The histone demethylase Jmjd3 sequentially associates with the transcription factors Tbx3 and Eomes to drive endoderm differentiation
Open accessAbstract
Stem cell differentiation depends on transcriptional activation driven by lineage-specific regulators as well as changes in chromatin organization. However, the coordination of these events is poorly understood. Here, we show that T-box proteins team up with chromatin modifying enzymes to drive the expression of the key lineage regulator, Eomes during endodermal differentiation of embryonic stem (ES) cells. The Eomes locus is maintained in a transcriptionally poised configuration in ES cells. During early differentiation steps, the ES cell factor Tbx3 associates with the histone demethylase Jmjd3 at the enhancer element of the Eomes locus to allow enhancer-promoter interactions. This spatial reorganization of the chromatin primes the cells to respond to Activin signalling, which promotes the binding of Jmjd3 and Eomes to its own bivalent promoter region to further stimulate Eomes expression in a positive feedback loop. In addition, Eomes activates a transcriptional network of core regulators of endodermal differentiation. Our results demonstrate that Jmjd3 sequentially associates with two T-box factors, Tbx3 and Eomes to drive stem cell differentiation towards the definitive endoderm lineage.
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
TBX3 is critically involved in pluripotency maintenance and lineage-specific exit from the pluripotency circuitry in mouse embryonic stem cells.
“Finally, TBX3 is not only critically involved in pluripotency maintenance but also in lineage-specific exit from the pluripotency circuitry in mouse embryonic stem cells [11–17].”
From TBX3 is dynamically expressed in pancreatic organogenesis and fine-tunes regeneration (2023) · cites this paper as [16]
The section “Tbx3 recruits Jmjd3 to the enhancer region of Eomes locus” reports that Tbx3 binds the Eomes enhancer during differentiation, and “Sequential two-step activation of Eomes locus leads to definitive endoderm differentiation” reports impaired endoderm differentiation after Tbx3 knockdown. These passages support a role in lineage-specific differentiation of mouse embryonic stem cells. They do not establish the separate claim that Tbx3 is critical for maintaining pluripotency. Page numbers were not provided in our copy. (LLM, conf=0.86)
Experimental — accuracy not yet measured
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Cites
Histone modifications at human enhancers reflect global cell-type-specific gene expression
Heintzman, N. D., Hon, G. C., Hawkins, R. D., Kheradpour, P., Stark, A., Harp, L. F., Ye, Z., Lee, L. K., Stuart, R. K., Ching, C. W., et al. (2009) · Nature · doi:10.1038/nature07829 · Cited by 2,533 · see citing works
A unique chromatin signature uncovers early developmental enhancers in humans
Rada-Iglesias, A., Bajpai, R., Swigut, T., Brugmann, S. A., Flynn, R. A., & Wysocka, J. (2011) · Nature · doi:10.1038/nature09692 · Cited by 2,233 · see citing works
Mediator and cohesin connect gene expression and chromatin architecture
Kagey, M. H., Newman, J. J., Bilodeau, S., Zhan, Y., Orlando, D. A., van Berkum, N. L., Ebmeier, C. C., Goossens, J., Rahl, P. B., Levine, S. S., et al. (2010) · Nature · doi:10.1038/nature09380 · Cited by 1,939 · see citing works
De Santa, F., Totaro, M. G., Prosperini, E., Notarbartolo, S., Testa, G., & Natoli, G. (2007) · Cell · doi:10.1016/j.cell.2007.08.019 · Cited by 965 · see citing works
Control of RNA Polymerase II Elongation Potential by a Novel Carboxyl-terminal Domain Kinase
Marshall, N. F., Peng, J., Xie, Z., & Price, D. H. (1996) · Journal of Biological Chemistry · doi:10.1074/jbc.271.43.27176 · Cited by 662 · see citing works
Defining the nature of human pluripotent stem cell progeny
Patterson, M., Chan, D. N., Ha, I., Case, D., Cui, Y., Handel, B. V., Mikkola, H. K., & Lowry, W. E. (2012) · Cell Research · doi:10.1038/cr.2011.133 · Cited by 145 · see citing works
Chromosome conformation capture (from 3C to 5C) and its ChIP-based modification
Gavrilov, A., Eivazova, E., Pirozhkova, I., Lipinski, M., Razin, S., & Vassetzky, Y. (2009) · Methods in molecular biology · doi:10.1007/978-1-60327-414-2_12 · Cited by 82 · cited 1× · see citing works
“Tbx3 (Han et al., 2010) GAATTGTACATAGCTGGATTTCAAGAGAATCCAGCTATGTACAATTC”
Flagged first, then by citations
Cited by
Sorted by citations
A Dynamic Role of TBX3 in the Pluripotency Circuitry
Russell, R., Ilg, M., Lin, Q., Wu, G., Lechel, A., Bergmann, W., Eiseler, T., Linta, L., Kumar P., P., Klingenstein, M., et al. (2015) · Stem Cell Reports · doi:10.1016/j.stemcr.2015.11.003 · Cited by 66 · see citing works
Perkhofer, L., Walter, K., Costa, I. G., Carrasco, M. C. R., Eiseler, T., Hafner, S., Genze, F., Zenke, M., Bergmann, W., Illing, A., et al. (2016) · Stem Cell Research · doi:10.1016/j.scr.2016.08.007 · Cited by 39 · see citing works
Dong, L., Dong, Q., Chen, Y., Li, Y., Zhang, B., Zhou, F., Lyu, X., Chen, G. G., Lai, P., Kung, H.-F., et al. (2018) · Signal Transduction and Targeted Therapy · doi:10.1038/s41392-018-0025-6 · Cited by 36 · see citing works
TBX3 Knockdown Decreases Reprogramming Efficiency of Human Cells
Klingenstein, M., Raab, S., Achberger, K., Kleger, A., Liebau, S., & Linta, L. (2016) · Stem Cells International · doi:10.1155/2016/6759343 · Cited by 11 · see citing works
TBX3 is dynamically expressed in pancreatic organogenesis and fine-tunes regeneration
Melzer, M. K., Schirge, S., Gout, J., Arnold, F., Srinivasan, D., Burtscher, I., Allgöwer, C., Mulaw, M., Zengerling, F., Günes, C., et al. (2023) · BMC Biology · doi:10.1186/s12915-023-01553-x · Cited by 5 · see citing works
- Authors
- Kartikasari, A. E. R., Zhou, J. X., Kanji, M. S., Chan, D. N., Sinha, A., Grapin‐Botton, A., Magnuson, M. A., Lowry, W. E., & Bhushan, A.
- Affiliations
- University of California, Los Angeles (US)
- University of Copenhagen (DK)
- Vanderbilt University Medical Center (US)
- Corresponding author
- Bhushan, Anil
- ORCID
- Venue
- The EMBO Journal
- Published
- 2013-04-12
- Volume
- 32
- Issue
- 10
- Pages
- 1393-1408
- ISSN
- 0261-4189 (ISSN-L)
- 1460-2075
- PMC
- PMC3655467
- OpenAlex
- W2104490470
- Cited by
- 90
- References
- 7
- Citations by year
- 2026: 3 · 2025: 1 · 2024: 3 · 2023: 5 · 2022: 6 · 2021: 6 · 2020: 7 · 2019: 5 · 2018: 7 · 2017: 7 · 2016: 11 · 2015: 13 · 2014: 9 · 2013: 6
- FWCI
- 4.90
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- Locations
- The EMBO Journal (publishedVersion)
- Europe PMC (PubMed Central) (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Research at the University of Copenhagen (University of Copenhagen) (publishedVersion)
- eScholarship (California Digital Library) (submittedVersion)
- Funders
- Leona M. and Harry B. Helmsley Charitable Trust
- National Institute of Diabetes and Digestive and Kidney Diseases (R01DK068763, U01DK072473, R01DK080996)
- Eli and Edythe Broad Center of Regenerative Medicine and Stem Cell Research, University of California Los Angeles
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Pluripotent Stem Cells Research
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Chromatin Dynamics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Epigenetics and DNA Methylation
- Keywords
- JMJD3, histone demethylase, TBX3, Eomes, endoderm differentiation, embryonic stem cells, T-box transcription factor, enhancer-promoter interactions, chromatin organization, activin signalling, bivalent promoters, transcriptional activation, lineage-specific gene expression
- MeSH terms
- Animals, Cell Differentiation, Cells, Cultured, Endoderm, Enhancer Elements, Genetic, Humans, Promoter Regions, Genetic, RNA Polymerase II, Serine, Gene Expression Regulation, Developmental, T-Box Domain Proteins, Feedback, Physiological, Activins, Mice, Smad2 Protein, Embryonic Stem Cells, Jumonji Domain-Containing Histone Demethylases
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
