R. D., Morales, S. E., & Stott, M. B. (2017) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/202077
Selective Enrichment Through Capture (SEC): A Technology for Retrieving Specific DNA Sequences from Complex Mixtures
Núñez, K. (2015) · doi:10.31390/gradschool_dissertations.514
Estudio del papel de las amebas de vida libre como reservorio de Helicobacter pylori y otras bacterias patógenas en aguas y alimentos mediante técnicas moleculares
Moreno‐Mesonero, L. (2018) · doi:10.4995/thesis/10251/111952
Peer Review #2 of "Ultraviolet disinfection impacts the microbial community composition and function of treated wastewater effluent and the receiving urban river (v0.2)"
(2019) · PeerJ · doi:10.7287/peerj.7455v0.2/reviews/2
Peer Review #2 of "Ultraviolet disinfection impacts the microbial community composition and function of treated wastewater effluent and the receiving urban river (v0.1)"
(2019) · PeerJ · doi:10.7287/peerj.7455v0.1/reviews/2
Mikrobiyota ve Yoğun Bakım
Küçük, M. P., & Ülger, F. (2019) · Türk yoğun bakım derneği dergisi/Türk yoğun bakım dergisi · doi:10.4274/tybd.galenos.2019.70883
Metagenomics in One Health — from standardization to targeted application
Hallmaier–Wacker, L. K. (2020) · doi:10.53846/goediss-7952
Practical considerations for the study of the oral microbiome
Yu, Y., Lee, S.-Y., & Na, H. S. (2020) · International Journal of Oral Biology · doi:10.11620/ijob.2020.45.3.77
PhD dissertation to infer multiple networks from microbial dataPreprint
Tavakoli, S. (2020) · arXiv (Cornell University) · doi:10.48550/arxiv.2010.05909
Application of 16S rDNA Sequencing Technology in the Analysis of Pathogenic Bacteria in Sputum of Severe Pneumonia
Zheng, J., Zhu, J., Chen, B., Chen, L., Gao, T., Chen, X., & Li, F. (2021) · Advances in Microbiology · doi:10.4236/aim.2021.113011
Benefits of Probiotics on Mortality, Growth Performance, Physiological Condition and Gut Histomophology of Juvenile Red Drum (Sciaenops ocellatus)
Busby, W. A. (2021) · doi:10.12794/metadc1808465
Microbial Diversity and Classification
Wilkinson, R. C. (2021) · Elsevier eBooks · doi:10.1016/b978-0-12-818731-9.00055-0
Determinación del riesgo para el consumidor de la presencia de H. pylori y otros Helicobacter spp. patógenos en aguas de consumo mediante técnicas moleculares y metagenómica
Martín, I. (2021) · doi:10.4995/thesis/10251/178942
Molecular Microbiology
Nolte, F. S. (2018) · Elsevier eBooks · doi:10.1016/b978-0-12-816061-9.00005-9
Microbiota y su relación en el cáncer
Ordóñez, G. D. B., Anguisaca, C. F. O., & Carpio, C. A. M. (2021) · Revista del Centro de Investigación de la Universidad la Salle · doi:10.26457/recein.v14i56.2853
Peer Review #2 of "Identifying accurate metagenome and amplicon software via a meta-analysis of sequence to taxonomy benchmarking studies (v0.1)"
(2019) · PeerJ · doi:10.7287/peerj.6160v0.1/reviews/2
Peer Review #1 of "Identifying accurate metagenome and amplicon software via a meta-analysis of sequence to taxonomy benchmarking studies (v0.1)"
(2019) · PeerJ · doi:10.7287/peerj.6160v0.1/reviews/1
Peer Review #1 of "Ultraviolet disinfection impacts the microbial community composition and function of treated wastewater effluent and the receiving urban river (v0.2)"
(2019) · PeerJ · doi:10.7287/peerj.7455v0.2/reviews/1
Peer Review #1 of "Ultraviolet disinfection impacts the microbial community composition and function of treated wastewater effluent and the receiving urban river (v0.1)"
(2019) · PeerJ · doi:10.7287/peerj.7455v0.1/reviews/1
Peer Review #1 of "Identifying accurate metagenome and amplicon software via a meta-analysis of sequence to taxonomy benchmarking studies (v0.2)"
(2019) · PeerJ · doi:10.7287/peerj.6160v0.2/reviews/1
The human gastroinstestinal tract microbiota in health – current knowledge summary
Prylińska, M., & Kożuchowski, M. (2022) · Journal of Education Health and Sport · doi:10.12775/jehs.2022.12.10.005
Functional Applications of Human Microbiome Diversity Studies
Nkera-Gutabara, C. K., Hurrell, T., & Naidoo, J. (2024) · Elsevier eBooks · doi:10.1016/b978-0-443-13320-6.00039-1
Bioluminescent monitoring of a co-culture model of pathogen growth to identify a novel probiotic bacterium
Gallo, P. H., Kathju, A., & Satish, L. (2025) · BMC Research Notes · doi:10.1186/s13104-025-07459-x
Le microbiote du DEMODEX associé à la rosacée
Murillo, N. (2013) · theses.fr (ABES) · doi:10.70675/dcf98ceez075az46e7zae25z312e3ebde022
Analysing the effect of industrial and urban polluted zones on microbial diversity in the SaiGon -DongNai river system (Vietnam)
Nguyen, T. T. N. (2017) · doi:10.70675/26be2f96z9475z41aez8a2fzd774dd996b0e
Métagénomique comparative de novo à grande échelle
Benoit, G. (2017) · theses.fr (ABES) · doi:10.70675/d94aaf7dz9964z49edzbfa8z80a1309d7172
Impact des antibiotiques sur le phageome intestinal humain : de la méthode à l’application
Humières, C. D. (2020) · theses.fr (ABES) · doi:10.70675/446d185dz2709z49cez954cz53533f91495b
The diagnostic potential of combined quantitative polymerase chain reaction and next-generation sequencing using the same primers for periprosthetic joint infection
Ueda, N., Inoue, J., Okuda, K., & Iida, H. (2026) · Microbiology Spectrum · doi:10.1128/spectrum.04128-25
Meta-Analysis of Vaginal Microbiome Data Provides New Insights On Preterm Birth
Sirota, M. (2019) · ImmPort · doi:10.21430/m3tryb4whx
Vaginal Virome and Preterm Birth (See companion study SDY1206)
Stout, M. (2019) · ImmPort · doi:10.21430/m31k9qn0om
FAIRsharing record for: NIH Human Microbiome Project
FAIRsharing Team, & Lister, A. (2018) · FAIRsharing.org · doi:10.25504/fairsharing.q04phv
Disability in the Post-Obese Bariatric Patient: Old and New Problems
Faintuch, J., de Souza, S. A. F., Fabris, S. M., Rosenblatt, A., & Cecconello, I. (2013) · Springer eBooks · doi:10.1007/978-3-642-35972-9_13

Authors: Jumpstart Consortium Human Microbiome Project Data Generation Working Group
Affiliations: University of Maryland, Baltimore (US)
Corresponding author: Jumpstart Consortium Human Microbiome Project Data Generation Working Group
Venue: PLoS ONE
Publisher: Public Library of Science (PLoS)
Published: 2012-06-13
Volume: 7
Issue: 6
Pages: e39315
ISSN: 1932-6203 (ISSN-L)
DOI: 10.1371/journal.pone.0039315
PMC: PMC3374619
OpenAlex: W2319405466
Cited by: 297
References: 38
Citations by year: 2026: 2 · 2025: 5 · 2024: 5 · 2023: 8 · 2022: 6 · 2021: 22 · 2020: 17 · 2019: 27 · 2018: 22 · 2017: 35 · 2016: 31 · 2015: 39 · 2014: 31 · 2013: 34 · 2012: 12
FWCI: 14.90
Type: journal article
Language: en
Open access: gold
doi.org
Licence: cc-by
creativecommons.org/licenses/by/4.0/ (unspecified)
Locations: PLoS ONE (publishedVersion, cc-by)
PubMed Central (publishedVersion, cc-by)
PubMed (publishedVersion)
DOAJ (DOAJ: Directory of Open Access Journals) (submittedVersion)
Figshare (submittedVersion, cc-by)
Funders: Broad Institute
National Institutes of Health
U.S. Public Health Service (HHSN2722009000018C)
National Human Genome Research Institute (U54HG004969, U54HG003079, U01HG004866, U54HG003273, U54HG004968, U54HG004973)
National Institute of Allergy and Infectious Diseases (HHSN272200900018C, HHSN272200900001C, HHSN272200900008C, U54AI084844)
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Phylogenetic Studies
Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Gut microbiota and health
Physical Sciences › Environmental Science › Ecology › Microbial Community Ecology and Physiology
Keywords: 16S rRNA gene, human microbiome, Human Microbiome Project, sequencing errors, community structure, reference dataset
MeSH terms: Bacteria, Bayes Theorem, Humans, RNA, Ribosomal, 16S, Metagenome

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Evaluation of 16S rDNA-Based Community Profiling for Human Microbiome Research

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks