Cited by 355T-cell and Retrovirus StudiesHIV Research and TreatmentCholesterol and Lipid Metabolism

The DOI matches its Crossref record; 37 of the 38 references it cites were found in a registry or an index.

A receptor for subgroup A Rous sarcoma virus is related to the low density lipoprotein receptor

Bates, Paul, Young, John A.T., Varmus, Harold E.·1993·Cell

Open this paper in CoChat — free account

Abstract

Cellular receptors are required for efficient entry of retroviruses into cells. We previously cloned a chicken gene responsible for susceptibility to the retrovirus subgroup A Rous sarcoma virus (RSV(A)). Here we have isolated the quail homolog and generated two alternatively spliced processed genes encoding cellular receptors for RSV(A). Predicted products of the processed genes appear to be small membrane-associated proteins with identical 83 amino acid extracellular domains but different membrane anchors. Within the extracellular domain is a region closely related to the ligand-binding repeat of the low density lipoprotein receptor (LDLR). Expression of either processed gene renders mammalian cells specifically susceptible to RSV(A). Antibodies directed against the receptor block subgroup A infection of avian cells via endogenous receptors and have no effect on entry of other RSV subgroups. Thus, small LDLR-related proteins are cellular receptors for RSV(A).

Integrity signals

Registry

Crossref · 10.1016/0092-8674(93)90726-7

Cites

37 of 37 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

This paper’s full text isn’t openly available, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

DNA sequencing with chain-terminating inhibitors
Sanger, F., Nicklen, S., & Coulson, A. R. (1977) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.74.12.5463 · Cited by 68,572
A simple method for displaying the hydropathic character of a protein
Kyte, J., & Doolittle, R. F. (1982) · Journal of Molecular Biology · doi:10.1016/0022-2836(82)90515-0 · Cited by 22,927
Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase
Smith, D. B., & Johnson, K. S. (1988) · Gene · doi:10.1016/0378-1119(88)90005-4 · Cited by 5,844
A new method for predicting signal sequence cleavage sites
von HEIJNE, G. (1986) · Nucleic Acids Research · doi:10.1093/nar/14.11.4683 · Cited by 4,473
Rapid and sensitive protein similarity searches
Lipman, D. J., & Pearson, W. R. (1985) · Science · doi:10.1126/science.2983426 · Cited by 4,033
The T4 gene encodes the AIDS virus receptor and is expressed in the immune system and the brain
Maddon, P. J., Dalgleish, A. G., McDougal, J. S., Clapham, P. R., Weiss, R. A., & Axel, R. (1986) · Cell · doi:10.1016/0092-8674(86)90590-8 · Cited by 2,003
Transfer of purified herpes virus thymidine kinase gene to cultured mouse cells
Wigler, M. H., Silverstein, S. J., Lee, L., Pellicer, À., Cheng, Y., & Axel, R. (1977) · Cell · doi:10.1016/0092-8674(77)90333-6 · Cited by 1,352
RNA tumor viruses
Weiss, R. A., & Bernstein, A. (1982) · Cold Spring Harbor Laboratory eBooks · Cited by 828
A putative murine ecotropic retrovirus receptor gene encodes a multiple membrane-spanning protein and confers susceptibility to virus infection
Albritton, L. M., Tseng, L., Scadden, D. T., & Cunningham, J. M. (1989) · Cell · doi:10.1016/0092-8674(89)90134-7 · Cited by 687
The LDL receptor gene: a mosaic of exons shared with different proteins.
Südhof, T. C., Goldstein, J. L., Brown, M. S., & Russell, D. W. (1985) · Science · doi:10.1126/science.2988123 · Cited by 611

Show all 38 references

Sorted by citations

Items 201–300 of 354

A Novel Member of the LDL Receptor Gene Family with Eleven Binding Repeats is Structurally Related to Neural Adhesion Molecules and a Yeast Vacuolar Protein Sorting Receptor
Yamazaki, H., Bujo, H., & Saito, Y. (1997) · Journal of Atherosclerosis and Thrombosis · doi:10.5551/jat1994.4.20 · Cited by 23
The Rous Sarcoma Virus Env Glycoprotein Contains a Highly Conserved Motif Homologous to Tyrosine-Based Endocytosis Signals and Displays an Unusual Internalization Phenotype
Ochsenbauer, C., Dubay, S. R., & Hunter, E. (2000) · Molecular and Cellular Biology · doi:10.1128/mcb.20.1.249-260.2000 · Cited by 23
“To directly test the receptor-binding activation hypothesis, it will be necessary to engineer the S19 and tyrosine motif mutations into an A subgroup virus for which the receptor gene has been cloned (3, 66); to date the cognate receptor for the PrC strain of RSV has not been identified.”
Background
Isolation of Cell Lines That Show Novel, Murine Leukemia Virus-Specific Blocks to Early Steps of Retroviral Replication
Bruce, J. W., Bradley, K. A., Ahlquist, P., & Young, J. A. T. (2005) · Journal of Virology · doi:10.1128/jvi.79.20.12969-12978.2005 · Cited by 23
“The TVA800-expressing cells were resistant to infection by MLV vectors pseudotyped with VSV-G or with the ASLV-A Env (EnvA) (Fig.”
BackgroundInfluentialSelf-citation
Continuous cell supply from Krt7-expressing hematopoietic stem cells during native hematopoiesis revealed by targeted in vivo gene transfer method
Tajima, Y., Ito, K., Umino, A., Wilkinson, A. C., Nakauchi, H., & Yamazaki, S. (2017) · Scientific Reports · doi:10.1038/srep40684 · Cited by 23
“virus A (TVA) antigen 13–15 .”
Unique Structure and Distinctive Properties of the Ancient and Ubiquitous Gamma-Type Envelope Glycoprotein
Hogan, V., & Johnson, W. E. (2023) · Viruses · doi:10.3390/v15020274 · Cited by 23
Requirements within the Ebola Viral Glycoprotein for Tetherin Antagonism
Burgt, N. H. V., Kaletsky, R. L., & Bates, P. F. (2015) · Viruses · doi:10.3390/v7102888 · Cited by 22
“To address this theory, sequences for an alternatively spliced form of avian TVA that encodes a glycosylphosphatidylinositol (GPI)-linked anchor [36,37] were appended onto sGP to produce sGP-GPIpTVAq (Figure 1a,b).”
MethodSelf-citation
Efficient Subgroup C Avian Sarcoma and Leukosis Virus Receptor Activity Requires the IgV Domain of the Tvc Receptor and Proper Display on the Cell Membrane
Munguia, A., & Federspiel, M. J. (2008) · Journal of Virology · doi:10.1128/jvi.01408-08 · Cited by 22
Replication-competent retroviral vectors for expressing genes in avian cells in vitro and in vivo
Bell, E. J. D. H., & Brickell, P. M. (1997) · Molecular Biotechnology · doi:10.1007/bf02740819 · Cited by 22
“8). Subgroup A viruses bind to a cell-surface membrane protein related to the lowdensity lipoprotein receptor ( 9 ), but receptors for viruses of other subgroups have not been characterized.”
Background
Primordial germ cells, stem cells and testicular cancer
Donovan, P. J., MIGUEL, M. D., Cheng, L., & Resnick, J. L. (1998) · Apmis · doi:10.1111/j.1699-0463.1998.tb01328.x · Cited by 22
Supplementary Materials and Methods
Groenendijk, F. H., Zwart, W. T., Floore, A. N., Akbari, S., & Bernards, R. (2013) · Cited by 22
In a Class of Their Own – RXFP1 and RXFP2 are Unique Members of the LGR Family
Petrie, E. J., Lagaida, S., Sethi, A., Bathgate, R. A. D., & Gooley, P. R. (2015) · Frontiers in Endocrinology · doi:10.3389/fendo.2015.00137 · Cited by 21
“LDLa modules have since been described in a variety of proteins both as repeats and single domains in proteins with diverse functions, such as viral entry (87), breast cancer invasion and metastasis (88), and cell differentiation (89).”
Background
Animal models to study cancer-initiating cells from Glioblastoma
Wee, B. (2011) · Frontiers in bioscience · doi:10.2741/3851 · Cited by 21
“Infectability requires expression of the receptor for the ASLV subgroup, tumor virus-A (tv-a) (78, 79).”
Background
Cell-specific targeting of lentiviral vectors mediated by fusion proteins derived from Sindbis virus, vesicular stomatitis virus, or avian sarcoma/leukosis virus
Zhang, X., Kutner, R. H., Bialkowska, A. B., Marino, M. P., Klimstra, W. B., & Reiser, J. (2010) · Retrovirology · doi:10.1186/1742-4690-7-3 · Cited by 21
“A DNA fragment encoding the extracellular domain of TVA (amino acids 1-107) linked in-frame to a proline rich sequence (PPPELLGGP) was PCR-amplified using pCB6 Tva950 [41] (a gift from Galen Fisher) as a template and primers TVA-F (5’-GTTCTAGCTAGCGCTGTGCGCGGTACCGATATG-3’) and TVA-Linker-R (5’GATTCCCTCGAGCGGTCCCCCCAGGA…”
Method
Genetic Diversity of NHE1, Receptor for Subgroup J Avian Leukosis Virus, in Domestic Chicken and Wild Anseriform Species
Reinišová, M., Plachý, J., Kučerová, D., Šenigl, F., Vinkler, M., & Hejnar, J. (2016) · PLoS ONE · doi:10.1371/journal.pone.0150589 · Cited by 21
“This would be a continuation of the existing diversity in the ALV complex, whose closely related A —E subgroups adapted to various receptors related to low-density lipoprotein receptors, tumor necrosis factor receptors, and butyrophilins [30,31,32].”
Background
Replicative homeostasis II: Influence of polymerase fidelity on RNA virus quasispecies biology: Implications for immune recognition, viral autoimmunity and other "virus receptor" diseases
Sallie, R. (2005) · Virology Journal · doi:10.1186/1743-422x-2-70 · Cited by 21
Cellular uptake of avian leukosis virus subgroup B is mediated by clathrin
Diaz‐Griffero, F., Jackson, A. P., & Brojatsch, J. (2005) · Virology · doi:10.1016/j.virol.2005.02.027 · Cited by 21
“The GPI-anchored form of the ALV-A receptor, TVA800, is associated with DRMs (Bates et al., 1993; Narayan et al., 2003).”
Background
High-Throughput Gateway Bicistronic Retroviral Vectors for Stable Expression in Mammalian Cells: Exploring the Biologic Effects of STAT5 Overexpression
Royer, Y., Menu, C., Liu, X., & Constantinescu, S. N. (2004) · DNA and Cell Biology · doi:10.1089/104454904323145245 · Cited by 21
“…Avian sarcoma-leukosis virus long terminal repeat with Splice Acceptor (RCAS) (Hughes et al ., 1987; Hughes and Kosik, 1984) code for replication competent viruses that infect avian cells or mammalian cells that have been engineered to express the avian receptor tv-a (Bates et al ., 1993, 1998).”
Role of Calcium in Protein Folding and Function of Tva, the Receptor of Subgroup A Avian Sarcoma and Leukosis Virus
Wang, Q., Dolmer, K., Huang, W., Gettins, P. G. W., & Rong, L. (2001) · Journal of Virology · doi:10.1128/jvi.75.5.2051-2058.2001 · Cited by 21
“The cellular receptor for subgroup A avian sarcoma and leukosis virus (ASLV-A) is Tva, a small membrane-associated protein (2, 3, 25).”
Background
Targeting Avian Leukosis Virus Subgroup A Vectors by Using a TVA-VEGF Bridge Protein
Astrof, S., Niederman, T. M. J., Mulligan, R. C., & Young, J. A. T. (2001) · Journal of Virology · doi:10.1128/jvi.75.3.1571-1575.2001 · Cited by 21
“4-kDa protein but the extracellular domain of TVA is subjected to extensive posttranslational modifications which add an additional 21 to 30 kDa to its apparent molecular mass (1, 2).”
BackgroundSelf-citation
Capsid Protein-Encoding Genes of Hamster Polyomavirus and Properties of the Viral Capsid
Siray, H., �zel, M., Jandrig, B., Voronkova, T., Jia, W., Zocher, R., Arnold, W., Scherneck, S., ̈ger, D. H. K., & Ulrich, R. G. (1999) · Virus Genes · doi:10.1023/a:1008017201999 · Cited by 18
Rapid adaptive evolution of avian leukosis virus subgroup J in response to biotechnologically induced host resistance
Matoušková, M., Plachý, J., Kučerová, D., Pecnová, Ľ., Reinišová, M., Geryk, J., Karafiát, V., Hron, T., & Hejnar, J. (2024) · PLoS Pathogens · doi:10.1371/journal.ppat.1012468 · Cited by 17
Avian leukosis virus is a versatile eukaryotic platform for polypeptide display
Khare, P. D., Russell, S. J., & Federspiel, M. J. (2003) · Virology · doi:10.1016/s0042-6822(03)00529-4 · Cited by 17
“The natural receptor for ALV(A) is Tva, a glycoprotein of unknown function which is normally expressed only in birds (Bates et al., 1993; Young et al., 1993).”
Background
Mapping Key Regions of the RXFP2 Low-Density Lipoprotein Class-A Module That Are Involved in Signal Activation
Kong, R. C. K., Bathgate, R. A. D., Bruell, S., Wade, J. D., Gooley, P. R., & Petrie, E. J. (2014) · Biochemistry · doi:10.1021/bi500797d · Cited by 17
Close linkage of genes encoding receptors for subgroups A and C of avian sarcoma/leucosis virus on chicken chromosome 28
Elleder, D., Plachý, J., Hejnar, J., Geryk, J., & Svoboda, J. (2004) · Animal Genetics · doi:10.1111/j.1365-2052.2004.01118.x · Cited by 17
“We had to overcome the fact that the TVA sequence originally discovered is from quail ( Bates et al. 1993 ) and to date only minor parts of the chicken sequence have been published (Bates et al. 1998).”
Background
The Human LGR7 Low‐Density Lipoprotein Class A Module Requires Calcium for Structure
Hopkins, E. J., Bathgate, R. A. D., & Gooley, P. R. (2005) · Annals of the New York Academy of Sciences · doi:10.1196/annals.1282.006 · Cited by 17
Single nucleotide polymorphism variants within tva and tvb receptor genes in Chinese chickens
Liao, C. T., Chen, S. Y., Chen, W., Liu, Y., Sun, B., Li, H., Zhang, H. M., Qu, H., Wang, J., Shu, D., et al. (2014) · Poultry Science · doi:10.3382/ps.2014-04077 · Cited by 17
“The susceptibility or resistance of chicken cells to subgroup A ALV is determined by the tumor virus locus A (tva) locus, which encodes the receptors for ALV-A (Bates et al., 1993; Gilbert et al., 1994).”
Background
Structural characterization of a fusion glycoprotein from a retrovirus that undergoes a hybrid 2‐step entry mechanism
Aydin, H., Smrke, B. M., & Lee, J. E. (2013) · The FASEB Journal · doi:10.1096/fj.13-232371 · Cited by 17
“The receptor for the ASLV subgroup A is Tva, a protein that belongs to the low-density lipoprotein receptor family (17).”
Background
HTLV envelopes and their receptor GLUT1, the ubiquitous glucose transporter: a new vision on HTLV infection?
Manel, N. (2004) · Frontiers in bioscience · doi:10.2741/1474 · Cited by 18
Xenotropism: The elusive viral receptor finally uncovered
Levy, J. A. (1999) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.96.3.802 · Cited by 17
Characterization of Mpl mutants using primary megakaryocyte-lineage cells from mpl-/- mice: a new system for Mpl structure-function studies
Gaur, M., Murphy, G. J., deSauvage, F. J., & Leavitt, A. D. (2001) · Blood · doi:10.1182/blood.v97.6.1653 · Cited by 17
ZASC1 Stimulates HIV-1 Transcription Elongation by Recruiting P-TEFb and TAT to the LTR Promoter
Bruce, J. W., Reddington, R., Mathieu, E., Bracken, M., Young, J. A. T., & Ahlquist, P. (2013) · PLoS Pathogens · doi:10.1371/journal.ppat.1003712 · Cited by 16
“Since mammalian cells do not express the receptor for EnvA [35,36], only cells co-transfected with both TVA-800 and the shRNAs were infected by the pseudotyped viruses.”
BackgroundMethodInfluentialSelf-citation
An Avian Sarcoma/Leukosis Virus-Based Gene Trap Vector for Mammalian Cells
Zheng-Bradley, X., & Hughes, S. H. (1999) · Journal of Virology · doi:10.1128/jvi.73.8.6946-6952.1999 · Cited by 16
“pGT-GFP(7) and pGT-GFP(11) are two independent clones of the vector pGT-GFP.”
Background
Pinpointing retrovirus entry sites in cells expressing alternatively spliced receptor isoforms by single virus imaging
Padilla‐Parra, S., Marin, M., Kondo, N., & Melikyan, G. B. (2014) · Retrovirology · doi:10.1186/1742-4690-11-47 · Cited by 16
“In addition, the subgroup A virus (ASLV-A) can effectively utilize two alternatively spliced isoforms of its TVA receptor, TVA800 (GPI-anchored receptor) and TVA950 (transmembrane receptor) [41,42].”
Background
Cellular Transcription Factor ZASC1 Regulates Murine Leukemia Virus Transcription
Bruce, J. W., Hierl, M. A., Young, J., & Ahlquist, P. (2010) · Journal of Virology · doi:10.1128/jvi.00299-10 · Cited by 18
“In contrast, the level of viral reporter gene expression following infection by the ASLV-A vector was only slightly reduced in IM1-TVA800 versus CHO-K1TVA800 cells (Fig.”
BackgroundMethodInfluentialSelf-citation
Gene Targeting to the Stroma of the Prostate and Bone
Jackson, R. S., Franco, O. E., & Bhowmick, N. A. (2008) · Differentiation · doi:10.1111/j.1432-0436.2008.00273.x · Cited by 16
“…M anuscript membrane-bound receptor for the avian leukosis virus sub-group A (ALV-A) retroviruses, not expressed in rodents or humans, encoded by the TVA gene (Bates et al., 1993; Federspiel et al., 1994; Holland et al., 1998a; Holland et al., 1998b; Holland and Varmus, 1998; Fisher et al., 1999).”
Background
An In Vivo Model to Study Osteogenic Gene Regulation: Targeting an Avian Retroviral Receptor (TVA) to Bone With the Bone Sialoprotein (BSP) Promoter
Li, L., Zhu, J. J., Tu, Q., Yamauchi, M., Sodek, J., Karsenty, G., Tang, J., & Chen, J. (2005) · Journal of Bone and Mineral Research · doi:10.1359/jbmr.050316 · Cited by 16
“downregulated when the Cbfa1mu is expressed under an OCN promoter.((35)) However, whereas OCN, like OPN, is also largely expressed after BSP, further studies are required to more clearly show the basis of these differences, which may reflect advantages of the TVA system in providing a more discrete time period of anal…”
BackgroundMethod
Kinetic Analysis of Binding Interaction between the Subgroup A Rous Sarcoma Virus Glycoprotein SU and Its Cognate Receptor Tva: Calcium Is Not Required for Ligand Binding
Yu, X., Wang, Q.-Y., Guo, Y., Dolmer, K., Young, J. A. T., Gettins, P. G. W., & Rong, L. (2003) · Journal of Virology · doi:10.1128/jvi.77.13.7517-7526.2003 · Cited by 15
“A 40residue cysteine-rich motif, referred to as the LDL-A module, which is highly conserved in all members of the LDL receptor (LDLR) superfamily, is located near the N terminus of the Tva extracellular domain (2).”
BackgroundMethodSelf-citation
The Avian Retroviral Receptor Tva Mediates the Uptake of Transcobalamin Bound Vitamin B 12 (Cobalamin)
Krchlíková, V., Mikešová, J., Geryk, J., Bařinka, C., Nexø, E., Fedosov, S. N., Kosla, J., Kučerová, D., Reinišová, M., Hejnar, J., et al. (2021) · Journal of Virology · doi:10.1128/jvi.02136-20 · Cited by 15
“In contrast, the physiological role of Tva has, until now, remained enigmatic despite its identification as early as in 1993 (4, 5).”
Background
Monosynaptic rabies virus tracing from projection-targeted single neurons
Masaki, Y., Yamaguchi, M., Takeuchi, R. F., & Osakada, F. (2022) · Neuroscience Research · doi:10.1016/j.neures.2022.01.007 · Cited by 15
Molecular Characteristics and Pathogenicity of an Avian Leukosis Virus Isolated from Avian Neurofibrosarcoma
Ochi, A., Ochiai, K., Nakamura, S., Kobara, A., Sunden, Y., & Umemura, T. (2012) · Avian Diseases · doi:10.1637/9830-060711-reg.1 · Cited by 15
“ALV-A (3), but the integration sites and the interactions of promoter and enhancer regions (LTR, DR1, and E elements) of CTS_5371 and host factors (transcription factors) might be the determinants of pathogenicity in peripheral nerves.”
BackgroundInfluential
Expression of Envelope Proteins of Endogeneous C-type Retrovirus on the Surface of Mouse and Human Oocytes at Fertilization
Nilsson, B. O., Jin, M., Andersson, A., ̈m, P. S., & Larsson, E. (1999) · Virus Genes · doi:10.1023/a:1008004332513 · Cited by 15
Development of an Endogenous Virus–Free Line of Chickens Susceptible to All Subgroups of Avian Leukosis Virus
Zhang, H., Bacon, L. D., & Fadly, A. M. (2008) · Avian Diseases · doi:10.1637/8180-112707-reg · Cited by 15
“TVA encodes a membrane protein related to the family of low density lipoprotein receptors (12,30,62) and is mapped to chicken autosomal chromosome 28 (51).”
Background
Novel Monoclonal Antibody Directed at the Receptor Binding Site on the Avian Sarcoma and Leukosis Virus Env Complex
Ochsenbauer‐Jambor, C., Delos, S. E., Accavitti, M. A., White, J. M., & Hunter, E. (2002) · Journal of Virology · doi:10.1128/jvi.76.15.7518-7527.2002 · Cited by 15
Naturally Occurring Frameshift Mutations in thetvbReceptor Gene Are Responsible for Decreased Susceptibility of Chicken to Infection with Avian Leukosis Virus Subgroups B, D, and E
Li, X., Chen, W., Zhang, H., Li, A., Shu, D., Li, H., Dai, Z., Yan, Y., Zhang, X., Lin, W., et al. (2017) · Journal of Virology · doi:10.1128/jvi.01770-17 · Cited by 14
“lipoprotein receptor (LDLR) family (6, 7).”
Bystander Killing during Avian Leukosis Virus Subgroup B Infection Requires TVB S3 Signaling
Diaz‐Griffero, F., Hoschander, S. A., & Brojatsch, J. (2003) · Journal of Virology · doi:10.1128/jvi.77.23.12552-12561.2003 · Cited by 14
“The plaque-forming assays were performed with a CEF cell line, DF-1, which expresses endogenous TVB as well as the ALV-A receptor TVA (2, 22).”
Method
Animal Models of Cell Cycle Dysregulation and the Pathogenesis of Gliomas
Holland, E. C. (2001) · Journal of Neuro-Oncology · doi:10.1023/a:1010609114564 · Cited by 15
“When mammalian cells are engineered to express tv-a, however, they become susceptible to infection by ALV and its derivative viral vectors (Figure 5) [17].”
Background
Manipulation of Mouse Hematopoietic Progenitors by Specific Retroviral Infection
Murphy, G. J., Göttgens, B., Vegiopoulos, A., Sánchez, M. J., Leavitt, A. D., Watson, S. P., Green, A. R., & Frampton, J. (2003) · Journal of Biological Chemistry · doi:10.1074/jbc.m302717200 · Cited by 14
Identification of glycosylation sites in the SU component of the Avian Sarcoma/Leukosis virus Envelope Glycoprotein (Subgroup A) by mass spectrometry
Kvaratskhelia, M., Clark, P. K., Hess, S. Y., Melder, D. C., Federspiel, M. J., & Hughes, S. H. (2004) · Virology · doi:10.1016/j.virol.2004.05.020 · Cited by 14
“The subgroup (A) receptor is Tva, a small protein of unknown function that is related (by sequence and structure) to the ligand binding repeat of the low-density lipoprotein receptor (LDLR) (Bates et al., 1993).”
Background
Mouse models of CNS embryonal tumors
Momota, H., & Holland, E. C. (2009) · Brain Tumor Pathology · doi:10.1007/s10014-009-0253-0 · Cited by 13
Membrane-associated GRP78 helps subgroup J avian leucosis virus enter cells
Wang, L., Mei, M., Qin, A., Ye, J., Qian, K., & Shao, H. (2016) · Veterinary Research · doi:10.1186/s13567-016-0373-6 · Cited by 13
“Tva [12], tvc [13], and chNHE1 [14] interact with the env proteins of ALV-A, C, and J, respectively.”
Background
Sequential disruption of ALV host receptor genes reveals no sharing of receptors between ALV subgroups A, B, and J
Lee, H. J., Park, K. J., Lee, K. Y., Yao, Y., Nair, V., & Han, J. Y. (2019) · Journal of Animal Science and Biotechnology/Journal of animal science and biotechnology · doi:10.1186/s40104-019-0333-x · Cited by 13
Squamous Cell Carcinoma Antigen 1-mediated Binding of Hepatitis B Virus to Hepatocytes Does Not Involve the Hepatic Serpin Clearance System
Moore, P. L., Ong, S., & Harrison, T. J. (2003) · Journal of Biological Chemistry · doi:10.1074/jbc.m302842200 · Cited by 13
Binding of more than one Tva800 molecule is required for ASLV-A entry
Gray, E. R., Illingworth, C. J. R., Coffin, J. M., & Stoye, J. P. (2011) · Retrovirology · doi:10.1186/1742-4690-8-96 · Cited by 13
“They are identical in the extracellular domain, including the viral envelope binding motifs, but differ in their attachment to cells [11].”
BackgroundMethodInfluential
Gene Structure and Molecular Phylogeny of the Linker Chains from the Giant Annelid Hexagonal Bilayer Hemoglobins
Chabasse, C., Bailly, X., Sanchez-Brosseau, S., Rousselot, M., & Zal, F. (2006) · Journal of Molecular Evolution · doi:10.1007/s00239-005-0198-9 · Cited by 13
“1994), the receptor for subgroup A Rous sarcoma virus (Bates et al. 1993), and enterokinase (Kitamoto et al.”
Background
Avian Sarcoma and Leukosis Virus Envelope Glycoproteins Evolve to Broaden Receptor Usage Under Pressure from Entry Competitors †
Munguia, A., & Federspiel, M. J. (2019) · Viruses · doi:10.3390/v11060519 · Cited by 12
Proteomes, kinases and signalling pathways in virus‐induced filopodia, as potential antiviral therapeutics targets
Aliyu, I. A., Kumurya, A. S., Bala, J. A., Hassan, Y., & Saidu, H. (2020) · Reviews in Medical Virology · doi:10.1002/rmv.2202 · Cited by 12
“labelled with yellow fluorescence protein and MLV capsid containing envelope glycoprotein of ALV were fused with ALV receptor Tva (forming virus‐receptor complex) on the surface of filopodia, and surf along HEK 239 cells before internalization.(70) Filopodia surfing was also reported in human immunodeficiency virus (H…”
Method
Characterization of the LDL‐A module mutants of Tva, the subgroup A Rous sarcoma virus receptor, and the implications in protein folding
Wang, Q., Manicassamy, B., Yu, X., Dolmer, K., Gettins, P. G. W., & Rong, L. (2002) · Protein Science · doi:10.1110/ps.0219802 · Cited by 12
“Furthermore, these results suggest that the familial hypercholesterolemia (FH) French Canadian-4 mutation is likely caused by protein misfolding of low-density lipoprotein receptor, thus explaining the defect for this class of FH. Keywords: Tva; LDL-A module; protein folding; familial hypercholesterolemia (FH) Tva is…”
BackgroundInfluential
Genetic variation at the tumour virus B locus in commercial and laboratory chicken populations assessed by a medium-throughput or a high-throughput assay
Zhang, H. M., Bacon, L. D., Heidari, M., Muir, W. M., Groenen, M. A. M., Zhang, Y., Wong, G. K., Fulton, J. E., O'Sullivan, N. P., Albers, G. A. A., et al. (2007) · Avian Pathology · doi:10.1080/03079450701449248 · Cited by 12
“TVB encodes the receptors for subgroup B, D, and E avian leukosis viruses (ALV-B, ALV-D, and ALV-E) (Adkins et al , 2000 ), TVA encodes the receptors for subgroup ALV-A (Bates et al , 1993 ; Gilbert et al , 1994 ), TVC encodes the receptors for subgroup ALV-C (Elleder et al , 2004 ) and, comparably, TVJ may be defined…”
Background
Expanded Tropism and Altered Activation of a Retroviral Glycoprotein Resistant to an Entry Inhibitor Peptide
Amberg, S. M., Netter, R. C., Simmons, G., & Bates, P. F. (2005) · Journal of Virology · doi:10.1128/jvi.80.1.353-359.2006 · Cited by 12
“Although this repeat is found in a wide variety of membrane proteins (39), only Tva has been shown to function as a receptor for ASLV-A.”
BackgroundInfluentialSelf-citation
Mutations in Both the Surface and Transmembrane Envelope Glycoproteins of the RAV-2 Subgroup B Avian Sarcoma and Leukosis Virus Are Required to Escape the Antiviral Effect of a Secreted Form of the TvbS3 Receptor †
Yin, X., Melder, D. C., Payne, W. S., Dodgson, J. B., & Federspiel, M. J. (2019) · Viruses · doi:10.3390/v11060500 · Cited by 11
The Mouse IAPE Endogenous Retrovirus Can Infect Cells through Any of the Five GPI-Anchored EphrinA Proteins
Dewannieux, M., Vernochet, C., Ribet, D., Bartosch, B., Cosset, F., & Heidmann, T. (2011) · PLoS Pathogens · doi:10.1371/journal.ppat.1002309 · Cited by 11
“, and one of the isoforms of TVA, the receptor used by the avian sarcoma and leukosis virus (the other isoform being a single transmembrane protein)”
Chapter 4 Recombinant Rous Sarcoma Virus Vectors for Avian Cells
Odorizzi, G., & Trowbridge, I. S. (1994) · Methods in cell biology · doi:10.1016/s0091-679x(08)60599-3 · Cited by 11
Model of the TVA Receptor Determinants Required for Efficient Infection by Subgroup A Avian Sarcoma and Leukosis Viruses
Melder, D. C., Pike, G. M., VanBrocklin, M. W., & Federspiel, M. J. (2014) · Journal of Virology · doi:10.1128/jvi.02339-14 · Cited by 10
“TVA proteins, which are proteins related to the low-density lipoprotein (LDL) receptors (LDLRs), are receptors for ASLV(A) (14, 15).”
Background
Library Screening and Receptor-Directed Targeting of Gammaretroviral Vectors
Mazari, P. M., & Roth, M. J. (2012) · Future Microbiology · doi:10.2217/fmb.12.122 · Cited by 10
Molecular biology and genetic models of glioma and medulloblastoma
Lassman, A. B., & Holland, E. C. (2006) · CRC Press eBooks · doi:10.1201/b13439-70 · Cited by 10
A premature stop codon within thetvbreceptor gene results in decreased susceptibility to infection by avian leukosis virus subgroups B, D, and E
Chen, W., Liu, Y., Li, A., Li, X., Li, H., Dai, Z., Yan, Y., Zhang, X., Shu, D., Zhang, H., et al. (2017) · Oncotarget · doi:10.18632/oncotarget.22512 · Cited by 10
RCAS-Mediated Retroviral Gene Delivery: A Versatile Tool for the Study of Gene Function in a Mouse Model of Pancreatic Cancer
Mayr, U., von Werder, A., Seidler, B., Reindl, W., Bajbouj, M., Schmid, R. M., Schneider, G., & Saur, D. (2008) · Human Gene Therapy · doi:10.1089/hum.2008.014 · Cited by 10
“In 1993 the group of H. Varmus cloned the receptor of the avian leucosis-sarcoma virus subgroup A (ALSV-A), called tumor virus A (TVA) (Bates et al ., 1993; Young et al ., 1993).”
Simple, Automated, High Resolution Mass Spectrometry Method to Determine the Disulfide Bond and Glycosylation Patterns of a Complex Protein
Pike, G. M., Madden, B. J., Melder, D. C., Charlesworth, M. C., & Federspiel, M. J. (2011) · Journal of Biological Chemistry · doi:10.1074/jbc.m111.229377 · Cited by 10
Influence of the alv 6 Recombinant Avian Leukosis Virus Transgene on Production Traits and Infection with Avian Tumor Viruses in Chickens
Gavora, J. S., Benkel, B. F., SPENCER, J. L., Gagnon, C. A., & Crittenden, L. B. (1995) · Poultry Science · doi:10.3382/ps.0740852 · Cited by 10
Mutational Analysis of the Subgroup A Avian Sarcoma and Leukosis Virus Putative Fusion Peptide Domain
Balliet, J. W., Gendron, K. B., & Bates, P. F. (2000) · Journal of Virology · doi:10.1128/jvi.74.8.3731-3739.2000 · Cited by 10
“We next determined if changes in the FPD affect the ability of Myc-EnvA to bind to Tva, the receptor for subgroup A ASLV, using an ELISA-based binding assay (3).”
MethodSelf-citation
Residues E53, L55, H59, and G70 of the cellular receptor protein Tva mediate cell binding and entry of the novel subgroup K avian leukosis virus
Li, X., Chen, Y., Yu, M., Wang, S., Liu, P., Meng, L., Guo, R., Feng, X., Hu, M., He, T., et al. (2023) · Journal of Biological Chemistry · doi:10.1016/j.jbc.2023.102962 · Cited by 9
“Tva proteins are related to low-density lipoprotein receptors, which consist of an amino-terminal extracellular domain of 83 residues and transmembrane and cytoplasmic tail regions of 23 and 32 amino acids, respectively (11).”
Background
The RCAS/TVA Somatic Gene Transfer Method in Modeling Human Cancer
Li, Y., Ferris, A. L., Lewis, B. C., Oršulić, S., Williams, B. O., Holland, E. C., & Hughes, S. H. (2011) · Springer eBooks · doi:10.1007/978-0-387-69805-2_5 · Cited by 9
The hr1 and Fusion Peptide Regions of the Subgroup B Avian Sarcoma and Leukosis Virus Envelope Glycoprotein Influence Low pH-Dependent Membrane Fusion
Babel, A. R., Bruce, J. W., & Young, J. A. T. (2007) · PLoS ONE · doi:10.1371/journal.pone.0000171 · Cited by 9
“Altered Env stability might also account for the TVA-independent infection seen with viruses bearing a six amino acid deletion within the hr1 region of ASLV-A SU [12].”
BackgroundSelf-citation
An NF-κB-Dependent Survival Pathway Protects against Cell Death Induced by TVB Receptors for Avian Leukosis Viruses
Chi, Y., Diaz‐Griffero, F., Wang, C., Young, J. A. T., & Brojatsch, J. (2002) · Journal of Virology · doi:10.1128/jvi.76.11.5581-5587.2002 · Cited by 9
“ALV-A, which utilizes the low density lipoprotein receptor (LDLR)-related TVA receptors and presumably does not activate NF- B (4), was used as a negative control.”
MethodSelf-citation
Live Cell Imaging of Retroviral Entry
Hulme, A. E., & Hope, T. J. (2014) · Annual Review of Virology · doi:10.1146/annurev-virology-031413-085502 · Cited by 8
Residues L55 and W69 of Tva Mediate Entry of Subgroup A Avian Leukosis Virus
Chen, Y., Wang, S., Li, X., Yu, M., Liu, P., Meng, L., Guo, R., Feng, X., Liu, A., Qi, X., et al. (2022) · Journal of Virology · doi:10.1128/jvi.00678-22 · Cited by 8
Conformational Changes in Enveloped Virus Surface Proteins During Cell Entry
Fass, D. (2003) · Advances in protein chemistry · doi:10.1016/s0065-3233(03)01009-x · Cited by 8
Differentially expressed genes in a flock of Chinese local-breed chickens infected with a subgroup J avian leukosis virus using suppression subtractive hybridization
Zhao, G., Zheng, M., Chen, J., Wen, J., Wu, C., Li, W., Liu, L., & Zhang, Y. (2009) · Genetics and Molecular Biology · doi:10.1590/s1415-47572009005000097 · Cited by 8
“Whereas receptor genes of subgroups A, B, C, D and J were identified by using transfected cultured cell methods (Bates et al., 1993; Young et al., 1993; Barnard and Young, 2003; Elleder et al., 2005; Chai and Bates., 2006), in ALV infection and tumor metastasis, the leading causes of tumor-related deaths, this involve…”
BackgroundMethod
The Spacing between Cysteines Two and Three of the LDL-A Module of Tva Is Important for Subgroup A Avian Sarcoma and Leukosis Virus Entry
Rai, T., Marble, D. J., Rihani, K., & Rong, L. (2003) · Journal of Virology · doi:10.1128/jvi.78.2.683-691.2004 · Cited by 8
“Entry of subgroup A avian sarcoma and leukosis virus (ASLV-A) into its hosts is mediated by interactions between the viral glycoprotein EnvA and a small cell surface glycoprotein, Tva (1, 29).”
Background
Development of the pancreas and pancreatic cancer.
Lewis, B. (2006) · Endocrinology and metabolism clinics of North America (Print) · doi:10.1016/j.ecl.2006.02.003 · Cited by 10
Retroviral Gene Transfer in Chondrogenic Limb Bud Micromass Cultures
Stott, N. S., Lee, Y., & Chuong, C. (1998) · BioTechniques · doi:10.2144/98244rr03 · Cited by 8
“Self-inactivating” rabies viruses are susceptible to loss of their intended attenuating modificationPreprint
Jin, L., Matsuyama, M., Sullivan, H. A., Zhu, M., Lavin, T. K., Hou, Y., Lea, N. E., Pruner, M. T., Ferdínez, M. L. D., & Wickersham, I. R. (2019) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/550640 · Cited by 8
Examination of antisense RNA and oligodeoxynucleotides as potential inhibitors of avian leukosis virus replication in RP30 cells
Kim, K. E., Salter, D. W., & Dodgson, J. B. (1998) · Poultry Science · doi:10.1093/ps/77.9.1400 · Cited by 7
Resistance of livestock to viruses: mechanisms and strategies for genetic engineering
Gavora, J. S. (1996) · Genetics Selection Evolution · doi:10.1186/1297-9686-28-5-385 · Cited by 7
A novel Flk1-TVA transgenic mouse model for gene delivery to angiogenic vasculature
Vervoort, V. S., Lu, M., Valencia, F., Lesperance, J., Breier, G., Oshima, R. G., & Pasquale, E. B. (2007) · Transgenic Research · doi:10.1007/s11248-007-9156-1 · Cited by 7
“To identify the transgenic lines with highest TVA protein expression in adult angiogenic vasculature, we prepared affinity-purified anti-TVA antibodies by immunizing rabbits with a GST–TVA fusion protein (Bates et al. 1993).”
Method
Avian leukosis virus‐receptor interactions
Young, J. A. T. (1998) · Avian Pathology · doi:10.1080/03079459808419289 · Cited by 7
Self-citation
Avian Sarcoma and Leukosis Virus Cytopathic Effect in the Absence of TVB Death Domain Signaling
Klucking, S., Collins, A. S., & Young, J. A. T. (2005) · Journal of Virology · doi:10.1128/jvi.79.13.8243-8248.2005 · Cited by 7
“dylinositol-linked form of the TVA receptor (4).”
BackgroundInfluentialSelf-citation
The Mouse Homolog of the Bovine Leukemia Virus Receptor Is Closely Related to the δ Subunit of Adaptor-Related Protein Complex AP-3, Not Associated with the Cell Surface
Suzuki, T., & Ikeda, H. (1998) · Journal of Virology · doi:10.1128/jvi.72.1.593-599.1998 · Cited by 7
“Several cellular receptors for retroviruses have been identified: a novel protein as a BLV receptor (3, 4), CD4 (7, 15) and chemokine receptors (8, 10, 12) as human immunodeficiency virus type 1 receptors, a cationic amino acid transporter as an ecotropic murine leukemia virus receptor (1), sodium-phosphate symporters…”
Background
Pseudorabies virus upregulates low-density lipoprotein receptors to facilitate viral entry
Ma, Y.-X., Chai, Y.-J., Han, Y.-Q., Zhao, S., Yang, G., Wang, J., Ming, S., & Chu, B. (2023) · Journal of Virology · doi:10.1128/jvi.01664-23 · Cited by 6
“LDLR-related protein acts as a receptor for subgroup A Rous sarcoma virus to enter avian cells (54).”
Background
Overview of Retrovirology
Rosenberg, N. E. (2010) · Springer eBooks · doi:10.1007/978-0-387-09581-3_1 · Cited by 6
“For example, the receptor for viruses like Moloney murine leukemia virus (MuLV) and related murine viruses is the cationic amino acid transporter (Kim et al., 1991) , whereas the receptor for subgroup B avian leukosis viruses is a member of the tumor necrosis factor (TNF) family (Bates, Young and Varmus, 1993) , and t…”
Identification of Two Residues within the LDL-A Module of Tva That Dictate the Altered Receptor Specificity of Mutant Subgroup A Avian Sarcoma and Leukosis Viruses
Rai, T., Caffrey, M. S., & Rong, L. (2005) · Journal of Virology · doi:10.1128/jvi.79.23.14962-14966.2005 · Cited by 6
“The genes encoding the Tva protein have been identified from both chicken and quail cells by a DNA transfer technique (2, 3, 30).”
BackgroundMethod
Recombinant Fluorescent Rabies Virus Vectors for Tracing Neurons and Synaptic ConnectionsPreprint
Hagendorf, N., & Conzelmann, K. (2015) · Cold Spring Harbor Protocols · doi:10.1101/pdb.top089391 · Cited by 6
“The receptor for EnvA (or EnvA) is TVA, a small avian protein not present in mammalian cells (Bates et al. 1993).”
Background
A review of genetic variation underlying chicken phenotypic diversity
Fulton, J. E., McCarron, A. M., Mullen, A., Ali, L., & Tarrant, K. J. (2025) · Poultry Science · doi:10.1016/j.psj.2025.105761 · Cited by 6
“The tva locus is a member of the low-density lipoprotein receptor (LDLR) gene family and is located on chicken chromosome 28, near the tvc locus (Bates et al., 1993; Elleder et al., 2005).”
Virus-based vectors for gene expression in mammalian cells: Retrovirus
Parolin, C., & Palù, G. (2003) · New comprehensive biochemistry · doi:10.1016/s0167-7306(03)38014-7 · Cited by 5
Retrovirus Receptor Interactions and Entry
Albritton, L. M. (2018) · Elsevier eBooks · doi:10.1016/b978-0-12-811185-7.00001-7 · Cited by 6
Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies virusesPreprint
Jin, L., Sullivan, H. A., Zhu, M., Lavin, T. K., Matsuyama, M., Fu, X., Lea, N. E., Xu, R., Hou, Y., Rutigliani, L., et al. (2021) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2021.12.04.471186 · Cited by 5
A Study of the Ebola Virus Glycoprotein: Disruption of Host Surface Protein Function and Evasion of Immune Responses
Francica, J. R. (2010) · ScholarlyCommons (University of Pennsylvania) · Cited by 4
Low-density lipoprotein receptor genetic polymorphism in chronic hepatitis C virus Egyptian patients affects treatment response
Naga, M. I. (2015) · World Journal of Gastroenterology · doi:10.3748/wjg.v21.i39.11141 · Cited by 4
Receptors for animal retroviruses
Miyazawa, T. (2009) · Uirusu · doi:10.2222/jsv.59.223 · Cited by 4
Genetics of Host Resistance to Retroviruses and Cancer
Okeoma, C. M., & Ross, S. R. (2010) · Springer eBooks · doi:10.1007/978-0-387-09581-3_4 · Cited by 4

Authors: Bates, P., Young, J. A. T., & Varmus, H. E.
Affiliations: University of California, San Francisco (US)
ORCID: Bates, Paul
Young, John A.T.
Varmus, Harold E.
Venue: Cell
Publisher: Elsevier BV
Published: 1993-09
Volume: 74
Issue: 6
Pages: 1043-1051
ISSN: 0092-8674 (ISSN-L)
DOI: 10.1016/0092-8674(93)90726-7
OpenAlex: W1969563526
Cited by: 355
References: 38
Citations by year: 2026: 3 · 2025: 4 · 2024: 5 · 2023: 4 · 2022: 5 · 2021: 6 · 2020: 4 · 2019: 6 · 2018: 3 · 2017: 10 · 2016: 3 · 2015: 13 · 2014: 11 · 2013: 12 · 2012: 8
FWCI: 6.34
Type: journal article
Language: en
Open access: closed
Licence: www.elsevier.com/tdm/userlicense/1.0/ (tdm)
Locations: Cell (publishedVersion)
PubMed (publishedVersion)
Funders: National Institutes of Health (2r35ca039832-08)
National Cancer Institute (CA 39832)
Topics: Life Sciences › Immunology and Microbiology › Immunology › T-cell and Retrovirus Studies
Life Sciences › Immunology and Microbiology › Virology › HIV Research and Treatment
Life Sciences › Biochemistry, Genetics and Molecular Biology › Biochemistry › Cholesterol and Lipid Metabolism
Keywords: cell receptors, LDL receptor, alternative splicing, membrane-associated proteins, chickens, quail, avian cells
MeSH terms: Amino Acid Sequence, Animals, Avian Sarcoma Viruses, Base Sequence, Cell Line, Chick Embryo, Chickens, Cloning, Molecular, DNA, Glutathione Transferase, Humans, Molecular Sequence Data, Plasmids, Quail, Receptors, LDL, Receptors, Virus, Recombinant Fusion Proteins, Transfection, Gene Library, 3T3 Cells, Sequence Homology, Amino Acid, Mice

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

A receptor for subgroup A Rous sarcoma virus is related to the low density lipoprotein receptor

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Citations

Cites

Cited by

Related

Metadata

Record

About these checks