Regulation of gluconeogenesis by glucocorticoids.

Exton, J. H.

doi:10.1007/978-3-642-81265-1_28

Cited by 130Metabolism, Diabetes, and CancerEstrogen and related hormone effectsAdrenal Hormones and Disorders

Regulation of gluconeogenesis by glucocorticoids.

Exton, J. H.·1979·Monographs on endocrinology

DOI 10.1007/978-3-642-81265-1_28

Open this paper in CoChat — free account

Abstract

1. Regulation of gluconeogenic substrate supply and modulation of the gluconeogenic pathway in the liver are both important in the control of gluconeogenesis by glucocorticoids. 2. Adrenal deficiency decreases the release of gluconeogenic and other amino acids from skeletal muscle during starvation. The effect is reversed by glucocorticoid replacement. The changes in amino acid release are accompanied by similar alterations in tissue amino acid levels and are not explained by alterations in net protein breakdown. Glucocorticoids do not alter protein catabolism and cause a small inhibition of protein synthesis. The biochemical alterations underlying the changes in amino acid metabolism induced by these steroids remain to be elucidated. Glucocorticoids may also regulate the supply of gluconeogenic substrates through permissive effects on the lipolytic action of catecholamines and other hormones in adipose tissue and on the glycogenolytic action of catecholamines on skeletal muscle. 3. Glucocorticoids are required for the increases in gluconeogenesis in starvation and diabetes. Part of their action is exerted directly on the liver and appears to involve modulation of P-enlopyruvate carboxykinase levels. Glucocorticoids increase the synthesis of this enzyme apparently through effects at the level of transcription. 4. Glucocorticoids exert permissive effects on the stimulation of gluconeogenesis in the liver by glucagon and epinephrine. The steroids are not required for cAMP generation or protein kinase activation by these hormones, but appear to act by maintaining the responsiveness of certain enzymes to the effects of the cAMP and alpha-adrenergic systems. It is proposed that this involves the maintenance of a normal intracellular ionic environment.

Integrity signals

Registry

Crossref · 10.1007/978-3-642-81265-1_28

Cites

46 of 46 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

This paper’s full text isn’t openly available, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Glucocorticoids can exacerbate hyperglycemia by increasing hepatic gluconeogenesis via inducing G6Pase and Pepck expression.
“Glucocorticoids can exacerbate hyperglycemia by increasing hepatic gluconeogenesis (by inducing expression of G6Pase and Pepck) (46)”
From Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia (2011) · cites this paper as [46]

THE ADRENAL CORTEX AND CARBOHYDRATE METABOLISM
Long, C. N. H., Katzin, B., & Fry, E. G. (1940) · Endocrinology · doi:10.1210/endo-26-2-309 · Cited by 519 · see citing works
The rate of gluconeogenesis from various precursors in the perfused rat liver
Ross, B. D., Hems, R., & Krebs, H. A. (1967) · Biochemical Journal · doi:10.1042/bj1020942 · Cited by 408 · see citing works
Metabolic and Hormonal Control of Phosphoenolpyruvate Carboxykinase and Malic Enzyme in Rat Liver
Shrago, E. S., Lardy, H. A., Nordlie, R. C., & Foster, D. O. (1963) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(18)48645-0 · Cited by 386 · see citing works
Studies on the alpha-adrenergic activation of hepatic glucose output. I. Studies on the alpha-adrenergic activation of phosphorylase and gluconeogenesis and inactivation of glycogen synthase in isolated rat liver parenchymal cells.
Hutson, N. J., Brumley, F. T., Assimacopoulos, F. D., Harper, S. C., & Exton, J. H. (1976) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(17)33147-2 · Cited by 348 · see citing works
Self-citation
Interaction of Glucocorticoids with Glucagon and Epinephrine in the Control of Gluconeogenesis and Glycogenolysis in Liver and of Lipolysis in Adipose Tissue
Exton, J. H., Friedmann, N. K., Wong, E., Brineaux, J. P., Corbin, J. D., & Park, C. R. (1972) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(19)45180-6 · Cited by 282 · see citing works
Effect of dexamethasone on insulin binding, glucose transport, and glucose oxidation of isolated rat adipocytes.
Olefsky, J. M. (1975) · Journal of Clinical Investigation · doi:10.1172/jci108231 · Cited by 277 · see citing works
The Role of Hepatic Glucose-6-phosphatase in the Regulation of Carbohydrate Metabolism
Ashmore, J., & Weber, G. F. (1959) · Vitamins and hormones · doi:10.1016/s0083-6729(08)60269-1 · Cited by 259 · see citing works
Hormonal control of pyruvate kinase activity and of gluconeogenesis in isolated hepatocytes.
Feliú, J. E., Hue, L., & Hers, H. G. (1976) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.73.8.2762 · Cited by 220 · see citing works
Lack of Correlation between Catecholamine Effects on Cyclic Adenosine 3′:5′-Monophosphate and Gluconeogenesis in Isolated Rat Liver Cells
Tolbert, M. E. M., Butcher, F. R., & Fain, J. N. (1973) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(19)43560-6 · Cited by 171 · see citing works
Hepatic pyruvate kinase. Regulation by glucagon, cyclic adenosine 3'-5'-monophosphate, and insulin in the perfused rat liver.
Blair, J. B., Cimbala, M. A., Foster, J. L., & Morgan, R. A. (1976) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(17)33408-7 · Cited by 170 · see citing works
Phosphorylation of purified rat liver pyruvate kinase by cyclic 3′,5′-AMP-stimulated protein kinase
Ljungström, O., Hjelmquist, G., & Engström, L. (1974) · Biochimica et Biophysica Acta (BBA) - Enzymology · doi:10.1016/0005-2744(74)90459-8 · Cited by 170 · see citing works
beta-adrenergic receptors in rat liver: effects of adrenalectomy.
Wolfe, B. B., Harden, T. K., & Molinoff, P. B. (1976) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.73.4.1343 · Cited by 148 · see citing works
Regulation of Phosphoenolpyruvate Carboxykinase and Tyrosine Transaminase in Hepatoma Cell Cultures
Barnett, C. A., & Wicks, W. D. (1971) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(19)45872-9 · Cited by 144 · see citing works
Increase in level of functional messenger RNA coding for phosphoenolpyruvate carboxykinase (GTP) during induction by cyclic adenosine 3':5'-monophosphate.
Iynedjian, P. B., & Hanson, R. W. (1977) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(17)32769-2 · Cited by 134 · see citing works
Paths of Carbon in Gluconeogenesis and Lipogenesis
Shrago, E. S., & Lardy, H. A. (1966) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(18)96889-4 · Cited by 115 · see citing works
Hormonal control of [14C]glucose synthesis from [U-14C]dihydroxyacetone and glycerol in isolated rat hepatocytes
Pilkis, S. J., Riou, J. P., & Claus, T. H. (1976) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(19)57012-0 · Cited by 107 · see citing works
Regulation in vitro of rat liver pyruvate kinase by phosphorylation-dephosphorylation reactions, catalyzed by cyclic-AMP dependent protein kinases and a histone phosphatase
Titanji, V. P. K., Zetterqvist, Ö., & Engström, L. (1976) · Biochimica et Biophysica Acta (BBA) - Enzymology · doi:10.1016/0005-2744(76)90011-5 · Cited by 106 · see citing works
Studies on the Mechanisms Underlying Adaptive Changes in Rat Liver Phosphoenolpyruvate Carboxykinase*
Foster, D. O., Ray, P. D., & Lardy, H. A. (1966) · Biochemistry · doi:10.1021/bi00866a022 · Cited by 104 · see citing works
Interaction of adrenal steroids and glucagon on gluconeogenesis in perfused rat liver
Friedmann, N. K., Exton, J. H., & Park, C. R. (1967) · Biochemical and Biophysical Research Communications · doi:10.1016/0006-291x(67)90550-5 · Cited by 104 · see citing works
Mode of Action of Glucocorticoids
Ray, P. D., Foster, D. O., & Lardy, H. A. (1964) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(18)97735-5 · Cited by 99 · see citing works
Evidence for separate epinephrine and glucagon responsive adenyl cyclase systems in rat liver
Bitensky, M. W., RUSSELL, V. P., & Robertson, W. R. (1968) · Biochemical and Biophysical Research Communications · doi:10.1016/0006-291x(68)90619-0 · Cited by 98 · see citing works
Comparative kinetic studies on the L-type pyruvate kinase from rat liver and the enzyme phosphorylated by cyclic 3′,5′-AMP-stimulated protein kinase
Ekman, P., Dahlqvist-Edberg, U., Humble, E., & Engström, L. (1976) · Biochimica et Biophysica Acta (BBA) - Enzymology · doi:10.1016/0005-2744(76)90285-0 · Cited by 97 · see citing works
Role of Enzymes in Homeostasis
Weber, G. F., & Singhal, R. L. (1964) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(18)51711-7 · Cited by 96 · see citing works
Effects of adenosine cyclic monophosphate, dexamethasone, and insulin on phosphoenolpyruvate carboxykinase synthesis in Reuber H-35 hepatoma cells
Gunn, J. M., Tilghman, S. M., Hanson, R. W., Reshef, L., & Ballard, F. J. (1975) · Biochemistry · doi:10.1021/bi00682a012 · Cited by 89 · see citing works
Glucocorticoids and the regulation of phosphoenolpyruvate carboxykinase (guanosine triphosphate) in the rat
Gunn, J. M., Hanson, R. W., Meyuhas, O., Reshef, L., & Ballard, F. J. (1975) · Biochemical Journal · doi:10.1042/bj1500195 · Cited by 86 · see citing works
Liver Microsomal Glucose 6-Phosphatase, Inorganic Pyrophosphatase, and Pyrophosphate-Glucose Phosphotransferase
Nordlie, R. C., Arion, W. J., & Glende, E. A. (1965) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(18)97168-1 · Cited by 84 · see citing works
Differential Effects of Glucocorticoids and Adenosine 3',5'-Monophosphate on Hepatic Enzyme Synthesis
Wicks, W. D. (1971) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(18)62552-9 · Cited by 82 · see citing works
Adenylate‐Cyclase Activity of Rat‐Liver Plasma Membranes
Leray, F., Chambaut‐Guérin, A., Perrenoud, M., & Hanoune, J. (1973) · European Journal of Biochemistry · doi:10.1111/j.1432-1033.1973.tb03049.x · Cited by 76 · see citing works
Glucose Inhibition of Epinephrine Stimulation of Hepatic Gluconeogenesis by Blockade of the α-Receptor Function
Kneer, N. M., Bosch, A. L., Clark, M. G., & Lardy, H. A. (1974) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.71.11.4523 · Cited by 76 · see citing works
Evidence for translational regulation of specific enzyme synthesis by N6, O2′-dibutyryl cyclic AMP in hepatoma cell cultures
Wicks, W. D., & Mckibbin, J. B. (1972) · Biochemical and Biophysical Research Communications · doi:10.1016/0006-291x(72)90364-6 · Cited by 74 · see citing works
THE EFFECT OF GROWTH HORMONE AND OF CORTISOL ON THE RESPONSE OF ISOLATED RAT DIAPHRAGM TO THE STIMULATING EFFECT OF INSULIN ON GLUCOSE UPTAKE AND ON INCORPORATION OF AMINO ACIDS INTO PROTEIN
Manchester, K. L., Randle, P. J., & Young, F. G. (1959) · Journal of Endocrinology · doi:10.1677/joe.0.0180395 · Cited by 71 · see citing works
A Block in Epinephrine-induced Glycogenolysis in Hearts from Adrenalectomized Rats
Miller, T. B., Exton, J. H., & Park, C. R. (1971) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(18)62180-5 · Cited by 59 · see citing works
On the mechanism of gluconeogenesis and its regulation. 3. The glucogenic capacity and the activities of pyruvate carboxylase and PEP-carboxylase of rat kidney and rat liver after cortisol treatment and starvation.
Hv, H., Stumpf, B., Ohly, B., & Seubert, W. (1966) · PubMed · Cited by 56 · see citing works
Carbohydrate metabolism in perfused livers of adrenalectomized and steroid-replaced rats
Exton, J. H., Miller, T. P., Harper, S. C., & Cr, P. (1976) · American Journal of Physiology-Legacy Content · doi:10.1152/ajplegacy.1976.230.1.163 · Cited by 56 · see citing works
Effect of Cortisol on the Plasma Amino Nitrogen of Eviscerated Adrenalectomized-Diabetic Rats
Smith, O. K., & Long, C. N. H. (1967) · Endocrinology · doi:10.1210/endo-80-4-561 · Cited by 50 · see citing works
Regulation of glucose uptake in muscle. VI. Effects of hypophysectomy, adrenalectomy, growth hormone, hydrocortisone, and insulin on glucose transport and phosphorylation in the perfused rat heart.
Morgan, H. E., Regen, D., Mj, H., Tk, S., & Cr, P. (1961) · PubMed · Cited by 49 · see citing works
Regulation of Glucose Uptake in Muscle
Morgan, H. E., Regen, D. M., Henderson, M. J., Sawyer, T. K., & Park, C. R. (1961) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(18)64048-7 · Cited by 49 · see citing works
Infulence of hormones and medium composition on the degradation of phosphoenolpyruvate carboxykinase (GTP) and total protein in Reuber H35 cells.
Gunn, J. M., Ballard, F. J., & Hanson, R. W. (1976) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(17)33384-7 · Cited by 47 · see citing works
Interaction between hormones and cyclic AMP in regulating specific hepatic enzyme synthesis.
Wd, W., Ca, B., & Mckibbin, J. B. (1974) · PubMed · Cited by 47 · see citing works
The Role of the Adrenals in the Regulation of Phosphoenolpyruvate Carboxykinase of Rat Adipose Tissue
Reshef, L., Ballard, F. J., & Hanson, R. W. (1969) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(18)63600-2 · Cited by 42 · see citing works
Effects of adrenalectomy and glucocorticoid replacement on gluconeogenesis in perfused livers from diabetic rats
Exton, J. H., Harper, S. C., Tucker, A. L., Flagg, J. L., & Park, C. R. (1973) · Biochimica et Biophysica Acta (BBA) - General Subjects · doi:10.1016/0304-4165(73)90006-8 · Cited by 39 · see citing works
Activity and Subcellular Distribution of Protein Kinase Dependent on Adenosine 3′: 5′‐Monophosphate in Liver from Normal and Adrenalectomized Rats
Rousseau, G. G., MARTIAL, J. A., & VISSCHER, M. D. (1976) · European Journal of Biochemistry · doi:10.1111/j.1432-1033.1976.tb10575.x · Cited by 22 · see citing works
Interaction between glucocorticoids and cyclic AMP in the regulation of phosphoenolpyruvate carboxykinase (GTP) in the isolated perfused rat liver Effects of cordycepin and cycloheximide
Krone, W., Marquardt, W., Seitz, H. J., Tarnowski, W., Carsten, D., Dunkelmann, B., & Harneit, A. (1976) · Biochimica et Biophysica Acta (BBA) - General Subjects · doi:10.1016/0304-4165(76)90258-0 · Cited by 16 · see citing works
Protein kinase and cyclic AMP‐binding activities in liver and adipose tissue of normal, streptozotocin‐diabetic and adrenalectomized rats
Zapf, J., WALDVOGEL, M., & Froesch, E. R. (1973) · FEBS Letters · doi:10.1016/0014-5793(73)80384-9 · Cited by 15 · see citing works
Intracellular distribution of pyruvate car☐ylase in livers of normal and cortisol treated rats
Walter, P., & Anabitarte, M. (1973) · FEBS Letters · doi:10.1016/0014-5793(73)80451-x · Cited by 14 · see citing works
Einfluß von Glucocorticoiden auf die Freisetzung von Aminosäuren des perfundierten Hinterkörpers adrenalektomierter Ratten
Thienhaus, R., Tharandt, L., Zais, U., & Staib, W. (1975) · Hoppe-Seyler´s Zeitschrift für physiologische Chemie · doi:10.1515/bchm2.1975.356.s1.811 · Cited by 12 · see citing works

Flagged first, then by citations

Sorted by citations

How do glucocorticoids influence stress responses? Integrating permissive, suppressive, stimulatory, and preparative actions
Sapolsky, R. M., Romero, L. M., & Munck, A. U. (2000) · Endocrine Reviews · doi:10.1210/edrv.21.1.0389 · Cited by 7,541 · see citing works
“Increased substrates for gluconeogenesis are primarily amino acids released from muscle and other peripheral tissues, and glycerol released from adipose tissue sensitized permissively by GCs to lipolysis by GH and catecholamines (419, 420).”
Background
Regulation of glucose homeostasis by glucocorticoids
Kuo, T., McQueen, A., Chen, T.-C., & Wang, J.-C. (2015) · Advances in Experimental Medicine and Biology · doi:10.1007/978-1-4939-2895-8_5 · Cited by 723 · see citing works
Glucocorticoid actions on synapses, circuits, and behavior: Implications for the energetics of stress
Myers, B., McKlveen, J. M., & Herman, J. P. (2014) · Frontiers in Neuroendocrinology · doi:10.1016/j.yfrne.2013.12.003 · Cited by 318 · see citing works
“…travel throughout the body, exerting a multitude of effects in the periphery including glycogen breakdown and gluconeogenesis (Coderre et al., 1991; Exton, 1979; Munck et al., 1984; for detailed reviews of brain circuits regulating glucose homeostasis see Schwartz et al., 2000; Seeley and Woods,…”
Background
Aquaglyceroporin AQP9: Solute permeation and metabolic control of expression in liver
Carbrey, J. M., Gorelick-Feldman, D. A., Kozono, D., Prætorius, J., Nielsen, S., & Agre, P. C. (2003) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0437994100 · Cited by 306 · see citing works
Adrenal Corticosteroid Biosynthesis, Metabolism, and Action
Arlt, W., & Stewart, P. M. (2005) · Endocrinology and Metabolism Clinics of North America · doi:10.1016/j.ecl.2005.01.002 · Cited by 194 · see citing works
“Hepatic glucose output increases through the activation of key enzymes involved in gluconeogenesis, principally glucose-6-phosphatase and phosphoenolpyruvate kinase (PEPCK) [67].”
Background
Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia
German, J. P., Thaler, J. P., Wisse, B. E., Oh-I, S., Sarruf, D. A., Matsen, M. E., Fischer, J. D., Taborsky, G. J., Schwartz, M. W., & Morton, G. J. (2011) · Endocrinology · doi:10.1210/en.2010-0890 · Cited by 169 · see citing works
“The primer sequences for 18S RNA, G6Pase, Pepck, and Igfbp-2 were designed using Primer Express (version 2.0.0; Applied Biosystems) and are as follows: 18S RNA forward, CGGACAGGATTGACAGATTG and reverse, CAAATCGCTCCACCAACTAA; G6Pase forward, TCAACCTCGTCTTCAAGTGGATT and reverse, CTGCTTTATTATAGGCACGGAGCT; Pepck forward,…”
BackgroundInfluential
Leptin Deficiency Causes Insulin Resistance Induced by Uncontrolled Diabetes
German, J. P., Wisse, B. E., Thaler, J. P., Oh-I, S., Sarruf, D. A., Ogimoto, K., Kaiyala, K. J., Fischer, J. D., Matsen, M. E., Taborsky, G. J., et al. (2010) · Diabetes · doi:10.2337/db09-1918 · Cited by 159 · see citing works
“Because glucocorticoids both inhibit peripheral glucose uptake in muscle and adipose tissue and induce hepatic expression of G6Pase and Pepck (39), HPA activation in uDM probably contributes to insulin resistance in this setting.”
BackgroundInfluential
Physiological stress in broilers: Ramifications on nutrient digestibility and responses
Virden, W. S., & Kidd, M. T. (2009) · The Journal of Applied Poultry Research · doi:10.3382/japr.2007-00093 · Cited by 142 · see citing works
“duction [40].”
Background
Neural basis for fasting activation of the hypothalamic–pituitary–adrenal axis
Douglass, A. M., Resch, J. M., Madara, J. C., Kucukdereli, H., Yizhar, O., Grama, A., Yamagata, M., Yang, Z., & Lowell, B. B. (2023) · Nature · doi:10.1038/s41586-023-06358-0 · Cited by 121 · see citing works
Energy metabolism in the newborn farm animal with emphasis on the calf: endocrine changes and responses to milk-born and systemic hormones
Hammon, H. M., Steinhoff‐Wagner, J., Schönhusen, U., Metges, C. C., & Blum, J. W. (2012) · Domestic Animal Endocrinology · doi:10.1016/j.domaniend.2012.02.005 · Cited by 116 · see citing works
Noradrenergic feeding elicited via the paraventricular nucleus is dependent upon circulating corticosterone
LEIBOWITZ, S. F., ROLAND, C., Hor, L., & SQUILLARI, V. (1984) · Physiology & Behavior · doi:10.1016/0031-9384(84)90206-3 · Cited by 101 · see citing works
Involvement of corticosterone in the fasting-induced rise in protein utilization and locomotor activity
Challet, É. (1995) · Pharmacology Biochemistry and Behavior · doi:10.1016/0091-3057(94)00287-s · Cited by 93 · see citing works
Consumption of a high-fat diet rapidly exacerbates the development of fatty liver disease that occurs with chronically elevated glucocorticoids
D'souza, A. M., Beaudry, J. L., Szigiato, A.-A., Trumble, S. J., Snook, L. A., Bonen, A., Giacca, A., & Riddell, M. C. (2012) · American Journal of Physiology-Gastrointestinal and Liver Physiology · doi:10.1152/ajpgi.00378.2011 · Cited by 89 · see citing works
Subcutaneous administration of leptin normalizes fasting plasma glucose in obese type 2 diabetic UCD-T2DM rats
Cummings, B. P., Bettaieb, A., Graham, J. L., Stanhope, K. L., Dill, R., Morton, G. J., Haj, F. G., & Havel, P. J. (2011) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1107163108 · Cited by 87 · see citing works
“Corticosterone has been suggested to contribute to the glucose-lowering effects of central leptin signaling because glucocorticoid action increases hepatic glucose production (32) and decreases insulin sensitivity (33).”
Background
Recent and emerging anti‐diabetes targets
Mohler, M. L., He, Y., Wu, Z., Hwang, D., & Miller, D. D. (2008) · Medicinal Research Reviews · doi:10.1002/med.20142 · Cited by 87 · see citing works
MicroRNA-214 Suppresses Gluconeogenesis by Targeting Activating Transcriptional Factor 4
Li, K., Zhang, J., Yu, J., Liu, B., Guo, Y., Deng, J., Chen, S., Wang, C., & Guo, F. (2015) · Journal of Biological Chemistry · doi:10.1074/jbc.m114.633990 · Cited by 81 · see citing works
Chicken domestication changes expression of stress-related genes in brain, pituitary and adrenals
Løtvedt, P. K., Fallahshahroudi, A., Bektic, L., Altimiras, J., & Jensen, P. (2017) · Neurobiology of Stress · doi:10.1016/j.ynstr.2017.08.002 · Cited by 77 · see citing works
“Glucocorticoids have a wide variety of effects depending on the target tissue, including glycogen breakdown and gluconeogenesis (Exton, 1978; Munk et al., 1984; Coderre et al., 1991; Myers et al., 2014).”
Background
The Effects of Handling and Anesthetic Agents on the Stress Response and Carbohydrate Metabolism in Northern Elephant Seals
Champagne, C. D., Houser, D. S., da Costa, D. P., & Crocker, D. E. (2012) · PLoS ONE · doi:10.1371/journal.pone.0038442 · Cited by 74 · see citing works
“Although cortisol is known to stimulate glucose production in mammals [34,91], this lack of correlation in elephant seals is not necessarily surprising.”
Background
Focus on FKBP51: A molecular link between stress and metabolic disorders
Häusl, A. S., Balsevich, G., Gassen, N. C., & Schmidt, M. V. (2019) · Molecular Metabolism · doi:10.1016/j.molmet.2019.09.003 · Cited by 71 · see citing works
“For instance, GCs increase glucose production in the liver by stimulating hepatic gluconeogenesis [14].”
Background
The Endocrine Effects of Nonhormonal Antineoplastic Therapy
Yeung, S. J., Chiu, A. C., Vassilopoulou‐Sellin, R., & Gagel, R. F. (1998) · Endocrine Reviews · doi:10.1210/edrv.19.2.0328 · Cited by 72 · see citing works
Glucocorticoids and hypothalamic obesity
King, B. M. (1988) · Neuroscience & Biobehavioral Reviews · doi:10.1016/s0149-7634(88)80071-x · Cited by 68 · see citing works
Dexamethasone and colostrum feeding affect hepatic gluconeogenic enzymes differently in neonatal calves1,2,3
Hammon, H. M., Sauter, S. N., Reist, M., Zbinden, Y., Philipona, C., Morel, C., & Blum, J. W. (2003) · Journal of Animal Science · doi:10.2527/2003.81123095x · Cited by 67 · see citing works
Effects of fasting on plasma catecholamine, corticosterone and glucose concentrations under basal and stress conditions in individual rats
de Boer, S. F., Koopmans, S. J., Slangen, J. L., & van der Gugten, J. (1989) · Physiology & Behavior · doi:10.1016/0031-9384(89)90226-6 · Cited by 64 · see citing works
Muscular response and adaptation to diabetes mellitus
Sun, Z. (2008) · Frontiers in bioscience · doi:10.2741/3038 · Cited by 56 · see citing works
“4771 muscle, and through permissive effects on the stimulation of gluconeogenesis in the liver by glucagon and epinephrine (137).”
Background
The Hypothalamic‐Pituitary‐Adrenal Axis in Obesity
Chalew, S. A., Nagel, H., & Shore, S. (1995) · Obesity Research · doi:10.1002/j.1550-8528.1995.tb00163.x · Cited by 52 · see citing works
Fat-brain connections: Adipocyte glucocorticoid control of stress and metabolism
de Kloet, A. D., & Herman, J. P. (2017) · Frontiers in Neuroendocrinology · doi:10.1016/j.yfrne.2017.10.005 · Cited by 42 · see citing works
Steroid use and misuse: a key performance indicator in the management of IBD
Blackwell, J., Selinger, C. P., Raine, T., Parkes, G. C., Smith, M. A., & Pollok, R. (2020) · Frontline Gastroenterology · doi:10.1136/flgastro-2019-101288 · Cited by 42 · see citing works
Mobilisation of Structural Proteins During Exercise
Viru, A. (1987) · Sports Medicine · doi:10.2165/00007256-198704020-00003 · Cited by 43 · see citing works
Comprehensive understanding of regulatory mechanisms, physiological models and key enzymes in microalgal cells based on various concentrations of CO2
Wang, Z., Cheng, J., Sun, Y., Jia, D., Tang, Y., Yang, W., & Cen, K. (2022) · Chemical Engineering Journal · doi:10.1016/j.cej.2022.140233 · Cited by 38 · see citing works
Assessment of ground transportation stress in juvenile Kemp’s ridley sea turtles (Lepidochelys kempii)
Hunt, K. E., Innis, C. J., Kennedy, A. S., McNally, K. L., Davis, D., Burgess, E. A., & Merigo, C. (2016) · Conservation Physiology · doi:10.1093/conphys/cov071 · Cited by 38 · see citing works
“Similar patterns of increased glucose are seen in livestock in response to road transport and other types of stressors and are generally interpreted as evidence of a physiological stress response (Exton, 1979; McMahon et al., 1988; Knowles and Warriss, 2007).”
Background
Glucocorticoids and Their Receptor Isoforms: Roles in Female Reproduction, Pregnancy, and Foetal Development
Bhaumik, S., Lockett, J., Cuffe, J. S. M., & Clifton, V. L. (2023) · Biology · doi:10.3390/biology12081104 · Cited by 39 · see citing works
Multihormonal control of enzyme clusters in rat liver ontogenesis II. Role of glucocorticosteroid and thyroid hormone and of glucagon and insulin
Lamers, W. H., & Mooren, P. G. (1981) · Mechanisms of Ageing and Development · doi:10.1016/0047-6374(81)90010-5 · Cited by 36 · see citing works
PCK1 dysregulation in cancer: Metabolic reprogramming, oncogenic activation, and therapeutic opportunities
Jin, X., Wang, K., & Tang, N. (2022) · Genes & Diseases · doi:10.1016/j.gendis.2022.02.010 · Cited by 35 · see citing works
Proteomic similarities in steroid responsiveness in normal and glaucomatous trabecular meshwork cells.
Bollinger, K. E., Crabb, J. S., Yuan, X., Sharma, T. P., Clark, A. F., & Crabb, J. W. (2012) · Europe PMC (PubMed Central) · Cited by 35 · see citing works
Glucagon, cyclic AMP, and hepatic glucose mobilization: A half‐century of uncertainty
Rodgers, R. L. (2022) · Physiological Reports · doi:10.14814/phy2.15263 · Cited by 33 · see citing works
“…corticosteroids are often described as having a “permissive” effect on the generation of cAMP by high concentrations of glucagon and by other AC activators such as NaF, isoproterenol, or forskolin (Adigun et al., 2010; Exton, 1979; Exton et al., 1972; Krone et al., 1976; Yoon et al., 2001).”
Background
Differential Neuropeptide Responses to Starvation with Ageing
Kaneda, T., Makino, S., Nishiyama, M., Asaba, K., & Hashimoto, K. (2001) · Journal of Neuroendocrinology · doi:10.1046/j.1365-2826.2001.00730.x · Cited by 35 · see citing works
Modeling of Corticosteroid Effects on Hepatic Low-Density Lipoprotein Receptors and Plasma Lipid Dynamics in Rats
Hazra, A., Pyszczynski, N. A., DuBois, D. C., Almon, R. R., & Jusko, W. J. (2007) · Pharmaceutical Research · doi:10.1007/s11095-007-9371-8 · Cited by 34 · see citing works
“Although the practical advantages in using this model are substantial, adrenalectomy may lead to undesirable physiological changes (35,36) especially when evaluating the inter-relationships between carbohydrate, protein, and lipid metabolism.”
Background
Fructose 2,6-bisphosphate and the control of glycolysis by glucocorticoids and by other agents in rat hepatoma cells.
Loiseau, A. M., Rousseau, G. G., & Hue, L. (1985) · PubMed · Cited by 32 · see citing works
Regulation of cytosolic aspartate aminotransferase mRNAs in the Fao rat hepatoma cell line by dexamethasone, insulin and cyclic AMP
Barouki, R., Pavé-Preux, M., Bousquet-Lemercier, B., Pol, S., Bouguet, J., & Hanoune, J. (1989) · European Journal of Biochemistry · doi:10.1111/j.1432-1033.1989.tb15180.x · Cited by 32 · see citing works
Antisense Oligonucleotides as Potential Therapeutics for Type 2 Diabetes
Chen, S., Sbuh, N., & Veedu, R. N. (2020) · Nucleic Acid Therapeutics · doi:10.1089/nat.2020.0891 · Cited by 30 · see citing works
“Glucocorticoids promote gluconeogenesis in liver [139,140], reduce glucose uptake in muscle and fat [141,142], and inhibit glycogen synthesis in skeletal muscle [143,144] by antagonizing insulin response.”
Modeling receptor/gene-mediated effects of corticosteroids on hepatic tyrosine aminotransferase dynamics in rats: dual regulation by endogenous and exogenous corticosteroids
Hazra, A., Pyszczynski, N. A., DuBois, D. C., Almon, R. R., & Jusko, W. J. (2007) · Journal of Pharmacokinetics and Pharmacodynamics · doi:10.1007/s10928-007-9063-3 · Cited by 30 · see citing works
“Although the practical advantages in using this model are substantial, adrenalectomy may lead to undesirable physiological changes such as increased sensitivity of hepatic cAMP in response to catecholamines [12], decrease in body weight [13], delay in onset of puberty in female rats, changes in expression of various n…”
Background
Glucocorticoid-Induced Osteoporosis
Adler, R. A., Curtis, J. R., Weinstein, R. S., & Saag, K. G. (2008) · Elsevier eBooks · doi:10.1016/b978-012370544-0.50046-x · Cited by 27 · see citing works
Neuroendocrine, Metabolic, and Immune Functions during the Acute Phase Response of Inflammatory Stress in Monosodium L-Glutamate-Damaged, Hyperadipose Male Rat
Castrogiovanni, D. C., Gaillard, R. C., Giovambattista, A., & Spinedi, E. (2008) · Neuroendocrinology · doi:10.1159/000124131 · Cited by 26 · see citing works
Effects of Dexamethasone and Growth Hormone Treatment on Hepatic Gluconeogenic Enzymes in Calves
Hammon, H. M., Philipona, C., Zbinden, Y., Blum, J. W., & Donkin, S. S. (2005) · Journal of Dairy Science · doi:10.3168/jds.s0022-0302(05)72887-3 · Cited by 26 · see citing works
Angiotensin II stimulates the reactivity of the pituitary-adrenal axis in leptin-resistant Zucker rats, thereby influencing the glucose utilization
Müller‐Fielitz, H., Schweitzer, N., Jöhren, O., Dominiak, P., & Raasch, W. (2007) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.00650.2006 · Cited by 25 · see citing works
“Considering that plasma glucose was high in the CRH test and OGTT, whereas corticosterone remained elevated, one might hypothesize that this effect is due to enhanced gluconeogenesis, since glucocorticoids are known to play a permissive role in the regulation of gluconeogenesis (25).”
Background
Effect of brief exposure to a potential predator on cortisol concentrations in female Columbian ground squirrels (Spermophilus columbianus)
Hubbs, A. H., Millar, J. S., & Wiebe, J. P. (2000) · Canadian Journal of Zoology · doi:10.1139/z99-244 · Cited by 25 · see citing works
An aptamer-responsive microneedle patch sensor platform combining with hybridization chain reaction amplification for detection of steroid hormone cortisol in skin interstitial fluid
Zhou, Y., He, L., Zhang, M., Chen, M., Wu, Y., Qi, L., Qi, L., Zhang, B., Yang, X., He, X., et al. (2024) · Biosensors and Bioelectronics · doi:10.1016/j.bios.2024.116935 · Cited by 24 · see citing works
Physiological plasticity in elephants: highly dynamic glucocorticoids in African and Asian elephants
Pokharel, S. S., & Brown, J. L. (2023) · Conservation Physiology · doi:10.1093/conphys/coad088 · Cited by 23 · see citing works
Temperament Type Specific Metabolite Profiles of the Prefrontal Cortex and Serum in Cattle
Brand, B., Hadlich, F., Brandt, B., Schauer, N., Graunke, K. L., Langbein, J., Repsilber, D., Ponsuksili, S., & Schwerin, M. (2015) · PLoS ONE · doi:10.1371/journal.pone.0125044 · Cited by 22 · see citing works
“In addition, the observed significant higher abundance of glucocorticoid 5a-tetrahydrocorticosterone in the fearful/neophobic-alert animals is concordant to the significant higher abundance of intermediates of gluconeogenesis [53] like glucose, glucose-6-phophat and fructose-6-phosphat (Table A in S2 File) at least in…”
Background
Analysis of Corticosterone and Testosterone Synthesis in Rat Salivary Gland Homogenates
Ieko, T., Sasaki, H., Maeda, N., Fujiki, J., Iwano, H., & Yokota, H. (2019) · Frontiers in Endocrinology · doi:10.3389/fendo.2019.00479 · Cited by 21 · see citing works
“The glucocorticoids inhibit the uptake of glucose by competing with the insulin response in skeletal muscle and white adipocytes (50, 51).”
Background
Glucocorticoids and activity in free-living arctic ground squirrels: Interrelationships between weather, body condition, and reproduction
Zhang, V. Y., Williams, C. T., Palme, R., & Buck, C. L. (2020) · Hormones and Behavior · doi:10.1016/j.yhbeh.2020.104818 · Cited by 20 · see citing works
“One major function of GCs is to promote gluconeogenesis (Dallman et al., 1993; Exton, 1979; Hasselgren, 1999), and the Energy Mobilization hypothesis posits that GC concentrations will be highest during time points with the highest energetic demands (Romero, 2002).”
Background
Triiodothyronine (T3) levels fluctuate in response to ambient temperature rather than nutritional status in a wild tropical ungulate
Hunninck, L., Jackson, C. R., May, R. F., Røskaft, E., Palme, R., & Sheriff, M. J. (2020) · Conservation Physiology · doi:10.1093/conphys/coaa105 · Cited by 20 · see citing works
Developmental programming of tissue-resident macrophages
Viola, M. F., Taveras, E. F., & Mass, E. (2024) · Frontiers in Immunology · doi:10.3389/fimmu.2024.1475369 · Cited by 21 · see citing works
Glucocorticoids and Diabetes.
Bauerle, K. T., & Harris, C. A. (2016) · Europe PMC (PubMed Central) · Cited by 20 · see citing works
Glucocorticoid‐Dependent Induction of mRNA Coding for Phosphoenolpyruvate Carboxykinase (GTP) in Rat Kidney
Iynedjian, P. B., & JACOT, M. M. (1980) · European Journal of Biochemistry · doi:10.1111/j.1432-1033.1980.tb06078.x · Cited by 20 · see citing works
Insulin inhibits glucocorticoid‐induced stimulation of liver 6‐phosphofructo‐2‐kinase/fructose‐2,6‐bisphosphatase gene transcription
Lemaigre, F. P., Lause, P., & Rousseau, G. G. (1994) · FEBS Letters · doi:10.1016/0014-5793(94)80142-8 · Cited by 20 · see citing works
Glycogen synthesis in serum-free cultured hepatocytes in response to insulin and dexamethasone
López, M. P., Gómez‐Lechón, M. J., & Castell, J. V. (1984) · In Vitro Cellular & Developmental Biology - Plant · doi:10.1007/bf02619665 · Cited by 20 · see citing works
Effect of spontaneous hyperadrenocorticism on endogenous production and utilization of glucose in the dog
Peterson, M. E., Winkler, B., Kintzer, P. P., & ALTSZULER, N. (1986) · Domestic Animal Endocrinology · doi:10.1016/0739-7240(86)90018-4 · Cited by 18 · see citing works
Corticosterone modulates acute toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in male Sprague-Dawley rats
Gorski, J. R. (1988) · Fundamental and Applied Toxicology · doi:10.1016/0272-0590(88)90113-3 · Cited by 18 · see citing works
Maladaptive Neuroplasticity Under Stress: Insights into Neuronal and Synaptic Changes in the Prefrontal Cortex
Ren, B., Yuan, Q., Cha, S., Liu, S.-Y. M., Zhang, J., & Guo, G. (2025) · Molecular Neurobiology · doi:10.1007/s12035-025-05152-5 · Cited by 20 · see citing works
“They primarily modulate glucose metabolism by promoting gluconeogenesis and inhibiting insulin secretion (reviewed in [71]).”
How should rheumatologists manage glucocorticoid-induced hyperglycemia?
Nakamura, H., Fujieda, Y., Nakamura, A., & Atsumi, T. (2020) · Modern Rheumatology · doi:10.1080/14397595.2020.1823060 · Cited by 18 · see citing works
“[5] and reduction of peripheral insulin sensitivity [6].”
Background
Simultaneous detection of salivary cortisol and cortisone using an automated high-throughput sample preparation method for LC-MS/MS
Fariha, R., Jabrah, M., Hill, C., Spooner, A., Deshpande, P. S., & Tripathi, A. (2022) · SLAS TECHNOLOGY · doi:10.1016/j.slast.2022.01.006 · Cited by 17 · see citing works
GLUCOCORTICOIDS AND GLUCOSE METABOLISM: HEPATIC GLUCOSE PRODUCTION IN UNTREATED ADDISONIAN PATIENTS AND ON TWO DIFFERENT LEVELS OF GLUCOCORTICOID ADMINISTRATION
Malerbi, D. A. C., Liberman, B., Filho, A. G., Giannella‐Neto, D., & WAJCHENBERG, B. L. (1988) · Clinical Endocrinology · doi:10.1111/j.1365-2265.1988.tb03673.x · Cited by 17 · see citing works
Parenteral Nourishment of Patients Undergoing Surgical or Traumatic Stress
Gilder, H. (1986) · Journal of Parenteral and Enteral Nutrition · doi:10.1177/014860718601000188 · Cited by 17 · see citing works
EJE Prize 2023: genes on steroids—genomic control of hepatic metabolism by the glucocorticoid receptor
Quagliarini, F., Makris, K., Friano, M. E., & Uhlenhaut, N. H. (2023) · European Journal of Endocrinology · doi:10.1093/ejendo/lvad048 · Cited by 18 · see citing works
Investigation of the impact of birth by cesarean section on fetal and maternal metabolism
Shokry, E., Marchioro, L., Uhl, O., García-Bermúdez, M., García-Santos, J. A., Segura, M. T., Campoy, C., & Koletzko, B. V. (2019) · Archives of Gynecology and Obstetrics · doi:10.1007/s00404-019-05213-w · Cited by 16 · see citing works
Effects of mammalian ACTH on potential fuels and gluconeogenic substrates in the plasma of the spiny dogfish shark (Squalus acanthias)
deRoos, R., & deRoos, C. C. (1992) · General and Comparative Endocrinology · doi:10.1016/0016-6480(92)90161-c · Cited by 16 · see citing works
Glucocorticoids modulate renal glucocorticoid receptors and Na-K ATPase activity
Ellis, D., Sothi, T. D., & Avner, E. D. (1987) · Kidney International · doi:10.1038/ki.1987.233 · Cited by 15 · see citing works
Stress as a facilitator? Territorial male impala have higher glucocorticoid levels than bachelors
Hunninck, L., Palme, R., & Sheriff, M. J. (2020) · General and Comparative Endocrinology · doi:10.1016/j.ygcen.2020.113553 · Cited by 13 · see citing works
Short-term exposure to 12‰ brackish water has significant effects on the endocrine physiology of juvenile American alligator (Alligator mississippiensis)
Faulkner, P. C., Hala, D. N., Rahman, M. S., & Petersen, L. H. (2019) · Comparative Biochemistry and Physiology Part A Molecular & Integrative Physiology · doi:10.1016/j.cbpa.2019.110531 · Cited by 13 · see citing works
Perioperative Complications of Adrenal Surgery
Angermeier, K. W., & Montie, J. E. (1989) · Urologic Clinics of North America · doi:10.1016/s0094-0143(21)01840-1 · Cited by 12 · see citing works
Glucagon 100 years. Important, but still enigmatic
Holst, J. J. (2023) · Peptides · doi:10.1016/j.peptides.2023.170942 · Cited by 11 · see citing works
“depends on the substrate (amino acids and glycerol) provision, which is regulated by the glucocorticoids and the HPA axis [32].”
Elevation of plasma glucose, alanine, and urea levels by mammalian ACTH in the American bullfrog (Rana catesbeiana)
Rosenthal, E. J., & deRoos, R. (1985) · General and Comparative Endocrinology · doi:10.1016/0016-6480(85)90370-3 · Cited by 11 · see citing works
The hypothalamic-pituitary-adrenal (HPA) axis: A major mediator of the adaptive responses to stress
Gabry, K. E., Chrousos, G. P., & Gold, P. W. (2003) · Neuroimmune biology · doi:10.1016/s1567-7443(03)80055-8 · Cited by 11 · see citing works
Characterizing the postnatal hypothalamic–pituitary–adrenal axis response of in utero heat stressed pigs at 10 and 15 weeks of age
Maskal, J. M., Brito, L. F., Duttlinger, A. W., Kpodo, K. R., McConn, B. R., Byrd, C. J., Richert, B. T., Marchant, J. N., Lay, D. C., Jr., Perry, S. D., et al. (2021) · Scientific Reports · doi:10.1038/s41598-021-01889-w · Cited by 10 · see citing works
Efeitos sistêmicos e síndrome de retirada em tomadores crônicos de corticosteróides
Faiçal, S., & Uehara, M. H. (1998) · Revista da Associação Médica Brasileira · doi:10.1590/s0104-42301998000100014 · Cited by 10 · see citing works
Pathophysiology of type II diabetes mellitus
Pierre-Jerome, C. (2024) · Elsevier eBooks · doi:10.1016/b978-0-443-13328-2.00003-9 · Cited by 11 · see citing works
Annotation of differential protein expression in the hypothalami of layer-type Taiwan country chickens in response to acute heat stress
Tu, W., Cheng, C., Chen, C., Chan, H., Wang, S.-H., Tang, P., Chen, C., Lee, Y., Chen, S., & Huang, S. (2018) · Journal of Thermal Biology · doi:10.1016/j.jtherbio.2018.08.013 · Cited by 9 · see citing works
Glucocorticoid-induced changes in glucocorticoid receptor mRNA and protein expression in the human placenta as a potential factor for altering fetal growth and development
Bivol, S., Owen, S., & Rose’Meyer, R. B. (2016) · Reproduction Fertility and Development · doi:10.1071/rd15356 · Cited by 9 · see citing works
“…including (but not limited to) metabolism, stress response, vascular responsiveness, embryogenesis, reproduction and programmed cell death (Exton 1979; Meagher et al. 1996; Barnes 1998; Newton 2000; Sapolsky et al. 2000; Arlt and Stewart 2005), the biological roles of corticosterone in…”
Normalization of enhanced hepatic gluconeogenesis by the antiglucocorticoid RU 38486 in acutely uraemic rats
Schaefer, R. M., Riegel, W., STEPHAN, E., KELLER, H., Hörl, W. H., & Heidland, A. (1990) · European Journal of Clinical Investigation · doi:10.1111/j.1365-2362.1990.tb01788.x · Cited by 9 · see citing works
Improved Insulin Sensitivity during Pioglitazone Treatment Is Associated with Changes in IGF-I and Cortisol Secretion in Type 2 Diabetes and Impaired Glucose Tolerance
Arnetz, L., Ekberg, N. R., Höybye, C., Brismar, K., & Alvarsson, M. (2013) · ISRN Endocrinology · doi:10.1155/2013/148497 · Cited by 8 · see citing works
“Cortisol has anti-insulin effects on glucose metabolism, increasing gluconeogenesis and decreasing glucose uptake [6].”
Background
Síndrome de Cushing exógena e retirada de glicocorticóides
Romanholi, D. J. P. C., & Salgado, L. R. (2007) · Arquivos Brasileiros de Endocrinologia & Metabologia · doi:10.1590/s0004-27302007000800014 · Cited by 8 · see citing works
Associations of Lameness with Indicators of Nitrogen Metabolism and Excretion in Dairy Cows
Necula, D.-C., Warren, H. E., Taylor-Pickard, J. A., Simiz, E., & Ştef, L. (2022) · Agriculture · doi:10.3390/agriculture12122109 · Cited by 7 · see citing works
An adventitious role of cortisol in degenerative processes due to decreased opposition by insulin: Implications for aging
Sorenson, D. K. (1981) · Medical Hypotheses · doi:10.1016/0306-9877(81)90068-2 · Cited by 7 · see citing works
A cross-tissue transcriptomic approach decodes glucocorticoid receptor-dependent links to human metabolic phenotypes
Piechota, M., Zięba, M., Borczyk, M., Gołda, S., Hajto, J., Skupio, U., Ślęzak, M., Parkitna, J. M. R., & Korostyński, M. (2025) · BMC Genomics · doi:10.1186/s12864-025-11676-w · Cited by 7 · see citing works
Association between Diabetes and Rheumatoid Arthritis: A Systematic Literature Review
Okais, J., Fayad, F., Baddoura, R., Tabesh, O. A., Aouad, K., Ghoubar, M., Sunna, N., & Mysler, E. (2022) · The Open Rheumatology Journal · doi:10.2174/18743129-v16-e221205-2022-13 · Cited by 6 · see citing works
Glucocorticoid-Induced Osteoporosis
Adler, R. A., Weinstein, R. S., & Saag, K. G. (2013) · Elsevier eBooks · doi:10.1016/b978-0-12-415853-5.00049-2 · Cited by 6 · see citing works
Glucocorticoid Receptor Antagonism Improves Glucose Metabolism in a Mouse Model of Polycystic Ovary Syndrome
Li, S., Ying, Z., Gentenaar, M., Rensen, P. C. N., Kooijman, S., Visser, J. A., Meijer, O. C., & Kroon, J. (2023) · Journal of the Endocrine Society · doi:10.1210/jendso/bvad162 · Cited by 5 · see citing works
“Glucocorticoid receptor (GR) signaling is known to play a major role in various metabolic process [12, 13], including lipid metabolism [14] and glucose metabolism [15-17].”
Background
Unraveling the mysteries of hepatic insulin signaling: deconvoluting the nuclear targets of insulin
Kitamoto, T., & Accili, D. (2023) · Endocrine Journal · doi:10.1507/endocrj.ej23-0150 · Cited by 4 · see citing works
Role of small leucine zipper protein in hepatic gluconeogenesis and metabolic disorder
Kang, M., Han, S. K., Kim, S., Park, S., Jo, Y., Kang, H., & Ko, J. (2020) · Journal of Molecular Cell Biology · doi:10.1093/jmcb/mjaa069 · Cited by 4 · see citing works
“Blood glucose level is tightly regulated by various hormones such as insulin, glucagon, and glucocorticoids (Exton, 1979; Kraus-Friedmann, 1984; Roder et al., 2016).”
Background
Glucocorticoid biology — a historical perspective
Munck, A. U. (2001) · Birkhäuser Basel eBooks · doi:10.1007/978-3-0348-8348-1_2 · Cited by 4 · see citing works
Oral Metformin Treatment Counteracts Adipoinsular Axis Dysfunction in Hypothalamic Obese Rats
Castrogiovanni, D. C., Ongaro, L., Zuburía, G., Giovambattista, A., & Spinedi, E. (2015) · International Scholarly Research Notices · doi:10.1155/2015/284042 · Cited by 4 · see citing works
“Moreover, animals under endotoxemia also develop an increase in glucocorticoid production that precedes that of insulin [27]; thus the enhanced glucocorticoid endogenous environment could be cooperating for maintaining glucose homeostasis [49], a phenomenon vital for survival during endotoxic shock.”
Background
The influence of Rooibos (Aspalathus linearis) on adrenal steroidogenic P450 enzymes
Perold, H. (2009) · SUNScholar (Stellenbosch University) · Cited by 4 · see citing works
Steroid-dependent metabolic rewiring reveals novel therapeutic and imaging approaches for glioblastoma
Allega, M. F., Deshmukh, R. S., Hillinger, T., Akhmetshina, A., Oudin, A., Bielik, R., Soloviev, D., Villar, V. H., Ackermann, T., Bourmeau, G., et al. (2026) · Science Advances · doi:10.1126/sciadv.adx6539 · Cited by 3 · see citing works
“They promote gluconeogenesis in the liver ( 12 ), whereas in skeletal muscle and white adipose tissue, they cause a decrease in glucose uptake antagonizing insulin signaling ( 13 ) and inducing hyperlipidemia ( 14 ).”
Diabetes support from romantic partners during early emerging adulthood
de Grey, R. G. K., Berg, C. A., Campbell, M. S., Munion, A. K., Luyckx, K., Raymaekers, K., Litchman, M. L., & Wiebe, D. J. (2022) · Journal of Behavioral Medicine · doi:10.1007/s10865-021-00271-5 · Cited by 3 · see citing works
“For example, cortisol is involved in regulation of the pancreas, glucagon secretion and glucose uptake (Exton, 1979; Kuo et al., 2015; Thau et al., 2021), meaning that dysregulation of cortisol may complicate the management of blood glucose.”
System identification of the control of gluconeogenesis in the intact organism under conditions of long-term stress
Paletta, B., Estelberger, W., & Porod, G. (1981) · Journal of Mathematical Biology · doi:10.1007/bf00275438 · Cited by 3 · see citing works
Elevated glucocorticoids during the ovarian follicular phase predict conception in wild female chacma baboons
Steiniche, T., Foerster, S., White, K. E., Monfort, S. L., Brown, J. L., Chowdhury, S., & Swedell, L. (2023) · Hormones and Behavior · doi:10.1016/j.yhbeh.2023.105354 · Cited by 2 · see citing works
Stress and parental behaviors
Wang, Y., & Lin, D. (2024) · Neuroscience Research · doi:10.1016/j.neures.2024.12.004 · Cited by 2 · see citing works
“Glucocorticoids cause a wide range of bodily changes, such as increasing glucose levels to fuel the muscle and brain and suppressing immune systems (Hostinar et al., 2014; Coutinho and Chapman, 2011; Exton, 1979; Chourpiliadis and Narothama, 2024).”
Signaling Pathways That Promote Muscle Catabolism in Cachexia
Gilda, J. E., & Cohen, S. (2022) · Springer eBooks · doi:10.1007/978-3-031-09518-4_5 · Cited by 2 · see citing works
Hormonal and metabolic control of hepatic carbohydrate metabolism
Jakob, A. (1981) · Molecular Aspects of Medicine · doi:10.1016/0098-2997(81)90009-1 · Cited by 2 · see citing works

Physiologic significance of glucocorticoids and insulin in the regulation of hepatic gluconeogenesis during starvation in rats
Seitz, H. J., Kaiser, M., Krone, W., & Tarnowski, W. (1976) · Metabolism · doi:10.1016/0026-0495(76)90107-4 · Cited by 28 · see citing works
Mode of Action of Glucocorticoids
Ray, P. D., Foster, D. O., & Lardy, H. A. (1964) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(18)97735-5 · Cited by 99 · see citing works
Glucocorticoid control of hepatic proline oxidase
Kowaloff, E. M., Granger, A. S., & Phang, J. M. (1977) · Metabolism · doi:10.1016/0026-0495(77)90008-7 · Cited by 8 · see citing works
Interaction of Glucocorticoids with Glucagon and Epinephrine in the Control of Gluconeogenesis and Glycogenolysis in Liver and of Lipolysis in Adipose Tissue
Exton, J. H., Friedmann, N. K., Wong, E., Brineaux, J. P., Corbin, J. D., & Park, C. R. (1972) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(19)45180-6 · Cited by 282 · see citing works
Regulation of glucose homeostasis by glucocorticoids
Kuo, T., McQueen, A., Chen, T.-C., & Wang, J.-C. (2015) · Advances in Experimental Medicine and Biology · doi:10.1007/978-1-4939-2895-8_5 · Cited by 723 · see citing works

Authors: Exton, J. H.
Corresponding author: Exton, J. H.
Venue: Monographs on endocrinology
Publisher: Springer Berlin Heidelberg
Published: 1979
Volume: 12
Pages: 535-546
ISSN: 0077-1015 (ISSN-L)
DOI: 10.1007/978-3-642-81265-1_28
OpenAlex: W2407810808
Cited by: 130
References: 46
Citations by year: 2026: 5 · 2025: 4 · 2024: 6 · 2023: 10 · 2022: 8 · 2021: 3 · 2020: 10 · 2019: 4 · 2018: 2 · 2017: 4 · 2016: 5 · 2015: 4 · 2014: 1 · 2013: 3 · 2012: 4
FWCI: 2.39
Type: book chapter
Language: en
Open access: closed
Locations: Monographs on endocrinology (publishedVersion)
PubMed (publishedVersion)
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Metabolism, Diabetes, and Cancer
Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Estrogen and related hormone effects
Health Sciences › Medicine › Endocrinology, Diabetes and Metabolism › Adrenal Hormones and Disorders
Keywords: gluconeogenesis, glucocorticoids, starvation, adrenal insufficiency, glucocorticoid replacement therapy, protein synthesis, lipolysis, catecholamines, glycogenolysis, transcriptional regulation, glucagon, epinephrine, cAMP signaling, alpha-adrenergic receptors, diabetes mellitus
MeSH terms: Adrenalectomy, Animals, Diabetes Mellitus, Experimental, Epinephrine, Glucagon, Glucocorticoids, Gluconeogenesis, Hydrocortisone, Liver, Rats

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Regulation of gluconeogenesis by glucocorticoids.

Abstract

Integrity signals

Claims the paper makes

Claims other papers make about this one

Cites

Cited by

Related

Record

About these checks