Chromosome conformation capture (from 3C to 5C) and its ChIP-based modification
Abstract
Chromosome conformation capture (3C) methodology was developed to study spatial organization of long genomic regions in living cells. Briefly, chromatin is fixed with formaldehyde in vivo to cross-link interacting sites, digested with a restriction enzyme and ligated at a low DNA concentration so that ligation between cross-linked fragments is favored over ligation between random fragments. Ligation products are then analyzed and quantified by PCR. So far, semi-quantitative PCR methods were widely used to estimate the ligation frequencies. However, it is often important to estimate the ligation frequencies more precisely which is only possible by using the real-time PCR. At the same time, it is equally necessary to monitor the specificity of PCR amplification. That is why the real-time PCR with TaqMan probes is becoming more and more popular in 3C studies. In this chapter, we describe the general protocol for 3C analysis with the subsequent estimation of ligation frequencies by using the real-time PCR technology with TaqMan probes. We discuss in details all steps of the experimental procedure paying special attention to weak points and possible ways to solve the problems. A special attention is also paid to the problems in interpretation of the results and necessary control experiments. Besides, in theory, we consider other approaches to analysis of the ligation products used in frames of the so-called 4C and 5C methods. The recently developed chromatin immunoprecipitation (ChIP)-loop assay representing a combination of 3C and ChIP is also discussed.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
A variety of assays now exist to capture three-dimensional architecture, including various adaptations of chromosome conformation capture (3C).
“A variety of assays now exist to capture this three-dimensional architecture, including various adaptations of chromosome conformation capture (3C) [179].”
From Genetic architecture of Alzheimer's disease (2020) · cites this paper as [179]
Cites
Capturing Chromosome Conformation
Dekker, J., Rippe, K., Dekker, M., & Kleckner, N. (2002) · Science · doi:10.1126/science.1067799 · Cited by 3,652 · see citing works
Simonis, M., Klous, P., Splinter, E., Moshkin, Y., Willemsen, R., de Wit, E., van Steensel, B., & de Laat, W. (2006) · Nature Genetics · doi:10.1038/ng1896 · Cited by 1,386 · see citing works
Looping and Interaction between Hypersensitive Sites in the Active β-globin Locus
Tolhuis, B., Palstra, R.-J., Splinter, E., Grosveld, F., & de Laat, W. (2002) · Molecular Cell · doi:10.1016/s1097-2765(02)00781-5 · Cited by 1,344 · see citing works
Dostie, J., Richmond, T., Arnaout, R., Selzer, R. R., Lee, W. L., Honan, T., Rubio, E. D., Krumm, A., Lamb, J., Nusbaum, C., et al. (2006) · Genome Research · doi:10.1101/gr.5571506 · Cited by 1,182 · see citing works
Zhao, Z., Tavoosidana, G., Sjölinder, M., Göndör, A., Mariano, P., Wang, S., Kanduri, C., Lezcano, M., Sandhu, K. S., Singh, U., et al. (2006) · Nature Genetics · doi:10.1038/ng1891 · Cited by 957 · see citing works
Interchromosomal associations between alternatively expressed loci
Spilianakis, C. G., Lalioti, M. D., Town, T., Lee, G. R., & Flavell, R. A. (2005) · Nature · doi:10.1038/nature03574 · Cited by 726 · see citing works
CTCF mediates long-range chromatin looping and local histone modification in the β-globin locus
Splinter, E., Heath, H., Kooren, J., Palstra, R.-J., Klous, P., Grosveld, F., Galjart, N., & de Laat, W. (2006) · Genes & Development · doi:10.1101/gad.399506 · Cited by 677 · see citing works
Loss of silent-chromatin looping and impaired imprinting of DLX5 in Rett syndrome
Horike, S., Cai, S., Miyano, M., Cheng, J., & Kohwi-shigematsu, T. (2004) · Nature Genetics · doi:10.1038/ng1491 · Cited by 585 · see citing works
The β-globin nuclear compartment in development and erythroid differentiation
Palstra, R.-J., Tolhuis, B., Splinter, E., Nijmeijer, R., Grosveld, F., & de Laat, W. (2003) · Nature Genetics · doi:10.1038/ng1244 · Cited by 559 · see citing works
Cai, S., Lee, C. C., & Kohwi-shigematsu, T. (2006) · Nature Genetics · doi:10.1038/ng1913 · Cited by 547 · see citing works
Kurukuti, S., Tiwari, V. K., Tavoosidana, G., Pugacheva, E., Murrell, A., Zhao, Z., Lobanenkov, V., Reik, W., & Ohlsson, R. (2006) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0600326103 · Cited by 511 · see citing works
Proximity among Distant Regulatory Elements at the β-Globin Locus Requires GATA-1 and FOG-1
Vakoc, C. R., Letting, D. L., Gheldof, N., Sawado, T., Bender, M. A., Groudine, M., Weiss, M. J., Dekker, J., & Blobel, G. A. (2005) · Molecular Cell · doi:10.1016/j.molcel.2004.12.028 · Cited by 490 · see citing works
Integrative analysis of the cancer transcriptome
Rhodes, D. R., & Chinnaiyan, A. M. (2005) · Nature Genetics · doi:10.1038/ng1570 · Cited by 490 · see citing works
CTCF Mediates Interchromosomal Colocalization Between Igf2/H19 and Wsb1/Nf1
Ling, J. Q., Li, T., Hu, J., Vu, T. H., Chen, H. L., Qiu, X. W., Cherry, A. M., & Hoffman, A. R. (2006) · Science · doi:10.1126/science.1123191 · Cited by 434 · see citing works
Long-range intrachromosomal interactions in the T helper type 2 cytokine locus
Spilianakis, C. G., & Flavell, R. A. (2004) · Nature Immunology · doi:10.1038/ni1115 · Cited by 425 · see citing works
The three 'C' s of chromosome conformation capture: controls, controls, controls
Dekker, J. (2005) · Nature Methods · doi:10.1038/nmeth823 · Cited by 347 · see citing works
Vernimmen, D., Gobbi, M. D., Sloane‐Stanley, J. A., Wood, W. G., & Higgs, D. R. (2007) · The EMBO Journal · doi:10.1038/sj.emboj.7601654 · Cited by 244 · see citing works
Würtele, H., & Chartrand, P. (2006) · Chromosome Research · doi:10.1007/s10577-006-1075-0 · Cited by 147 · see citing works
3C Technology: Analyzing the Spatial Organization of Genomic Loci In Vivo
Splinter, E., Grosveld, F. G., & de Laat, W. L. (2003) · Methods in enzymology on CD-ROM/Methods in enzymology · doi:10.1016/s0076-6879(03)75030-7 · Cited by 121 · see citing works
Liu, Z., & Garrard, W. T. (2005) · Molecular and Cellular Biology · doi:10.1128/mcb.25.8.3220-3231.2005 · Cited by 120 · see citing works
Zhou, G., Xin, L., Song, W., Di, L., Liu, G., Wu, X., Liu, D., & Liang, C. (2006) · Molecular and Cellular Biology · doi:10.1128/mcb.02454-05 · Cited by 110 · see citing works
Dynamic alterations in the conformation of the Ifng gene region during T helper cell differentiation
Eivazova, E. R., & Aune, T. M. (2003) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0303919101 · Cited by 59 · see citing works
Spatial configuration of the chicken α-globin gene domain: immature and active chromatin hubs
Gavrilov, A. A., & Razin, S. V. (2008) · Nucleic Acids Research · doi:10.1093/nar/gkn429 · Cited by 48 · see citing works
Göndör, A., & OHLSSON, R. I. (2006) · Nature Genetics · doi:10.1038/ng1106-1229 · Cited by 10 · see citing works
Flagged first, then by citations
Cited by
Sorted by citations
Enhancer function: new insights into the regulation of tissue-specific gene expression
Ong, C.-T., & Corces, V. G. (2011) · Nature Reviews Genetics · doi:10.1038/nrg2957 · Cited by 929 · see citing works
Next-generation genomics: an integrative approach
Hawkins, R. D., Hon, G. C., & Ren, B. (2010) · Nature Reviews Genetics · doi:10.1038/nrg2795 · Cited by 591 · see citing works
Genome organization in and around the nucleolus
Németh, A., & Längst, G. (2011) · Trends in Genetics · doi:10.1016/j.tig.2011.01.002 · Cited by 208 · see citing works
Insulators and promoters: closer than we think
Raab, J. R., & Kamakaka, R. T. (2010) · Nature Reviews Genetics · doi:10.1038/nrg2765 · Cited by 171 · see citing works
DNA–protein interactions: methods for detection and analysis
Dey, B., Thukral, S., Krishnan, S., Chakrobarty, M., Gupta, S., Manghani, C., & Rani, V. (2012) · Molecular and Cellular Biochemistry · doi:10.1007/s11010-012-1269-z · Cited by 159 · see citing works
“The precipitated chromatin is then allowed to ligate and is further analyzed by quantitative PCR as in standard 3C experiments [111].”
MethodGene Regulatory Elements, Major Drivers of Human Disease
Chatterjee, S., & Ahituv, N. (2017) · Annual Review of Genomics and Human Genetics · doi:10.1146/annurev-genom-091416-035537 · Cited by 136 · see citing works
Bacterial transcriptomics: what is beyond the RNA horiz-ome?
Güell, M., Yus, E., Lluch‐Senar, M., & Serrano, L. G. (2011) · Nature Reviews Microbiology · doi:10.1038/nrmicro2620 · Cited by 126 · see citing works
Genetic architecture of Alzheimer's disease
Neuner, S. M., TCW, J., & Goate, A. M. (2020) · Neurobiology of Disease · doi:10.1016/j.nbd.2020.104976 · Cited by 126 · see citing works
“A variety of assays now exist to capture this three-dimensional architecture, including various adaptations of chromosome conformation capture (3C) (Gavrilov et al., 2009).”
BackgroundHamamoto, R., Komatsu, M., Takasawa, K., Asada, K., & Kaneko, S. (2019) · Biomolecules · doi:10.3390/biom10010062 · Cited by 126 · see citing works
Coordination of KSHV Latent and Lytic Gene Control by CTCF-Cohesin Mediated Chromosome Conformation
Kang, H., Wiedmer, A., Yuan, Y., Robertson, E. S., & Lieberman, P. M. (2011) · PLoS Pathogens · doi:10.1371/journal.ppat.1002140 · Cited by 112 · see citing works
“out essentially as described in Vassetzky et al [59] with minor modification.”
MethodDavison, L. J., Wallace, C., Cooper, J. D., Cope, N. F., Wilson, N. K., Smyth, D. J., Howson, J. M. M., Saleh, N. M., Aljeffery, A., Angus, K. L., et al. (2011) · Human Molecular Genetics · doi:10.1093/hmg/ddr468 · Cited by 107 · see citing works
“Taken together, there is now clear justification not only for the evaluation of the mechanism(s) by which DEXI might protect against autoimmune disease, but also for the development and use of 3C techniques involving next-generation sequencing, on a genome-wide scale, such as ChIA-PET (45), HiC (46) and 5C (47) in mul…”
BackgroundProgesterone Receptor Regulation of Uterine Adaptation for Pregnancy
Wu, S., Li, R., & DeMayo, F. J. (2018) · Trends in Endocrinology and Metabolism · doi:10.1016/j.tem.2018.04.001 · Cited by 102 · see citing works
A distant trophoblast-specific enhancer controls HLA-G expression at the maternal–fetal interface
Ferreira, L. M. R., Meissner, T. B., Mikkelsen, T. S., Mallard, W., O’Donnell, C. W., Tilburgs, T., Gomes, H. A. B., Camahort, R., Sherwood, R. I., Gifford, D. K., et al. (2016) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1602886113 · Cited by 97 · see citing works
Kartikasari, A. E. R., Zhou, J. X., Kanji, M. S., Chan, D. N., Sinha, A., Grapin‐Botton, A., Magnuson, M. A., Lowry, W. E., & Bhushan, A. (2013) · The EMBO Journal · doi:10.1038/emboj.2013.78 · Cited by 90 · see citing works
“Tbx3 (Han et al., 2010) GAATTGTACATAGCTGGATTTCAAGAGAATCCAGCTATGTACAATTC”
Single nucleotide polymorphisms in clinics: Fantasy or reality for cancer?
Srinivasan, S., Clements, J. A., & Batra, J. (2015) · Critical Reviews in Clinical Laboratory Sciences · doi:10.3109/10408363.2015.1075469 · Cited by 85 · see citing works
Transcription factories in the context of the nuclear and genome organization
Razin, S. V., Gavrilov, A. A., Pichugin, A., Lipinski, M., Iarovaia, O. V., & Vassetzky, Y. S. (2011) · Nucleic Acids Research · doi:10.1093/nar/gkr683 · Cited by 68 · see citing works
Spatial confinement is a major determinant of the folding landscape of human chromosomes
Gürsoy, G., Xu, Y., Kenter, A. L., & Liang, J. (2014) · Nucleic Acids Research · doi:10.1093/nar/gku462 · Cited by 61 · see citing works
Du, M., Yuan, T., Schilter, K. F., Dittmar, R. L., Mackinnon, A. C., Huang, X., Tschannen, M., Worthey, E. A., Jacob, H. J., Xia, S., et al. (2014) · Human Molecular Genetics · doi:10.1093/hmg/ddu426 · Cited by 61 · see citing works
“Adjacent fragment ligation frequency was used to normalize the different loading, fixation and ligation efficiencies between different cell lines (63,64).”
MethodCheng, P.-Y., Lin, Y., Chen, Y., Lee, Y., Tai, C.-C., Wang, Y.-T., Chen, Y., Kao, C.-F., & Yu, J. (2011) · PLoS ONE · doi:10.1371/journal.pone.0022018 · Cited by 56 · see citing works
“We also combined the 3C with ChIP (using p300 as a ChIP antibody) in a ChIP-loop assay [68] that presumably allowed us to determine which genomic sites would interact and how the candidate proteins mediate the interactions.”
MethodDevelopmental Regulation of Chromatin Conformation by Hox Proteins in Drosophila
Agelopoulos, M., McKay, D. J., & Mann, R. S. (2012) · Cell Reports · doi:10.1016/j.celrep.2012.03.003 · Cited by 48 · see citing works
“Standard ChIP experiments with whole embryos, including 3C and its derivatives (Gavrilov et al., 2009), cannot discriminate between these two scenarios because they do not distinguish cells that express Dll from cells where Dll is repressed.”
BackgroundIdentification of c-Myb Target Genes in K562 Cells Reveals a Role for c-Myb as a Master Regulator
Lorenzo, P. I., Brendeford, E. M., Gilfillan, S., Gavrilov, A. A., Ledsaak, M., Razin, S. V., Eskeland, R., Sæther, T., & Gabrielsen, O. S. (2011) · Genes & Cancer · doi:10.1177/1947601911428224 · Cited by 41 · see citing works
The Current Status and Challenges in Computational Analysis of Genomic Big Data
Qin, Y., Yalamanchili, H. K., Qin, J., Yan, B., & Wang, J. (2015) · Big Data Research · doi:10.1016/j.bdr.2015.02.005 · Cited by 39 · see citing works
“Thus, 3C can be laborious, so 4C (circular 3C) [55] and 5C (3C-Carbon Copy) [56] are developed to screen interaction partners for some selected genome sites at the whole genome [57].”
BackgroundTranscriptional network control of normal and leukaemic haematopoiesis
Sive, J. I., & Göttgens, B. (2014) · Experimental Cell Research · doi:10.1016/j.yexcr.2014.06.021 · Cited by 33 · see citing works
Expression-Dependent Folding of Interphase Chromatin
Jerabek, H., & Heermann, D. W. (2012) · PLoS ONE · doi:10.1371/journal.pone.0037525 · Cited by 30 · see citing works
Regulation of HDL Genes: Transcriptional, Posttranscriptional, and Posttranslational
Kardassis, D., Gafencu, A. V., Zannis, V. I., & Dávalos, A. (2014) · Handbook of experimental pharmacology · doi:10.1007/978-3-319-09665-0_3 · Cited by 30 · see citing works
“Furthermore, using new powerful methodologies such as chromosome conformation capture (3C) and its derivatives, we are at a position to monitor dynamic intra- and interchromosomal interactions that allow the optimal expression of genes at a given time and space (Gavrilov et al. 2009; Wei et al. 2013).”
MethodEnhancer Dysfunction in 3D Genome and Disease
Xia, J., & Wei, G. (2019) · Cells · doi:10.3390/cells8101281 · Cited by 26 · see citing works
“In addition, its derivatives, circular chromosome conformation capture (4C) and circular chromosome conformation capture carbon copy (5C), respectively, are used to examine the interaction at one genomic location with any other genomic locations throughout the whole genome [48,49].”
BackgroundInfluentialKSHV Topologically Associating Domains in Latent and Reactivated Viral Chromatin
Campbell, M., Chantarasrivong, C., Yanagihashi, Y., Inagaki, T., Davis, R., Nakano, K., Kumar, A., Tepper, C., & Izumiya, Y. (2022) · bioRxiv · doi:10.1128/jvi.00565-22 · Cited by 21 · see citing works
“(45) with a single restriction enzyme digestion prior to library”
MethodActual Ligation Frequencies in the Chromosome Conformation Capture Procedure
Gavrilov, A. A., Golov, A. K., & Razin, S. V. (2013) · PLoS ONE · doi:10.1371/journal.pone.0060403 · Cited by 25 · see citing works
“In a conventional 3C experiment, ligation frequencies are determined by qPCR with amplicons spanning ligation junctions of interest and expressed in units reflecting the relative amounts of the ligation products [4,5].”
MethodJerabek, H., & Heermann, D. W. (2014) · International review of cytology · doi:10.1016/b978-0-12-800046-5.00010-2 · Cited by 25 · see citing works
Pharmacogene regulatory elements: from discovery to applications
Smith, R. P., Lam, E. T., Markova, S., Yee, S. W., & Ahituv, N. (2012) · Genome Medicine · doi:10.1186/gm344 · Cited by 23 · see citing works
“Th ese looping interactions can be identifi ed through techniques such as chromatin conformation capture (3C) and several of its derivatives (4C [125], 5C [126]).”
MethodLiang, J., Bi, G., Huang, X., Xu, Z., Huang, Y., Bian, Y., Shan, G., Guo, W., Yan, Y., Sui, Q., et al. (2025) · 癌症：英文版 · doi:10.1002/cac2.70068 · Cited by 25 · see citing works
“Chromosome conformation capture (3C) assay was performed as previously reported [25].”
Mapping of the nuclear matrix-bound chromatin hubs by a new M3C experimental procedure
Gavrilov, A. A., Zukher, I., Philonenko, E. S., Razin, S. V., & Iarovaia, O. V. (2010) · Nucleic Acids Research · doi:10.1093/nar/gkq712 · Cited by 23 · see citing works
“Ligation products were analyzed according to the conventional 3C assay protocol (6,28).”
MethodIdentification of cis-regulatory sequence variations in individual genome sequences
Worsley-Hunt, R., Bernard, V., & Wasserman, W. W. (2011) · Genome Medicine · doi:10.1186/gm281 · Cited by 24 · see citing works
“Emerging methods that detect such DNA proximity (such as the Hi-C method described in [84,85]) may provide data suitable for integration into future bioinformatics methods for predicting the impact of a variant.”
MethodYang, Y., Fu, W., Zhang, J., Li, Z., Cai, S., & Sun, C. (2018) · Carcinogenesis · doi:10.1093/carcin/bgy084 · Cited by 22 · see citing works
The search for cis-regulatory driver mutations in cancer genomes
Poulos, R. C., Sloane, M. A., Hesson, L. B., & Wong, J. W. H. (2015) · Oncotarget · doi:10.18632/oncotarget.5085 · Cited by 20 · see citing works
Chromatin binding by the androgen receptor in prostate cancer
Itkonen, H. M., & Mills, I. G. (2011) · Molecular and Cellular Endocrinology · doi:10.1016/j.mce.2011.09.037 · Cited by 21 · see citing works
“In addition we will need to consider methods for mapping the true associations between AR complexes and sites elsewhere such as chromosome conformation capture protocols (Vassetzky et al., 2009) or chromatin interaction analysis with paired-end tag sequencing (ChIA-PET) (Fullwood et al.”
MethodEpigenetics in the early divergent eukaryotic Giardia duodenalis: An update
Lagunas‐Rangel, F. A., & Bermúdez‐Cruz, R. M. (2018) · Biochimie · doi:10.1016/j.biochi.2018.10.008 · Cited by 20 · see citing works
Agrawal, P., Heimbruch, K. E., & Rao, S. (2018) · Comprehensive physiology · doi:10.1002/cphy.c180028 · Cited by 21 · see citing works
Recent advances in the study of Kaposi’s sarcoma-associated herpesvirus replication and pathogenesis
Avey, D. R., Brewers, B., & Zhu, F. (2015) · Virologica Sinica · doi:10.1007/s12250-015-3595-2 · Cited by 18 · see citing works
“VIROLOGICA SINICA 134 APRIL 2015 VOLUME 30 ISSUE 2 mation capture (3C) and its ChIP-based modifications (Gavrilov et al., 2009; Woodcock and Ghosh, 2010; de Wit and de Laat, 2012).”
BackgroundFunctional characteristics of novel pancreatic Pax6 regulatory elements
Buckle, A., Nozawa, R.-S., Kleinjan, D., & Gilbert, N. (2018) · Human Molecular Genetics · doi:10.1093/hmg/ddy255 · Cited by 17 · see citing works
“Standard curves 489 were generated using the RLT on the primer panel as described by (68), with serial 5-fold dilutions of RLT 490 used to produce standard curves for all variable primers with the probe and constant fragment primer.”
MethodUlianov, S. V., Gavrilov, A. A., & Razin, S. V. (2012) · Epigenetics & Chromatin · doi:10.1186/1756-8935-5-16 · Cited by 17 · see citing works
“Using the quantitative chromosome conformation capture assay (3C-qPCR) [25,26], we have demonstrated that the switching of chicken β-globin gene expression correlates with prominent changes in the spatial configuration of the domain.”
MethodUnraveling the Epigenetic Landscape for Salt Tolerance in Plants
Roy, S., & Soni, P. (2022) · International Journal of Plant Biology · doi:10.3390/ijpb13040036 · Cited by 16 · see citing works
“Specific primers are designed based on the genes to be studied in the loops in close proximity [12].”
BackgroundLong‐range genomic interactions epigenetically regulate the expression of a cytokine receptor
Deligianni, C., & Spilianakis, C. G. (2012) · EMBO Reports · doi:10.1038/embor.2012.112 · Cited by 16 · see citing works
“To test the hypothesis that CTCF protein is recruited on these loci and allows the Ifng–IfngR1 interaction, we performed a ChIP-loop assay [15].”
Pike, J. W., Meyer, M. B., & Lee, S. M. (2011) · Elsevier eBooks · doi:10.1016/b978-0-12-381978-9.10007-1 · Cited by 15 · see citing works
Epigenetic Features that Regulate IgH Locus Recombination and Expression
Subrahmanyam, R., & Sen, R. (2011) · Current topics in microbiology and immunology · doi:10.1007/82_2011_153 · Cited by 15 · see citing works
Strahan, R. C., Uppal, T., & Verma, S. C. (2016) · Viruses · doi:10.3390/v8040092 · Cited by 14 · see citing works
Inferring Single-Cell 3D Chromosomal Structures Based on the Lennard-Jones Potential
zha, M., Wang, N., Zhang, C., & Wang, Z. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22115914 · Cited by 12 · see citing works
“…(one vs. all) [19–25]; 5C can detect the spatial proximities between selective genomic regions and other selective genomic regions (many vs many) [26–31]; and Hi-C, as one of the latest chromosome conformation capturing methods, can detect genome-wide all-to-all spatial in-contact relationships…”
BackgroundTranscriptional regulatory network shapes the genome structure ofSaccharomyces cerevisiae
Li, S., & Heermann, D. W. (2013) · Nucleus · doi:10.4161/nucl.24875 · Cited by 11 · see citing works
Castellano‐Castillo, D., Denechaud, P., Moreno‐Indias, I., Tinahones, F. J., Fajas, L., Queipo‐Ortuño, M. I., & Cardona, F. (2018) · PLoS ONE · doi:10.1371/journal.pone.0192314 · Cited by 9 · see citing works
Chromatin Immunoprecipitation Assays
(2009) · Methods in molecular biology · doi:10.1007/978-1-60327-414-2 · Cited by 9 · see citing works
C-methods to study 3D organization of the eukaryotic genome
Gavrilov, A. A., Razin, S. V., & Iarovaia, O. V. (2012) · Biopolymers and Cell · doi:10.7124/bc.000056 · Cited by 8 · see citing works
“The current 3C protocols suggest using real-time PCR with TaqMan probes to improve performance of the assay [16].”
MethodIoudinkova, E. S., Ulianov, S. V., Bunina, D., Iarovaia, O. V., Gavrilov, A. A., & Razin, S. V. (2011) · Epigenetics · doi:10.4161/epi.6.12.18215 · Cited by 8 · see citing works
Agrawal, P., Heimbruch, K. E., & Rao, S. (2019) · Comprehensive physiology · doi:10.1002/j.2040-4603.2019.tb00066.x · Cited by 4 · see citing works
Use of In Vivo Biotinylation for Chromatin Immunoprecipitation
Kulyyassov, A., Shoaib, M., & Ogryzko, V. V. (2011) · Current Protocols in Cell Biology · doi:10.1002/0471143030.cb1712s51 · Cited by 4 · see citing works
“, 3C-5C (Vassetzky et al., 2009) and RNAChIP (Gilbert and Svejstrup, 2006; Percipalle and Obrdlik 2009).”
cgChIP: A Cell Type- and Gene-Specific Method for Chromatin Analysis
Agelopoulos, M., McKay, D. J., & Mann, R. S. (2014) · Methods in molecular biology · doi:10.1007/978-1-4939-1242-1_18 · Cited by 4 · see citing works
Interactions of Transcription Factors with Chromatin
van Bakel, H. (2011) · Sub-cellular biochemistry/Subcellular biochemistry · doi:10.1007/978-90-481-9069-0_11 · Cited by 4 · see citing works
“The advent of new technologies such as the numerous derivatives of chromosome conformation capture (3C) [270, 271] now make such approaches possible at a genome-wide level (see Chapter 13).”
BackgroundEpigenomics – Impact for Drug Safety Sciences
Lempiäinen, H., Luisier, R., Müller, A., Marc, P., Heard, D. J., Bolognani, F., Moulin, P., Couttet, P., Grenet, O., Marlowe, J. L., et al. (2012) · doi:10.1002/9781118349045.ch19 · Cited by 4 · see citing works
Markova, E. N., Kantidze, O. L., & Razin, S. V. (2012) · Gene · doi:10.1016/j.gene.2012.09.028 · Cited by 3 · see citing works
Methods of massive parallel reporter assays for investigation of enhancers
Romanov, S. E., Kalashnikova, D. A., & Laktionov, P. P. (2021) · Vavilov Journal of Genetics and Breeding · doi:10.18699/vj21.038 · Cited by 3 · see citing works
“The most widely used HiC method allows to build DNA genome-wide contacts map, in contrast to earlier methods (Gavrilov et al., 2009; Lieberman-Aiden et al., 2009).”
MethodSpatial organization of housekeeping genes in interphase nuclei
Gushchanskaya, E. S., Artemov, A. V., Ulianov, S. V., Penin, A. A., Logacheva, M. D., Razin, S. V., & Gavrilov, A. A. (2014) · Molecular Biology · doi:10.1134/s0026893314060053 · Cited by 3 · see citing works
Chudalayandi, S. (2010) · Methods in molecular biology · doi:10.1007/978-1-61737-957-4_16 · Cited by 3 · see citing works
Gushchanskaya, E. S., Gavrilov, A. A., & Razin, S. V. (2014) · Molecular Biology · doi:10.1134/s0026893314030078 · Cited by 2 · see citing works
“All C methods (other than M3C [5]) include the fixation step of the genomic elements interacting in a living cell using formaldehyde crosslinking followed by chromatin digestion with restriction enzymes, the resulting fragments are then ligated.”
MethodEpigenetics and Epigenomics in Human Health and Disease
Festenstein, R. (2016) · Elsevier eBooks · doi:10.1016/b978-0-12-420196-5.00005-8 · Cited by 2 · see citing works
Biophysics is reshaping our perception of the epigenome: from DNA-level to high-throughput studies
Kanapeckaitė, A., Burokienė, N., Mažeikienė, A., Cottrell, G. S., & Widera, D. (2021) · Biophysical Reports · doi:10.1016/j.bpr.2021.100028 · Cited by 2 · see citing works
“For example, chromosome conformation capture (3C) (53) and subsequent evolutions of the method to 4C (54) and 5C (52) helped evaluate spatial changes in nuclear organization through gene expression.”
MethodAhituv, N. (2012) · Springer eBooks · doi:10.1007/978-1-4614-1683-8_1 · Cited by 2 · see citing works
de Lima, E. G. (2018) · Bioengineering and Bioscience · doi:10.13189/bb.2018.060201 · Cited by 1 · see citing works
The Genomic Landscape of Meningiomas
Zhao, A., Youngblood, M. W., Erson-Omay, Z., Moliterno, J. A., & Günel, M. (2020) · Springer eBooks · doi:10.1007/978-3-030-59558-6_4 · Cited by 1 · see citing works
Seid, C. A. (2014) · DSpace@MIT (Massachusetts Institute of Technology)
SURVEY AND SUMMARY Transcription factories in the context of the nuclear and genome organization
Razin, S. V., Gavrilov, A. A., Pichugin, A., Lipinski, M., Iarovaia, O. V., & Vassetzky, Y. S. (2011)
Electrical induction hypothesis to explain enhancer-promoter communicationPreprint
Agoni, V. (2015) · doi:10.7287/peerj.preprints.950v1
“Our hypothesis goes in accordance with the fact that many authors identified 3D loops in the genomes.”
ResultPractical Analysis of Genome Contact Interaction Experiments
Carty, M., & Elemento, O. (2016) · Methods in molecular biology · doi:10.1007/978-1-4939-3578-9_9
Chromosome Conformation Capture (3C) and 3C-based Methods
Zhai, K., Zhi-Yin, W. U., & Yu, D. (2010) · PROGRESS IN BIOCHEMISTRY AND BIOPHYSICS · doi:10.3724/sp.j.1206.2010.00158
Methods to Identify Chromatin-Bound Protein Complexes: From Genome-Wide to Locus-Specific Approaches
Massie, C. E. (2016) · Methods in molecular biology · doi:10.1007/978-1-4939-3724-0_9
Peng, G.-H., & Chen, S. (2012) · Methods in molecular biology · doi:10.1007/978-1-61779-848-1_22
Regulatory architecture of the Pax6 locus
Buckle, A. (2014) · ERA
Zielke, T. (2015) · doi:10.18452/17232
“Eine neuere Methode um lokale schleifenbildende Chromatininteraktionen direkt zu identifizieren ist die „chromosome conformation capture“ Analyse (3C) (Gavrilov et al., 2009; Miele et al., 2006; Zhao et al., 2006; Simonis et al., 2006).”
BackgroundDistal Enhancer – Gene Interactions at the Lmo2 locus in Mouse Erythroid cells
Bhattacharya, A. (2012) · Library and Archives Canada (Government of Canada)
Pou5f1 Post-translational Modifications Modulate Gene Expression and Cell Fate
Campbell, P. (2012) · uO Research (University of Ottawa) · doi:10.20381/ruor-6280
The Role of Spatial Organization of the Genome in the Regulation of Transcription
Razin, S. V. (2025) · Russian Journal of Genetics · doi:10.1134/s1022795425700917
“…with the interpretation of data from 3C and other protocols based on the ligation of closely spaced DNA fragments (the so-called C-methods) [73–75] is that these protocols do not allow a direct assessment of the proportion of cells in the population in which the contacts between enhancers…”
- Authors
- Gavrilov, A., Eivazova, E., Pirozhkova, I., Lipinski, M., Razin, S., & Vassetzky, Y.
- Affiliations
- Université Paris-Sud (FR)
- Vanderbilt University (US)
- Russian Academy of Sciences (RU)
- Venue
- Methods in molecular biology
- Publisher
- Humana Press
- Published
- 2009
- Volume
- 567
- Pages
- 171-188
- ISSN
- 1064-3745 (ISSN-L)
- 1940-6029
- OpenAlex
- W1605795938
- Cited by
- 82
- References
- 24
- Citations by year
- 2025: 2 · 2022: 2 · 2021: 3 · 2020: 2 · 2019: 3 · 2018: 7 · 2017: 1 · 2016: 5 · 2015: 6 · 2014: 10 · 2013: 3 · 2012: 14
- FWCI
- 14.94
- Type
- book chapter
- Language
- en
- Update notices
- erratum (2011-08-20)
- Open access
- closed
- Locations
- Methods in molecular biology (publishedVersion)
- PubMed (publishedVersion)
- HAL (submittedVersion)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Chromatin Dynamics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Genomic variations and chromosomal abnormalities
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Chromatin Remodeling and Cancer
- Keywords
- chromosome conformation capture, 3C, 5C, 4Cs, 3D genome organization, PCR specificity, formaldehyde crosslinking, restriction enzyme digestion
- MeSH terms
- Chromosome Mapping, Chromosomes, Cross-Linking Reagents, Humans, Models, Biological, Nucleic Acid Conformation, Quality Control, Polymerase Chain Reaction, Chromatin Immunoprecipitation
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
