The DOI matches its Crossref record; 38 of the 39 references it cites were found in a registry or an index.
Molecular Architecture of the Mos1 Paired-End Complex: The Structural Basis of DNA Transposition in a Eukaryote
Open accessAbstract
A key step in cut-and-paste DNA transposition is the pairing of transposon ends before the element is excised and inserted at a new site in its host genome. Crystallographic analyses of the paired-end complex (PEC) formed from precleaved transposon ends and the transposase of the eukaryotic element Mos1 reveals two parallel ends bound to a dimeric enzyme. The complex has a trans arrangement, with each transposon end recognized by the DNA binding region of one transposase monomer and by the active site of the other monomer. Two additional DNA duplexes in the crystal indicate likely binding sites for flanking DNA. Biochemical data provide support for a model of the target capture complex and identify Arg186 to be critical for target binding. Mixing experiments indicate that a transposase dimer initiates first-strand cleavage and suggest a pathway for PEC formation.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Intasomes from several retroviral species as well as prokaryotic and eukaryotic transpososomes have been visualised as post-catalytic strand transfer complexes, all of which display sharp deformations of target DNA29,30,32,33,37,51–54.”
From Structure and function of retroviral integrase (2022) · cites this paper as [51]
Experimental — accuracy not yet measured
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
Transposable elements and the epigenetic regulation of the genome
Slotkin, R. K., & Martienssen, R. (2007) · Nature Reviews Genetics · doi:10.1038/nrg2072 · Cited by 2,044
Beese, L. S., & Steitz, T. A. (1991) · The EMBO Journal · doi:10.1002/j.1460-2075.1991.tb07917.x · Cited by 1,059
Luscombe, N. M. (2001) · Nucleic Acids Research · doi:10.1093/nar/29.13.2860 · Cited by 981
Junk DNA as an evolutionary force
Biémont, C., & Vieira, C. P. (2006) · Nature · doi:10.1038/443521a · Cited by 736
Making and Breaking Nucleic Acids: Two-Mg2+-Ion Catalysis and Substrate Specificity
Yang, W., Lee, J. Y., & Nowotny, M. (2006) · Molecular Cell · doi:10.1016/j.molcel.2006.03.013 · Cited by 573
RAG1 Core and V(D)J Recombination Signal Sequences Were Derived from Transib Transposons
Kapitonov, V. V., & Jurka, J. (2005) · PLoS Biology · doi:10.1371/journal.pbio.0030181 · Cited by 521
Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system
Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., & Jenkins, N. A. (2005) · Nature · doi:10.1038/nature03691 · Cited by 482
Resident aliens: the Tc1/ mariner superfamily of transposable elements
Plasterk, R. H. A., Izsvák, Z., & Ivics, Z. (1999) · Trends in Genetics · doi:10.1016/s0168-9525(99)01777-1 · Cited by 472
A purified mariner transposase is sufficient to mediate transposition in vitro.
Lampe, D. J., Churchill, M. E. A., & Robertson, H. M. (1996) · The EMBO Journal · doi:10.1002/j.1460-2075.1996.tb00930.x · Cited by 457
Roth, D. B., Menetski, J. P., Nakajima, P. B., Bosma, M. J., & Gellert, M. F. (1992) · Cell · doi:10.1016/0092-8674(92)90248-b · Cited by 440
Flagged first, then by citations
1 of the 39 references couldn’t be matched to a known paper.
Cited by
Sorted by citations
Bacterial insertion sequences: their genomic impact and diversity
Siguier, P., Gourbeyre, E., & Chandler, M. (2014) · FEMS Microbiology Reviews · doi:10.1111/1574-6976.12067 · Cited by 773
“Other ISs such as the IS630 family, related to the eukaryote mariner/Tc superfamily, employ a mechanism in which the initial H2O-catalysed cleavage of the nontransferred strand occurs with a small offset of 2 bases into the IS prior to cleavage of the transferred strand (Feng & Colloms, 2007) as do their eukaryotic co…”
BackgroundNucleases: diversity of structure, function and mechanism
Yang, W. (2011) · Quarterly Reviews of Biophysics · doi:10.1017/s0033583510000181 · Cited by 692
Retroviral intasome assembly and inhibition of DNA strand transfer
Hare, S., Gupta, S. S., Valkov, E., Engelman, A., & Cherepanov, P. (2010) · Nature · doi:10.1038/nature08784 · Cited by 678
Craigie, R., & Bushman, F. D. (2012) · Cold Spring Harbor Perspectives in Medicine · doi:10.1101/cshperspect.a006890 · Cited by 327
“The intertwined nature of protein–protein and protein–DNA contacts is reminiscent of the structures of Tn5 and Mos1 transpososomes (Davies et al. 2000; Richardson et al. 2009).”
BackgroundThe mechanism of retroviral integration from X-ray structures of its key intermediates
Maertens, G. N., Hare, S., & Cherepanov, P. (2010) · Nature · doi:10.1038/nature09517 · Cited by 296
“The reservoir contained 20% (6)-2-methyl-2,4-pentanediol (MPD), 40 mM MgCl2 and 50 mM sodium cacodylate, pH 5.”
BackgroundLesbats, P., Engelman, A., & Cherepanov, P. (2016) · Chemical Reviews · doi:10.1021/acs.chemrev.6b00125 · Cited by 250
Structure-based modeling of the functional HIV-1 intasome and its inhibition
Krishnan, L., Li, X., Naraharisetty, H. L., Hare, S., Cherepanov, P., & Engelman, A. (2010) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1002346107 · Cited by 197
“A theme common to transpososome (3, 4) and retroviral intasome (26) structures is the unpairing of the donor DNA duplex at the enzyme active site, which is probably important to unveil the scissile phosphodiester bond for 3′ processing and resulting 3′-OH nucleophile for subsequent DNA strand transfer.”
BackgroundMolecular Mechanism of V(D)J Recombination from Synaptic RAG1-RAG2 Complex Structures
Ru, H., Chambers, M. G., Fu, T., Tong, A., Liao, M., & Wu, H. (2015) · Cell · doi:10.1016/j.cell.2015.10.055 · Cited by 200
“Similarly, in the crystal structure of the eukaryotic transposase Mos1, precleaved transposon signal ends mimicked non-specific interactions by the flanking DNA (Richardson et al., 2009).”
Crystal structure of the V(D)J recombinase RAG1–RAG2
Kim, M.-S., Lapkouski, M., Yang, W., & Gellert, M. F. (2015) · Nature · doi:10.1038/nature14174 · Cited by 172
Recurrent evolution of vertebrate transcription factors by transposase capture
Cosby, R. L., Judd, J., Zhang, R., Zhong, A., Garry, N., Pritham, E. J., & Feschotte, C. (2021) · Science · doi:10.1126/science.abc6405 · Cited by 173
Integrating prokaryotes and eukaryotes: DNA transposases in light of structure
Hickman, A. B., Chandler, M., & Dyda, F. (2010) · Critical Reviews in Biochemistry and Molecular Biology · doi:10.3109/10409230903505596 · Cited by 155
“…in Chaconas and Harshey, 2002; Rice, 2005); members of the mariner family use two HTH domains (reviewed in Plasterk et al., 1999; van Pouderoyen et al., 1997; Watkins et al., 2004; Richardson et al., 2009); and OrfAB, the transposase of IS911, uses a single HTH domain (Rousseau et al., 2002).”
BackgroundInfluentialThe Mu transpososome structure sheds light on DDE recombinase evolution
Montaño, S. P., Pigli, Y. Z., & Rice, P. A. (2012) · Nature · doi:10.1038/nature11602 · Cited by 137
The Tn 3 -family of Replicative Transposons
Nicolas, É., Lambin, M., Dandoy, D., Galloy, C., Nguyen, N., Oger, C. A., & Hallet, B. (2015) · Microbiology Spectrum · doi:10.1128/microbiolspec.mdna3-0060-2014 · Cited by 141
Structure and function of retroviral integrase
Maertens, G. N., Engelman, A. N., & Cherepanov, P. (2022) · Nature Reviews Microbiology · doi:10.1038/s41579-021-00586-9 · Cited by 124
Mechanisms of DNA Transposition
Hickman, A. B., & Dyda, F. (2015) · Microbiology Spectrum · doi:10.1128/microbiolspec.mdna3-0034-2014 · Cited by 138
“, MuA (93, 96) and the mariner elements (90, 97)), or to bind multiple sites close to the transposon ends where each site binds a separate transposase monomer (e.”
BackgroundHickman, A. B., & Dyda, F. (2016) · Chemical Reviews · doi:10.1021/acs.chemrev.6b00003 · Cited by 123
Linheiro, R. S., & Bergman, C. (2012) · PLoS ONE · doi:10.1371/journal.pone.0030008 · Cited by 122
“[58,59]), with the target site entering the catalytic complex along an axis of two-fold symmetry [60,61].”
BackgroundStructural insights into the retroviral DNA integration apparatus
Cherepanov, P., Maertens, G. N., & Hare, S. (2011) · Current Opinion in Structural Biology · doi:10.1016/j.sbi.2010.12.005 · Cited by 122
Harshey, R. M. (2014) · Microbiology Spectrum · doi:10.1128/microbiolspec.mdna3-0007-2014 · Cited by 96
“As first demonstrated for MuA (9), the Tn5 transposase subunits were observed to be arranged in trans for catalysis (57), a feature proving to be widespread among mobile elements (22, 58, 59, 60).”
BackgroundDDE transposases: Structural similarity and diversity
Nesmelova, I. V., & Hackett, P. B. (2010) · Advanced Drug Delivery Reviews · doi:10.1016/j.addr.2010.06.006 · Cited by 90
“, Tn5 and Mos1), truncated DD[E/D]-transposases or their functional domains have been determined [17,18,25–36] (Table 1).”
Structural basis of seamless excision and specific targeting by piggyBac transposase
Chen, Q., Luo, W., Veach, R. A., Hickman, A. B., Wilson, M. H., & Dyda, F. (2020) · Nature Communications · doi:10.1038/s41467-020-17128-1 · Cited by 90
Mariner and the ITm Superfamily of Transposons
Tellier, M., Bouuaert, C. C., & Chalmers, R. (2015) · Microbiology Spectrum · doi:10.1128/microbiolspec.mdna3-0033-2014 · Cited by 78
“7(A)] (57).”
BackgroundHickman, A. B., Ewis, H. E., Li, X., Knapp, J. A., Laver, T. W., Doss, A.-L., Tolun, G., Steven, A. C., Grishaev, A., Bax, A., et al. (2014) · Cell · doi:10.1016/j.cell.2014.05.037 · Cited by 72
“Binding of two transposon ends is a property of all DNA transpososomes that have been structurally characterized to date (Davies et al., 2000; Richardson et al., 2009; Montaño et al., 2012).”
BackgroundInfluentialFunctional Evolution of Subolesin/Akirin
Artigas-Jerónimo, S., Villar, M., Cabezas‐Cruz, A., Valdés, J. J., Estrada‐Peña, A., Alberdi, P., & de la Fuente, J. (2018) · Frontiers in Physiology · doi:10.3389/fphys.2018.01612 · Cited by 70
Moving DNA around: DNA transposition and retroviral integration
Montaño, S. P., & Rice, P. A. (2011) · Current Opinion in Structural Biology · doi:10.1016/j.sbi.2011.03.004 · Cited by 68
“Although contacts between DNA-binding domains occur in other recombinases [13 ,30,31], this degree of intertwining has only been seen in the DNA-binding domain of Hermes transposase, which follows a similar hairpin-formation pathway [32].”
BackgroundIvics, Z., & Izsvák, Z. (2015) · Microbiology Spectrum · doi:10.1128/microbiolspec.mdna3-0042-2014 · Cited by 64
“Although the crystal structure of the SB transposase catalytic domain is yet to be solved, the available Mos1 mariner structure from Drosophila mauritiana (26) is assumed to be the closest to model the structure of the SB transposase.”
BackgroundVoigt, F., Wiedemann, L., Zuliani, C., Querques, I., Sebe, A., Mátés, L., Izsvák, Z., Ivics, Z., & Barábas, O. (2016) · Nature Communications · doi:10.1038/ncomms11126 · Cited by 62
Iyer, L. M., Zhang, D., de Souza, R. F., Pukkila, P. J., Rao, A., & Aravind, L. (2014) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1321818111 · Cited by 60
“A well-studied transposon family with a comparable insert between strands 1 and 2 is Mariner (Mos1), where the crystal structure shows that the insert is involved in making specific contacts with the target DNA (21).”
BackgroundThe autoregulation of a eukaryotic DNA transposon
Bouuaert, C. C., Lipkow, K., Andrews, S. S., Liu, D., & Chalmers, R. (2013) · eLife · doi:10.7554/elife.00668 · Cited by 59
“The RA104 mutation is located within the second helix-turn-helix motif, and abolishes an ionic interaction with the phosphodiester backbone (Roman et al., 2007; Richardson et al., 2009).”
BackgroundEngelman, A., & Cherepanov, P. (2017) · Current Opinion in Structural Biology · doi:10.1016/j.sbi.2017.04.005 · Cited by 58
“As has been noted some time ago [37], DNA transposases tend to form functional multimers only on their DNA substrates, which is explained by the key roles that proteinDNA contacts play in the formation of transpososomes [38-40].”
BackgroundHickman, A. B., & Dyda, F. (2015) · Nucleic Acids Research · doi:10.1093/nar/gkv1180 · Cited by 54
Sleeping Beauty transposition: from biology to applications
Narayanavari, S. A., Chilkunda, S. S., Ivics, Z., & Izsvák, Z. (2016) · Critical Reviews in Biochemistry and Molecular Biology · doi:10.1080/10409238.2016.1237935 · Cited by 56
“As in MOS1 (Richardson et al., 2009), this interface might bring two catalytic domains into close proximity with their active sites facing each other during synaptic assembly.”
BackgroundInfluentialThe Mu story: how a maverick phage moved the field forward
Harshey, R. M. (2012) · Mobile DNA · doi:10.1186/1759-8753-3-21 · Cited by 52
“The trans feature of transposase-mediated catalysis is also proving to be widespread among mobile elements [24-27].”
DNA recognition and the precleavage state during single‐stranded DNA transposition in D. radiodurans
Hickman, A. B., James, J. A., Barábas, O., Pasternak, C., Ton‐Hoang, B., Chandler, M., Sommer, S., & Dyda, F. (2010) · The EMBO Journal · doi:10.1038/emboj.2010.241 · Cited by 51
“The wide range of sequences that can be recognized and distinguished is readily understood by the fact that these enzymes are multidomain proteins containing dedicated se- quence-specific DNA-binding domains (Davies et al, 2000; Watkins et al, 2004; Rice, 2005; Richardson et al, 2009).”
BackgroundAn Engineered Cas-Transposon System for Programmable and Site-Directed DNA Transpositions
Chen, S. P., & Wang, H. H. (2019) · The CRISPR Journal · doi:10.1089/crispr.2019.0030 · Cited by 47
Structures of a RAG-like transposase during cut-and-paste transposition
Liu, C., Yang, Y., & Schatz, D. G. (2019) · Nature · doi:10.1038/s41586-019-1753-7 · Cited by 44
“…capturing the strand transfer complexes of bacteriophage Mu 18 and retroviral integrases 19–22 , transposon integration has been visualized structurally for only one eukaryotic DNA transposase, Mos1 23,24 , and Mos1 employs a catalytic mechanism that does not involve a hairpin intermediate 25 .”
InfluentialThe emerging diversity of transpososome architectures
Dyda, F., Chandler, M., & Hickman, A. B. (2012) · Quarterly Reviews of Biophysics · doi:10.1017/s0033583512000145 · Cited by 47
“The second crystal structure describing a transpososome containing an RNaseH-like catalytic domain is that of the eukaryotic mariner element, Mos1, from Drosophila mauritiana (Richardson et al. 2009).”
BackgroundPflieger, A., Téguo, P. W., Papastamoulis, Y., Chaignepain, S., Subra, F., Munir, S., Delelis, O., Lesbats, P., Calmels, C., Andréola, M., et al. (2013) · PLoS ONE · doi:10.1371/journal.pone.0081184 · Cited by 42
“recently solved [4] and a model of the MOS1 dimer was proposed [4].”
BackgroundRegulated complex assembly safeguards the fidelity ofSleeping Beautytransposition
Wang, Y., Pryputniewicz-Dobrinska, D., Nagy, E.-E., Kaufman, C. D., Singh, M., Yant, S. R., Wang, J., Dalda, A., Kay, M. A., Ivics, Z., et al. (2016) · Nucleic Acids Research · doi:10.1093/nar/gkw1164 · Cited by 42
“(a) CAACTG-----AA-----TTGAA (3) (b) CAACT ---CAAA -----TGAA (2) (c) CAACTG---GA-------TTGAA (4) (d) CAACT-----CGA------TTGAA (1) (e) CAACT—--CAG------TTGAA (1) (f) CAACTG---AAA--------TGAA (1) (g) CAAC-----CGAA--------TGAA (2) C rpsL LacZ-SB CCCTAGAATTCATAATA TATTATGAATTCTAGGG CCCTAGAATTCATAATACAG TATTATGAATTCTAGGG”
BackgroundDifferential Sensitivities of Retroviruses to Integrase Strand Transfer Inhibitors
Koh, Y., Matreyek, K. A., & Engelman, A. (2011) · Journal of Virology · doi:10.1128/jvi.02541-10 · Cited by 37
“Underlining marks the positions of secondary structural elements for HIV-1 (19), SIV (4), RSV (52), and PFV (10) INs and the positions of SB elements from a structure-based alignment with the related Mos1 transposase (37).”
BackgroundLiu, D., & Chalmers, R. (2013) · Nucleic Acids Research · doi:10.1093/nar/gkt1218 · Cited by 37
“(C and D) The structural relationships between the conserved sequence motifs as they appear in the crystal structure of the Mos1 post-cleavage intermediate (15).”
BackgroundCutting antiparallel DNA strands in a single active site
Chen, X., Cui, Y., Best, R. B., Wang, H., Zhou, Z. H., Yang, W., & Gellert, M. F. (2020) · Nature Structural & Molecular Biology · doi:10.1038/s41594-019-0363-2 · Cited by 37
“These structures reveal how a Y-shaped dimer of RAG1-RAG2 heterodimers pairs asymmetrical 12 and 23RSS DNAs and can undergo large conformational changes.”
Kim, H.-S., Chen, Q., Kim, S.-K., Nickoloff, J. A., Hromas, R., Georgiadis, M. M., & Lee, S. (2014) · Journal of Biological Chemistry · doi:10.1074/jbc.m113.533216 · Cited by 38
Transposase concentration controls transposition activity: Myth or reality?
Bire, S., Casteret, S., Arnaoty, A., Piégu, B., Lecomte, T., & Bigot, Y. (2013) · Gene · doi:10.1016/j.gene.2013.08.039 · Cited by 35
Nicolas, É., Oger, C. A., Nguyen, N., Lambin, M., Draime, A., Leterme, S. C., Chandler, M., & Hallet, B. (2017) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1611701114 · Cited by 35
Precise targeted integration by a chimaeric transposase zinc-finger fusion protein
Feng, X., Bednarz, A. L., & Colloms, S. D. (2009) · Nucleic Acids Research · doi:10.1093/nar/gkp1068 · Cited by 34
“(B) ISY100 transposase is expected to act as a dimer (27); one”
BackgroundSelf-citationBuchmann, J. P., Matsumoto, T., Stein, N., Keller, B., & Wicker, T. (2012) · The Plant Journal · doi:10.1111/j.1365-313x.2012.05007.x · Cited by 33
Morellet, N., Li, X., Wieninger, S. A., Taylor, J. L., Bischerour, J., Moriau, S., Lescop, E., Bardiaux, B., Mathy, N., Assrir, N., et al. (2018) · Nucleic Acids Research · doi:10.1093/nar/gky044 · Cited by 32
“Four transpososomes assembled by DD(D/E) transposases have been structurally characterized: the prokaryotic Tn5 transposase in complex with Tn5 transposon end DNAs (68); the Mu transposase in complex with bacteriophage DNA ends and target DNA (69); the eukaryotic mariner Mos1 transposon (70) and Hermes, a member of th…”
MethodZhang, T., Tan, S., Tang, N., Li, Y., Zhang, C., Sun, J., Guo, Y., Gao, H., Cai, Y., Sun, W. H., et al. (2024) · Cell · doi:10.1016/j.cell.2024.05.007 · Cited by 32
Structural gymnastics of RAG-mediated DNA cleavage in V(D)J recombination
Ru, H., Zhang, P., & Wu, H. (2018) · Current Opinion in Structural Biology · doi:10.1016/j.sbi.2018.11.001 · Cited by 30
Engineered Sleeping Beauty transposase redirects transposon integration away from genes
Miskey, C., Kesselring, L., Querques, I., Abrusán, G., Barábas, O., & Ivics, Z. (2022) · Nucleic Acids Research · doi:10.1093/nar/gkac092 · Cited by 29
“Structural modeling identifies candidate residues involved in target DNA interactions of the Sleeping Beauty transposase To shortlist amino acids in the SB transposase potentially involved in shaping its integration site selection, we performed a comparative structural analysis of a structural model of the SB TCC comp…”
InfluentialSolution conformations of early intermediates in Mos1 transposition
Cuypers, M. G., Trubitsyna, M., Callow, P., Forsyth, V. T., & Richardson, J. M. (2012) · Nucleic Acids Research · doi:10.1093/nar/gks1295 · Cited by 29
“The order and requirements for DNA excision have been established (10,11), and crystal structures have been determined of the transposase C-terminal catalytic domain (11) and the paired-end complex of transposase and cleaved transposon DNA (14).”
BackgroundInfluentialSelf-citationIdentification and evolutionary history of the DD41D transposons in insects
Zhang, H., Shen, Y., Xiong, X., Han, M., & Xiao-gu, Z. (2015) · Genes & Genomics · doi:10.1007/s13258-015-0356-4 · Cited by 28
“2009), the transposase structures of the rosa subfamily and the Lsra subfamily can be predicted based on these templates (van Pouderoyen et al. 1997; Richardson et al. 2009).”
InfluentialTc1-like transposable elements in plant genomes
Liu, Y., & Yang, G. (2014) · Mobile DNA · doi:10.1186/1759-8753-5-17 · Cited by 27
“The pocket formed by these residues contains the metal ions needed in the DNA cleavage reaction during transposition [24].”
Reconstitution of a functional IS608 single-strand transpososome: role of non-canonical base pairing
He, S., Hickman, A. B., Dyda, F., Johnson, N. P., Chandler, M., & Ton‐Hoang, B. (2011) · Nucleic Acids Research · doi:10.1093/nar/gkr566 · Cited by 26
A bend, flip and trap mechanism for transposon integration
Morris, E. R., Grey, H., McKenzie, G., Jones, A. C., & Richardson, J. M. (2016) · eLife · doi:10.7554/elife.15537 · Cited by 26
“The transposase subunits adopt a crossed (or trans) arrangement with IR DNA in the Mos1 STC, similar to the pre- and post-TS cleavage Mos1 PECs (Dornan et al., 2015; Richardson et al., 2009):”
BackgroundResultInfluentialSelf-citationCrosstalk between transposase subunits during cleavage of the mariner transposon
Bouuaert, C. C., Walker, N., Liu, D., & Chalmers, R. (2014) · Nucleic Acids Research · doi:10.1093/nar/gku172 · Cited by 25
“In the Mos1 post-cleavage intermediate, the DNAbinding and catalytic domains of a given subunit are engaged with opposite ends of the transposon (Figure 7B, C and (4)).”
BackgroundInfluentialSeparate structural and functional domains of Tn4430 transposase contribute to target immunity
Lambin, M., Nicolas, É., Oger, C. A., Nguyen, N., Prozzi, D., & Hallet, B. (2012) · Molecular Microbiology · doi:10.1111/j.1365-2958.2012.07967.x · Cited by 25
“In Tc1/mariner transposases, the DNA binding domain is directly connected to the C-terminal catalytic domain through a short linker of ~ 13 aa (Watkins et al., 2004; Richardson et al., 2009).”
BackgroundKošek, D., Grabundžija, I., Lei, H., Bilić, I., Wang, H., Jin, Y., Peaslee, G. F., Hickman, A. B., & Dyda, F. (2021) · Molecular Cell · doi:10.1016/j.molcel.2021.07.028 · Cited by 21
Structural role of the flanking DNA in mariner transposon excision
Dornan, J., Grey, H., & Richardson, J. M. (2015) · Nucleic Acids Research · doi:10.1093/nar/gkv096 · Cited by 24
“We proposed that these duplexes could occupy the putative binding sites for flanking DNA (4) served.”
Self-citationCryo-EM structure of mouse RAG1/2 PRC complex (DNA1)
Chen, X., Cui, Y., Zhou, Z. H., Yang, W., & Gellert, M. F. (2019) · Worldwide Protein Data Bank · doi:10.2210/pdb6oen/pdb · Cited by 24
Hsmar1 Transposition Is Sensitive to the Topology of the Transposon Donor and the Target
Bouuaert, C. C., & Chalmers, R. (2013) · PLoS ONE · doi:10.1371/journal.pone.0053690 · Cited by 23
“Furthermore, the Mos1 post-cleavage pairedends-complex structure suggests that the mariner transpososome may also bind the target [41].”
BackgroundJumping Ahead with Sleeping Beauty: Mechanistic Insights into Cut-and-Paste Transposition
Ochmann, M. T., & Ivics, Z. (2021) · Viruses · doi:10.3390/v13010076 · Cited by 21
“Based on the structure of the Mos1 synaptic complex [37], it is likely that the catalytic DDE domains are acting in”
BackgroundInfluentialStructure, Activity, and Function of SETMAR Protein Lysine Methyltransferase
Tellier, M. (2021) · Life · doi:10.3390/life11121342 · Cited by 20
“Of note, phosphorylation of the equivalent residue in another transposase, Ser170 in Mos1, is performed by the cAMP-dependent protein kinase (PKA) and prevents the active transport of the transposase to the nucleus and also interferes with the formation of the paired-end complex (a transposase dimer bound to two ITRs)…”
BackgroundNMR structural analysis of Sleeping Beauty transposase binding to DNA
Carpentier, C. E., Schreifels, J. M., Aronovich, E. L., Carlson, D. F., Hackett, P. B., & Nesmelova, I. V. (2013) · Protein Science · doi:10.1002/pro.2386 · Cited by 18
Košek, D., Hickman, A. B., Ghirlando, R., He, S., & Dyda, F. (2020) · The EMBO Journal · doi:10.15252/embj.2020105666 · Cited by 18
“This is reflected in the rotational symmetry relating the two bound TIRs seen in available trans-pososome structures (Davies et al , 2000; Richardson et al , 2009; Montan˜o et al , 2012; Liu et al , 2019).”
DNA–PK facilitates piggyBac transposition by promoting paired-end complex formation
Jin, Y., Chen, Y., Zhao, S., Guan, K., Zhuang, Y., Zhou, W., Wu, X., & Xu, T. (2017) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1612980114 · Cited by 18
“A paired-end complex (PEC) is first formed by aligning both ends of the transposon, which is then excised and inserted into new loci (1, 2).”
BackgroundDemattei, M.-V., Hedhili, S., Sinzelle, L., Bressac, C., Casteret, S., Moiré, N., Cambefort, J., Thomas, X., Pollet, N., Gantet, P., et al. (2011) · PLoS ONE · doi:10.1371/journal.pone.0023693 · Cited by 17
“Moreover, it is located in a non structured segment and contains a proline at the first position [17,32].”
InfluentialJump ahead with a twist: DNA acrobatics drive transposition forward
Arinkin, V., Smyshlyaev, G., & Barábas, O. (2019) · Current Opinion in Structural Biology · doi:10.1016/j.sbi.2019.08.006 · Cited by 19
Retroviral integrase: Structure, mechanism, and inhibition
Passos, D. O., Li, M., Craigie, R., & Lyumkis, D. (2021) · The Enzymes · doi:10.1016/bs.enz.2021.06.007 · Cited by 20
“Richardson JM, Colloms SD, Finnegan DJ, Walkinshaw MD, Molecular Architecture of the Mos1 Paired-End Complex: The Structural Basis of DNA Transposition in a Eukaryote, Cell.”
BackgroundTransposable Elements for Insect Transformation
Handler, A. M., & O’Brochta, D. A. (2011) · Elsevier eBooks · doi:10.1016/b978-0-12-384747-8.10004-2 · Cited by 17
B-to-A transition in target DNA during retroviral integration
Jozwik, I. K., Li, W., Zhang, D., Wong, D., Grawenhoff, J., Ballandras-Colas, A., Aiyer, S., Cherepanov, P., Engelman, A., & Lyumkis, D. (2022) · Nucleic Acids Research · doi:10.1093/nar/gkac644 · Cited by 16
Transposase–Transposase Interactions in MOS1 Complexes: A Biochemical Approach
Carpentier, G., Jaillet, J., Pflieger, A., Adet, J., Renault, S., & Augé‐Gouillou, C. (2010) · Journal of Molecular Biology · doi:10.1016/j.jmb.2010.11.032 · Cited by 16
Regulation of Mariner Transposition: The Peculiar Case of Mos1
Jaillet, J., Genty, M., Cambefort, J., Rouault, J.-D., & Augé‐Gouillou, C. (2012) · PLoS ONE · doi:10.1371/journal.pone.0043365 · Cited by 15
Chen, W., Mandali, S., Hancock, S. P., Kumar, P., Collazo, M., Cascio, D., & Johnson, R. C. (2018) · eLife · doi:10.7554/elife.39611 · Cited by 15
“For example, each subunit of the Mos1 Mariner-family transposase dimer binds to one transposon terminus and additional separate DNA binding domains associate with two subterminal binding sites on the other transposon end within the active complex (Richardson et al., 2009).”
BackgroundZhang, Y., Corbett, E., Wu, S., & Schatz, D. G. (2020) · The EMBO Journal · doi:10.15252/embj.2020105857 · Cited by 14
“While multiple STC structures have been reported for DDE transposases/ integrases (Richardson et al , 2009; Montano & Rice, 2011; Morris et al , 2016; Ballandras-Colas et al , 2017; Passos et al , 2017; Arinkin et al , 2019; Ghanim et al , 2019) including recently for RAG (Chen et al , 2020b), no…”
Biochemical Characterization and Comparison of Two Closely Related Active mariner Transposases
Trubitsyna, M., Morris, E. R., Finnegan, D., & Richardson, J. M. (2014) · Biochemistry · doi:10.1021/bi401193w · Cited by 13
Self-citationA model for the molecular organisation of the IS911 transpososome
Rousseau, P., Tardin, C., Tolou, N., Salomé, L., & Chandler, M. (2010) · Mobile DNA · doi:10.1186/1759-8753-1-16 · Cited by 13
“In spite of its key importance, the composition and organisation of such assemblies have been examined for only a handful of transposable elements [2,11] and with varying degrees of detail.”
BackgroundMethodInfluentialSantana, M. F., Silva, J. C. F., Mizubuti, E. S. G., Ara�jo, E. F., & de Queiroz, M. V. (2014) · BMC Microbiology · doi:10.1186/s12866-014-0256-9 · Cited by 13
Mechanistic insights into transposon cleavage and integration by TnsB of ShCAST system
Zeng, T., Yin, J., Liu, Z., Li, Z., Zhang, Y., Lv, Y., Lü, M., Luo, M., Chen, M., & Xiao, Y. (2023) · Cell Reports · doi:10.1016/j.celrep.2023.112698 · Cited by 12
Modeling the HIV-1 Intasome: A Prototype View of the Target of Integrase Inhibitors
Yin, Z., & Craigie, R. (2010) · Viruses · doi:10.3390/v2122777 · Cited by 12
“Prior to the determination of the PFV intasome structure, the structures of the Tn5 transposase [12] and Mos 1 [13] transposase were the only structures of an integrase or transposase in complex with DNA and they provided the best available scaffold for modeling the active site of the HIV-1 intasome.”
BackgroundA single active site in the mariner transposase cleaves DNA strands of opposite polarity
Bouuaert, C. C., & Chalmers, R. (2017) · Nucleic Acids Research · doi:10.1093/nar/gkx826 · Cited by 12
“The residue lies within the second helix-turn-helix motif of the transposase, which is important for the recognition of the transposon end (30,38,39).”
BackgroundStructural Basis of Mos1 Transposase Inhibition by the Anti-retroviral Drug Raltegravir
Wolkowicz, U. M., Morris, E. R., Robson, M. I., Trubitsyna, M., & Richardson, J. M. (2014) · ACS Chemical Biology · doi:10.1021/cb400791u · Cited by 12
Self-citationBouchet, N., Jaillet, J., Gabant, G., Brillet, B., Briseño-Roa, L., Cadène, M., & Augé‐Gouillou, C. (2013) · Nucleic Acids Research · doi:10.1093/nar/gkt874 · Cited by 12
“The crystal structure of the Mos1 synaptic complex locates the S170 residue of one monomer in a structure called the ‘clamp loop’ (residues 162–189), which locks the PEC by interacting with the linker region (residues 113–125) of the second monomer (22).”
BackgroundThe Tn3-family of Replicative Transposons
Nicolas, É., Lambin, M., Dandoy, D., Galloy, C., Nguyen, N., Oger, C. A., & Hallet, B. (2015) · ASM Press eBooks · doi:10.1128/9781555819217.ch32 · Cited by 12
Mechanisms of DNA Transposition
Hickman, A. B., & Dyda, F. (2015) · ASM Press eBooks · doi:10.1128/9781555819217.ch25 · Cited by 14
Synergistic Coding of Carbon Dioxide and a Human Sweat Odorant in the Mosquito BrainPreprint
Shankar, S., Tauxe, G. M., Spikol, E. D., Li, M., Akbari, O. S., Giraldo, D., & McMeniman, C. J. (2020) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2020.11.02.365916 · Cited by 13
Bouuaert, C. C., Tellier, M., & Chalmers, R. (2014) · Mobile Genetic Elements · doi:10.4161/mge.28807 · Cited by 11
“In the crystal structure of the Mos1 post-cleavage transpososome the WVPHEL motif is seen to occupy a central position in the dimer interface.(17) An unstructured “clamp-loop” feature emerges from the catalytic core of one transposase subunit, crosses the dimer interface, and interacts with the transposon end and the…”
BackgroundInfluentialIS21 family transposase cleaved donor complex traps two right-handed superhelical crossings
Spínola‐Amilibia, M., Araújo‐Bazán, L., de la Gándara, Á., Berger, J. M., & Arias‐Palomo, E. (2023) · Nature Communications · doi:10.1038/s41467-023-38071-x · Cited by 10
“To minimize the heterogeneity we elected to use only the pre-cleavedrightendforthestructuralstudies(SupplementaryTable1),an approach widely used for other transposases 50,51,53,54 .”
InfluentialEsnault, C., Chénais, B., Casse, N., Delorme, N., Louarn, G., & Pilard, J. (2013) · ChemPhysChem · doi:10.1002/cphc.201200885 · Cited by 11
Target Capture during Mos1 Transposition
Pflieger, A., Jaillet, J., Petit, A., Augé‐Gouillou, C., & Renault, S. (2013) · Journal of Biological Chemistry · doi:10.1074/jbc.m113.523894 · Cited by 11
“This model predicts that the Arg(186) MOS1 residue will bind to the target through the target TA dinucleotide, supporting subsequent integration (9).”
BackgroundInfluentialStructural Basis for the Inverted Repeat Preferences of mariner Transposases
Trubitsyna, M., Grey, H., Houston, D. R., Finnegan, D., & Richardson, J. M. (2015) · Journal of Biological Chemistry · doi:10.1074/jbc.m115.636704 · Cited by 10
“Comparison of the crystal structure of the Mos1 IRL PEC reported here with our previous IRR PEC structure (18) provides a molecular explanation for this difference in binding affinity, as subtle differences in the interactions of the central region of IR and the linker between the two HTH regions of transposase are re…”
BackgroundMethodInfluentialSelf-citationGenome-wide comparison of Asian and African rice reveals high recent activity of DNA transposons
Roffler, S., & Wicker, T. (2015) · Mobile DNA · doi:10.1186/s13100-015-0040-x · Cited by 10
“When DNA transposons excise, they leave a double-strand break (DSB) with small 3′ overhangs which are derived from the TIRs of the element [22] (Additional file 1: Figure S1).”
BackgroundBlundell‐Hunter, G., Tellier, M., & Chalmers, R. (2018) · Nucleic Acids Research · doi:10.1093/nar/gky794 · Cited by 9
“Next, the Hsmar1 transposase has a low affinity for non-specific DNA and two helix-turn-helix domains for sequence-specific binding (22,32,51).”
Tu, Z. J. (2011) · Elsevier eBooks · doi:10.1016/b978-0-12-384747-8.10003-0 · Cited by 9
Structural Determinants of Sleeping Beauty Transposase Activity
Abrusán, G., Yant, S. R., Szilágyi, A., Marsh, J. A., Mátés, L., Izsvák, Z., Barábas, O., & Ivics, Z. (2016) · Molecular Therapy · doi:10.1038/mt.2016.110 · Cited by 8
“…similar structure in the Protein Data Bank (PDB, http:/www.rcsb.org) to the predicted structure (supplementary SB.pdb file) is the Mos1 transposase, 29 which was also the highest ranking template used by I-TASSER (see Supplementary Figure S1b,c for structural alignments between the Mos1…”
Mariner and the ITm Superfamily of Transposons
Tellier, M., Bouuaert, C. C., & Chalmers, R. (2015) · ASM Press eBooks · doi:10.1128/9781555819217.ch34 · Cited by 8
Shankar, S., Giraldo, D., Tauxe, G. M., Spikol, E. D., Li, M., Akbari, O. S., Wohl, M. P., & McMeniman, C. J. (2025) · G3 Genes Genomes Genetics · doi:10.1093/g3journal/jkae307 · Cited by 7
“BLAST searches were used to map splinkerette fragments derived from each Mos1 mariner cassette to coordinate locations in the genome at canonical TA dinucleotides (Richardson et al .”
Harshey, R. M. (2015) · ASM Press eBooks · doi:10.1128/9781555819217.ch31 · Cited by 7
Tellier, M., & Chalmers, R. (2020) · Mobile DNA · doi:10.1186/s13100-020-0200-5 · Cited by 7
Metadata
- Authors
- Richardson, J. M., Colloms, S. D., Finnegan, D. J., & Walkinshaw, M. D.
- Affiliations
- University of Edinburgh (GB)
- Corresponding author
- Richardson, Julia M.
- Venue
- Cell
- Publisher
- Elsevier BV
- Published
- 2009-09
- Volume
- 138
- Issue
- 6
- Pages
- 1096-1108
- ISSN
- 0092-8674 (ISSN-L)
- PMC
- PMC3977044
- OpenAlex
- W2026862785
- Cited by
- 145
- References
- 39
- Citations by year
- 2026: 2 · 2025: 5 · 2024: 5 · 2023: 7 · 2022: 4 · 2021: 7 · 2020: 6 · 2019: 6 · 2018: 7 · 2017: 8 · 2016: 10 · 2015: 17 · 2014: 14 · 2013: 12 · 2012: 11
- FWCI
- 4.70
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- Locations
- Cell (publishedVersion)
- PubMed (publishedVersion)
- Europe PMC (PubMed Central) (acceptedVersion)
- PubMed Central (acceptedVersion)
- ENLIGHTEN (Jurnal Bimbingan dan Konseling Islam) (submittedVersion)
- Funders
- Wellcome Trust (085176)
- Chinese Academy of Agricultural Sciences
- Medical Research Council
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › CRISPR and Genetic Engineering
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Chromosomal and Genetic Variations
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Bacterial Genetics and Biotechnology
- Keywords
- DNA transposition, cut-and-paste transposition, crystal structure
- MeSH terms
- Animals, DNA Transposable Elements, DNA-Binding Proteins, Drosophila, Models, Molecular, X-Ray Diffraction, Protein Structure, Tertiary, Crystallography, X-Ray, Transposases, Catalytic Domain
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
