Nlrp6- and ASC-Dependent Inflammasomes Do Not Shape the Commensal Gut Microbiota Composition
Open accessAbstract
The gut microbiota regulate susceptibility to multiple human diseases. The Nlrp6-ASC inflammasome is widely regarded as a hallmark host innate immune axis that shapes the gut microbiota composition. This notion stems from studies reporting dysbiosis in mice lacking these inflammasome components when compared with non-littermate wild-type animals. Here, we describe microbial analyses in inflammasome-deficient mice while minimizing non-genetic confounders using littermate-controlled Nlrp6-deficient mice and ex-germ-free littermate-controlled ASC-deficient mice that were all allowed to shape their gut microbiota naturally after birth. Careful microbial phylogenetic analyses of these cohorts failed to reveal regulation of the gut microbiota composition by the Nlrp6- and ASC-dependent inflammasomes. Our results obtained in two geographically separated animal facilities dismiss a generalizable impact of Nlrp6- and ASC-dependent inflammasomes on the composition of the commensal gut microbiota and highlight the necessity for littermate-controlled experimental design in assessing the influence of host immunity on gut microbial ecology.
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In different facilities, mice lacking ASC, NLRP6, or NLRP3 fail to show any detectable differences in the composition of their fecal flora compared to wild-type controlled littermates, either co-housed or individually housed, contrary to what has been described in other facilities.
“In fact, in different facilities, mice lacking ASC, NLRP6 (199), or NLRP3 (200) fail to show any detectable differences in the composition of their fecal flora compared to wild-type controlled littermates (199), either co-housed or individually housed, contrary to what has been described in other facilities (194).”
From The gut-brain axis: how microbiota and host inflammasome influence brain physiology and pathology (2020) · cites this paper as [199]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Cites
Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing
Benjamini, Y., & Hochberg, Y. (1995) · Journal of the Royal Statistical Society Series B: Statistical Methodology · doi:10.1111/j.2517-6161.1995.tb02031.x · Cited by 109,482 · see citing works
Fast gapped-read alignment with Bowtie 2
Langmead, B., & Salzberg, S. L. (2012) · Nature Methods · doi:10.1038/nmeth.1923 · Cited by 56,400 · see citing works
QIIME allows analysis of high-throughput community sequencing data
Caporaso, J. G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F. D., Costello, E. K., Fierer, N., Peña, A. G., Goodrich, J. K., Gordon, J. I., et al. (2010) · Nature Methods · doi:10.1038/nmeth.f.303 · Cited by 34,887 · see citing works
Cutadapt removes adapter sequences from high-throughput sequencing reads
Martin, M. (2011) · EMBnet.journal · doi:10.14806/ej.17.1.200 · Cited by 33,889 · see citing works
The SILVA ribosomal RNA gene database project: improved data processing and web-based tools
Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., Peplies, J., & Glöckner, F. O. (2012) · Nucleic Acids Research · doi:10.1093/nar/gks1219 · Cited by 33,055 · see citing works
Search and clustering orders of magnitude faster than BLAST
Edgar, R. C. (2010) · Bioinformatics · doi:10.1093/bioinformatics/btq461 · Cited by 20,617 · see citing works
Naive Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy
Wang, Q., Garrity, G. M., Tiedje, J. M., & Cole, J. R. (2007) · Applied and Environmental Microbiology · doi:10.1128/aem.00062-07 · Cited by 19,770 · see citing works
UCHIME improves sensitivity and speed of chimera detection
Edgar, R. C., Haas, B. J., Clemente, J. C., Quince, C., & Knight, R. (2011) · Bioinformatics · doi:10.1093/bioinformatics/btr381 · Cited by 15,114 · see citing works
Klindworth, A., Pruesse, E., Schweer, T., Peplies, J., Quast, C., Horn, M., & Glöckner, F. O. (2013) · Nucleic Acids Research · doi:10.1093/nar/gks808 · Cited by 8,850 · see citing works
Dysfunction of the intestinal microbiome in inflammatory bowel disease and treatment
Morgan, X. C., Tickle, T. L., Sokol, H., Gevers, D., Devaney, K. L., Ward, D. V., Reyes, J. A., Shah, S. A., LeLeiko, N., Snapper, S. B., et al. (2012) · Genome Biology · doi:10.1186/gb-2012-13-9-r79 · Cited by 2,713 · see citing works
CANONICAL ANALYSIS OF PRINCIPAL COORDINATES: A USEFUL METHOD OF CONSTRAINED ORDINATION FOR ECOLOGY
Anderson, M. J., & Willis, T. J. (2003) · Ecology · doi:10.1890/0012-9658(2003)084[0511:caopca]2.0.co;2 · Cited by 2,533 · see citing works
Inflammasome-mediated dysbiosis regulates progression of NAFLD and obesity
Henao-Mejia, J., Elinav, E., Jin, C., Hao, L., Mehal, W. Z., Strowig, T., Thaiss, C. A., Kau, A. L., Eisenbarth, S. C., Jurczak, M. J., et al. (2012) · Nature · doi:10.1038/nature10809 · Cited by 2,435 · see citing works
Population-level analysis of gut microbiome variation
Falony, G., Joossens, M., Vieira-Silva, S., Wang, J., Darzi, Y., Faust, K., Kurilshikov, A., Bonder, M. J., Valles-Colomer, M., Vandeputte, D., et al. (2016) · Science · doi:10.1126/science.aad3503 · Cited by 2,400 · see citing works
Self-citationNLRP6 Inflammasome Regulates Colonic Microbial Ecology and Risk for Colitis
Elinav, E., Strowig, T., Kau, A. L., Henao-Mejia, J., Thaiss, C. A., Booth, C. J., Peaper, D. R., Bertin, J., Eisenbarth, S. C., Gordon, J. I., et al. (2011) · Cell · doi:10.1016/j.cell.2011.04.022 · Cited by 2,024 · see citing works
Population-based metagenomics analysis reveals markers for gut microbiome composition and diversity
Zhernakova, A., Kurilshikov, A., Bonder, M. J., Tigchelaar, E. F., Schirmer, M., Vatanen, T., Mujagic, Z., Vila, A. V., Falony, G., Vieira-Silva, S., et al. (2016) · Science · doi:10.1126/science.aad3369 · Cited by 1,914 · see citing works
Lamas, B., Richard, M. L., Leducq, V., Pham, H.-P., Michel, M.-L., Da Costa, G., Bridonneau, C., Jegou, S., Hoffmann, T. W., Natividad, J. M., et al. (2016) · Nature Medicine · doi:10.1038/nm.4102 · Cited by 1,482 · see citing works
How informative is the mouse for human gut microbiota research?
Nguyen, T. L. A., Vieira-Silva, S., Liston, A., & Raes, J. (2015) · Disease Models & Mechanisms · doi:10.1242/dmm.017400 · Cited by 1,334 · see citing works
Genetic determinants of the gut microbiome in UK twins
Goodrich, J. K., Davenport, E. R., Beaumont, M., Jackson, M. A., Knight, R., Ober, C., Spector, T. D., Bell, J. T., Clark, A. G., & Ley, R. E. (2016) · Cell Host & Microbe · doi:10.1016/j.chom.2016.04.017 · Cited by 1,048 · see citing works
Levy, M., Thaiss, C. A., Zeevi, D., Dohnalová, L., Zilberman-Schapira, G., Mahdi, J. A., David, E., Savidor, A., Korem, T., Herzig, Y., et al. (2015) · Cell · doi:10.1016/j.cell.2015.10.048 · Cited by 960 · see citing works
The effect of host genetics on the gut microbiome
Bonder, M. J., Kurilshikov, A., Tigchelaar, E. F., Mujagic, Z., Imhann, F., Vila, A. V., Deelen, P., Vatanen, T., Schirmer, M., Smeekens, S. P., et al. (2016) · Nature Genetics · doi:10.1038/ng.3663 · Cited by 819 · see citing works
Microbiome-wide association studies link dynamic microbial consortia to disease
Gilbert, J. A., Quinn, R. A., Debelius, J. W., Xu, Z. Z., Morton, J. T., Garg, N., Jansson, J. K., Dorrestein, P. C., & Knight, R. D. (2016) · Nature · doi:10.1038/nature18850 · Cited by 714 · see citing works
Wang, J., Thingholm, L. B., Skiecevičienė, J., Rausch, P., Kummen, M., Hov, J. R., Degenhardt, F., Heinsen, F.-A., Rühlemann, M. C., Szymczak, S., et al. (2016) · Nature Genetics · doi:10.1038/ng.3695 · Cited by 625 · see citing works
Morgan, M. T., Anders, S., Lawrence, M. F., Aboyoun, P., Pagès, H., & Gentleman, R. C. (2009) · Bioinformatics · doi:10.1093/bioinformatics/btp450 · Cited by 545 · see citing works
Barcoded Primers Used in Multiplex Amplicon Pyrosequencing Bias Amplification
Berry, D., Mahfoudh, K. B., Wagner, M., & Loy, A. (2011) · Applied and Environmental Microbiology · doi:10.1128/aem.05220-11 · Cited by 519 · see citing works
The outer mucus layer hosts a distinct intestinal microbial niche
Li, H., Limenitakis, J. P., Fuhrer, T., Geuking, M. B., Lawson, M. A., Wyss, M., Brugiroux, S., Keller, I., Macpherson, J. A., Rupp, S., et al. (2015) · Nature Communications · doi:10.1038/ncomms9292 · Cited by 511 · see citing works
Self-citationAssociation of host genome with intestinal microbial composition in a large healthy cohort
GEM Project Research Consortium, Turpin, W., Espin-Garcia, O., Xu, W., Silverberg, M. S., Kevans, D., Smith, M. I., Guttman, D. S., Griffiths, A., Panaccione, R., et al. (2016) · Nature Genetics · doi:10.1038/ng.3693 · Cited by 460 · see citing works
NLRP6 negatively regulates innate immunity and host defence against bacterial pathogens
Anand, P., Malireddi, R. K. S., Lukens, J. R., Vogel, P., Bertin, J., Lamkanfi, M., & Kanneganti, T. (2012) · Nature · doi:10.1038/nature11250 · Cited by 414 · see citing works
Barcoded Primers Used in Multiplex Amplicon Pyrosequencing Bias Amplification
Berry, D., Mahfoudh, K. B., Wagner, M., & Loy, A. (2011) · Applied and Environmental Microbiology · doi:10.1128/aem.07448-11 · Cited by 394 · see citing works
Chassaing, B., Ley, R. E., & Gewirtz, A. T. (2014) · Gastroenterology · doi:10.1053/j.gastro.2014.08.033 · Cited by 326 · see citing works
Hu, B., Elinav, E., Huber, S., Strowig, T., Hao, L., Hafemann, A., Jin, C., Wunderlich, C. M., Wunderlich, T., Eisenbarth, S. C., et al. (2013) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1307575110 · Cited by 325 · see citing works
Ubeda, C., Lipuma, L., Gobourne, A., Viale, A., Leiner, I., Equinda, M., Khanin, R., & Pamer, E. G. (2012) · Journal of Experimental Medicine · doi:10.1084/jem.20120504 · Cited by 310 · see citing works
Accounting for reciprocal host–microbiome interactions in experimental science
Stappenbeck, T. S., & Virgin, H. W. (2016) · Nature · doi:10.1038/nature18285 · Cited by 265 · see citing works
Bacterial flora-typing with targeted, chip-based Pyrosequencing
Sundquist, A., Bigdeli, S., Jalili, R., Druzin, M. L., Waller, S. A., Pullen, K. M., El-Sayed, Y. Y., Taslimi, M. M., Batzoglou, S., & Ronaghi, M. (2007) · BMC Microbiology · doi:10.1186/1471-2180-7-108 · Cited by 231 · see citing works
Microbial 16S rRNA Ion Tag and community metagenome sequencing using the Ion Torrent (PGM) Platform
Whiteley, A. S., Jenkins, S., Waite, I. S., Kresoje, N., Payne, H. G., Mullan, B. P., Allcock, R. J. N., & O’Donnell, A. G. (2012) · Journal of Microbiological Methods · doi:10.1016/j.mimet.2012.07.008 · Cited by 203 · see citing works
Rausch, P., Basic, M., Batra, A., Bischoff, S. C., Blaut, M., Clavel, T., Gläsner, J., Gopalakrishnan, S., Graßl, G. A., Günther, C., et al. (2016) · International Journal of Medical Microbiology · doi:10.1016/j.ijmm.2016.03.004 · Cited by 177 · see citing works
IL-33 regulates the IgA-microbiota axis to restrain IL-1α–dependent colitis and tumorigenesis
Malik, A., Sharma, D., Zhu, Q., Karki, R., Guy, C. S., Vogel, P., & Kanneganti, T. (2016) · Journal of Clinical Investigation · doi:10.1172/jci88625 · Cited by 176 · see citing works
Drexler, S. K., Bonsignore, L., Masin, M., Tardivel, A., Jackstadt, R., Hermeking, H., Schneider, P., Groß, O., Tschopp, J., & Yazdi, A. S. (2012) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1209171109 · Cited by 150 · see citing works
Robertson, S. J., Zhou, J. Y., Geddes, K., Rubino, S. J., Cho, J., Girardin, S. E., & Philpott, D. J. (2013) · Gut Microbes · doi:10.4161/gmic.24373 · Cited by 147 · see citing works
Rogers, G. B., Kozlowska, J., Keeble, J. E., Metcalfe, K., Fao, M., Dowd, S. E., Mason, A. J., McGuckin, M. A., & Bruce, K. D. (2014) · Scientific Reports · doi:10.1038/srep05437 · Cited by 70 · see citing works
Flagged first, then by citations
Research works printed but not linked: 2
- Bacteria-specific primer IT_16S_REV_1 CCTCT CTATGGGCAGTCGGTGATACGAGCTGACGA CARCCATG Li et al., 2015; Sundquist et al., 2007 https://www.nature.com/articles/ncomms9292; https://bmcmicrobiol.biomedcentral.com/ articles/10.1186/1471-2180-7-108 Software and Algorithms Illumina's MiSeq Reporter v2. · DOI
- distance-based redundancy analysis (db-RDA) Anderson and Willis, 2003 http://onlinelibrary.wiley.com/doi/10.1890/0012- 9658%282003%29084[0511:CAOPCA]2.0.CO;2/ abstract Benjamini-Hochberg false discovery rate correction Benjamini and Hochberg, 1995 https://www.jstor.org/stable/2346101? seq=1#page_scan_tab_contents · DOI
Cited by
Sorted by citations
Inflammasome activation and regulation: toward a better understanding of complex mechanisms
Zheng, D., Liwinski, T., & Elinav, E. (2020) · Cell Discovery · doi:10.1038/s41421-020-0167-x · Cited by 1,042 · see citing works
The gut-brain axis: how microbiota and host inflammasome influence brain physiology and pathology
Rutsch, A., Kantsjö, J. B., & Ronchi, F. (2020) · Frontiers in Immunology · doi:10.3389/fimmu.2020.604179 · Cited by 821 · see citing works
Gut Microbiota as a Trigger for Metabolic Inflammation in Obesity and Type 2 Diabetes
Scheithauer, T. P. M., Rampanelli, E., Nieuwdorp, M., Vallance, B. A., Verchere, C. B., van Raalte, D. H., & Herrema, H. (2020) · Frontiers in Immunology · doi:10.3389/fimmu.2020.571731 · Cited by 694 · see citing works
Diverging inflammasome signals in tumorigenesis and potential targeting
Karki, R., & Kanneganti, T. (2019) · Nature reviews. Cancer · doi:10.1038/s41568-019-0123-y · Cited by 641 · see citing works
The influence of the microbiome on respiratory health
Wypych, T. P., Wickramasinghe, L. C., & Marsland, B. J. (2019) · Nature Immunology · doi:10.1038/s41590-019-0451-9 · Cited by 611 · see citing works
Blevins, H. M., Xu, Y., Biby, S., & Zhang, S. (2022) · Frontiers in Aging Neuroscience · doi:10.3389/fnagi.2022.879021 · Cited by 587 · see citing works
Immunomodulatory potential of gut microbiome-derived short-chain fatty acids (SCFAs)
Ratajczak, W., Rył, A., Mizerski, A., Walczakiewicz, K., Sipak‐Szmigiel, O., & Laszczyńska, M. (2019) · Acta Biochimica Polonica · doi:10.18388/abp.2018_2648 · Cited by 532 · see citing works
Emerging Activators and Regulators of Inflammasomes and Pyroptosis
Xue, Y., Tuipulotu, D. E., Tan, W. H., Kay, C., & Man, S. M. (2019) · Trends in Immunology · doi:10.1016/j.it.2019.09.005 · Cited by 513 · see citing works
Understanding oxidants and antioxidants: Classical team with new players
Ali, S. S., Ahsan, H., Zia, M. K., Siddiqui, T., & Khan, F. H. (2020) · Journal of Food Biochemistry · doi:10.1111/jfbc.13145 · Cited by 497 · see citing works
Iljazovic, A., Roy, U., Gálvez, E. J. C., Lesker, T. R., Zhao, B., Gronow, A., Amend, L., Will, S. E., Hofmann, J. D., Pils, M. C., et al. (2021) · Mucosal Immunology · doi:10.1038/s41385-020-0296-4 · Cited by 454 · see citing works
A 360° view of the inflammasome: Mechanisms of activation, cell death, and diseases
Barnett, K. C., Li, S., Liang, K., & Ting, J. P.-Y. (2023) · Cell · doi:10.1016/j.cell.2023.04.025 · Cited by 458 · see citing works
Inflammasome activation and assembly at a glance
Malik, A., & Kanneganti, T. (2017) · Journal of Cell Science · doi:10.1242/jcs.207365 · Cited by 451 · see citing works
Gut Microbiome Dysbiosis and Immunometabolism: New Frontiers for Treatment of Metabolic Diseases
Belizário, J. E., Faintuch, J., & Garay-Malpartida, M. (2018) · Mediators of Inflammation · doi:10.1155/2018/2037838 · Cited by 341 · see citing works
The NLRP6 Inflammasome Recognizes Lipoteichoic Acid and Regulates Gram-Positive Pathogen Infection
Hara, H., Seregin, S. S., Yang, D., Fukase, K., Chamaillard, M., Alnemri, E. S., Inohara, N., Chen, G., & Núñez, G. (2018) · Cell · doi:10.1016/j.cell.2018.09.047 · Cited by 306 · see citing works
Inflammasomes in the gastrointestinal tract: infection, cancer and gut microbiota homeostasis
Man, S. M. (2018) · Nature Reviews Gastroenterology & Hepatology · doi:10.1038/s41575-018-0054-1 · Cited by 305 · see citing works
Intestinal epithelial cells: At the interface of the microbiota and mucosal immunity
Soderholm, A. T., & Pedicord, V. A. (2019) · Immunology · doi:10.1111/imm.13117 · Cited by 281 · see citing works
Microbiota-derived peptide mimics drive lethal inflammatory cardiomyopathy
Gil-Cruz, C., Perez-Shibayama, C., De Martin, A., Ronchi, F., van der Borght, K., Niederer, R., Onder, L., Lütge, M., Novkovic, M., Nindl, V., et al. (2019) · Science · doi:10.1126/science.aav3487 · Cited by 260 · see citing works
Microbiome, inflammation and colorectal cancer
Chen, J., Pitmon, E., & Wang, K. (2017) · Seminars in Immunology · doi:10.1016/j.smim.2017.09.006 · Cited by 267 · see citing works
The Role of NLRP3 and IL-1β in the Pathogenesis of Inflammatory Bowel Disease
Mao, L., Kitani, A., Strober, W., & Fuss, I. J. (2018) · Frontiers in Immunology · doi:10.3389/fimmu.2018.02566 · Cited by 242 · see citing works
NADPH oxidases and ROS signaling in the gastrointestinal tract
Aviello, G., & Knaus, U. G. (2018) · Mucosal Immunology · doi:10.1038/s41385-018-0021-8 · Cited by 225 · see citing works
Kwon, Y. H., Wang, H., Denou, E., Ghia, J., Rossi, L., Fontes, M. E., Bernier, S. P., Shajib, M. S., Banskota, S., Collins, S. M., et al. (2019) · Cellular and Molecular Gastroenterology and Hepatology · doi:10.1016/j.jcmgh.2019.01.004 · Cited by 223 · see citing works
The NLR gene family: from discovery to present day
Chou, W.-C., Jha, S., Linhoff, M. W., & Ting, J. P. ‐. (2023) · Nature reviews. Immunology · doi:10.1038/s41577-023-00849-x · Cited by 221 · see citing works
Parasite-Microbiota Interactions With the Vertebrate Gut: Synthesis Through an Ecological Lens
Leung, J. M., Graham, A. L., & Knowles, S. C. L. (2018) · Frontiers in Microbiology · doi:10.3389/fmicb.2018.00843 · Cited by 214 · see citing works
The NLR family of innate immune and cell death sensors
Sundaram, B., Tweedell, R. E., Kumar, S. P., & Kanneganti, T. (2024) · Immunity · doi:10.1016/j.immuni.2024.03.012 · Cited by 213 · see citing works
Comparison of Co-housing and Littermate Methods for Microbiota Standardization in Mouse Models
Robertson, S. J., Lemire, P., Maughan, H., Goethel, A., Turpin, W., Bedrani, L., Guttman, D. S., Croitoru, K., Girardin, S. E., & Philpott, D. J. (2019) · Cell Reports · doi:10.1016/j.celrep.2019.04.023 · Cited by 194 · see citing works
Inflammasome, Inflammation, and Tissue Homeostasis
Rathinam, V. A. K., & Chan, F. K.-M. (2018) · Trends in Molecular Medicine · doi:10.1016/j.molmed.2018.01.004 · Cited by 192 · see citing works
The Gut Microbiome in Hypertension
Avery, E. G., Bartolomaeus, H., Maifeld, A., Markó, L., Wiig, H., Wilck, N., Rosshart, S. P., Forslund, S. K., & Müller, D. N. (2021) · Circulation Research · doi:10.1161/circresaha.121.318065 · Cited by 174 · see citing works
Sun, R., Peng, M., Xu, P., Huang, F., Xie, Y., Li, J., Hong, Y., Guo, H., Liu, Q., & Zhu, W. (2020) · Journal of Neuroinflammation · doi:10.1186/s12974-020-01988-x · Cited by 166 · see citing works
Host control of the microbiome: Mechanisms, evolution, and disease
Wilde, J., Slack, E. M. C., & Foster, K. R. (2024) · Science · doi:10.1126/science.adi3338 · Cited by 159 · see citing works
Roy, U., Gálvez, E. J. C., Iljazović, A., Lesker, T. R., Błażejewski, A. J., Pils, M. C., Heise, U., Huber, S., Flavell, R. A., & Strowig, T. (2017) · Cell Reports · doi:10.1016/j.celrep.2017.09.097 · Cited by 136 · see citing works
Wasimuddin, Schlaeppi, K., Ronchi, F., Leib, S. L., Erb, M., & Ramette, A. (2020) · Molecular Ecology Resources · doi:10.1111/1755-0998.13215 · Cited by 140 · see citing works
Inflammasomes and Cancer: The Dynamic Role of the Inflammasome in Tumor Development
Kantono, M., & Guo, B. (2017) · Frontiers in Immunology · doi:10.3389/fimmu.2017.01132 · Cited by 133 · see citing works
The NLRP6 inflammasome in health and disease
Ghimire, L., Paudel, S., Jin, L., & Jeyaseelan, S. (2020) · Mucosal Immunology · doi:10.1038/s41385-020-0256-z · Cited by 134 · see citing works
Advances in Understanding Activation and Function of the NLRC4 Inflammasome
Sundaram, B., & Kanneganti, T. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22031048 · Cited by 130 · see citing works
The Nlrp6 inflammasome is not required for baseline colonic inner mucus layer formation or function
Volk, J. K., Nyström, E. E. L., van der Post, S., Martínez‐Abad, B., Schroeder, B. O., Johansson, Å., Svensson, F. R., Jäverfelt, S., Johansson, M., Hansson, G. C., et al. (2019) · The Journal of Experimental Medicine · doi:10.1084/jem.20190679 · Cited by 128 · see citing works
Innate Sensors Trigger Regulated Cell Death to Combat Intracellular Infection
Nozaki, K., Li, L., & Miao, E. A. (2022) · Annual Review of Immunology · doi:10.1146/annurev-immunol-101320-011235 · Cited by 119 · see citing works
Hausmann, A., Böck, D., Geiser, P., Berthold, D. L., Fattinger, S. A., Furter, M., Bouman, J. A., Barthel, M., Lang, C. M., Bakkeren, E., et al. (2020) · Mucosal Immunology · doi:10.1038/s41385-019-0247-0 · Cited by 118 · see citing works
Zheng, D., Kern, L., & Elinav, E. (2020) · Immunology · doi:10.1111/imm.13293 · Cited by 120 · see citing works
Campbell, C., Dikiy, S., Bhattarai, S. K., Chinen, T., Matheis, F., Calafiore, M., Hoyos, B. E., Hanash, A. M., Mucida, D., Bucci, V., et al. (2018) · Immunity · doi:10.1016/j.immuni.2018.04.013 · Cited by 118 · see citing works
Verma, A., Bhagchandani, T., Rai, A., Nikita, N., Sardarni, U. K., Bhavesh, N. S., Gulati, S., Malik, R., & Tandon, R. (2024) · ACS Omega · doi:10.1021/acsomega.3c05846 · Cited by 123 · see citing works
NLRP1 restricts butyrate producing commensals to exacerbate inflammatory bowel disease
Tye, H., Yu, C., Simms, L. A., de Zoete, M. R., Kim, M. L., Zakrzewski, M., Penington, J. S., Harapas, C. R., Souza-Fonseca-Guimarães, F., Wockner, L. F., et al. (2018) · Nature Communications · doi:10.1038/s41467-018-06125-0 · Cited by 111 · see citing works
Immunity, microbiota and kidney disease
Knauf, F., Brewer, J. R., & Flavell, R. A. (2019) · Nature Reviews Nephrology · doi:10.1038/s41581-019-0118-7 · Cited by 111 · see citing works
Ghimire, L., Paudel, S., Jin, L., Baral, P., Cai, S., & Jeyaseelan, S. (2018) · PLoS Pathogens · doi:10.1371/journal.ppat.1007308 · Cited by 105 · see citing works
Pandey, A., Li, Z., Gautam, M., Ghosh, A., & Man, S. M. (2024) · Immunological Reviews · doi:10.1111/imr.13406 · Cited by 113 · see citing works
The NLR Protein NLRP6 Does Not Impact Gut Microbiota Composition
Lemire, P., Robertson, S. J., Maughan, H., Tattoli, I., Streutker, C. J., Platnich, J. M., Muruve, D. A., Philpott, D. J., & Girardin, S. E. (2017) · Cell Reports · doi:10.1016/j.celrep.2017.12.026 · Cited by 98 · see citing works
Understanding immune–microbiota interactions in the intestine
Ahern, P. P., & Maloy, K. J. (2019) · Immunology · doi:10.1111/imm.13150 · Cited by 99 · see citing works
Fecal Microbial Transplantation for Diseases Beyond Recurrent Clostridium Difficile Infection
D’Haens, G., & Jobin, C. (2019) · Gastroenterology · doi:10.1053/j.gastro.2019.04.053 · Cited by 98 · see citing works
Inflammasome signaling in colorectal cancer
Sharma, B. R., & Kanneganti, T. (2022) · Translational research · doi:10.1016/j.trsl.2022.09.002 · Cited by 93 · see citing works
Zhu, W., Yan, J., Zhi, C., Zhou, Q., & Yuan, X. (2019) · Gut Pathogens · doi:10.1186/s13099-019-0291-z · Cited by 90 · see citing works
Dubey, S. R., Turnbull, C., Pandey, A., Zhao, A., Kurera, M., Al-Zidan, R. N., Shen, C. X., Gautam, M., Mahajan, S., Jadhav, P. S., et al. (2025) · Cellular and Molecular Immunology · doi:10.1038/s41423-025-01354-y · Cited by 97 · see citing works
Long-term evolution and short-term adaptation of microbiota strains and sub-strains in mice
Yılmaz, B., Mooser, C., Keller, I., Li, H., Zimmermann, J., Bosshard, L., Fuhrer, T., de Agüero, M. G., Trigo, N. F., Lischer, H. E. L., et al. (2021) · Cell Host & Microbe · doi:10.1016/j.chom.2021.02.001 · Cited by 87 · see citing works
Nicco, C., Paule, A., Konturek, P. C., & Edeas, M. A. (2020) · Diseases · doi:10.3390/diseases8020009 · Cited by 87 · see citing works
Shaping of Intestinal Microbiota in Nlrp6- and Rag2-Deficient Mice Depends on Community Structure
Gálvez, E. J. C., Iljazovic, A., Gronow, A., Flavell, R., & Strowig, T. (2017) · Cell Reports · doi:10.1016/j.celrep.2017.12.027 · Cited by 81 · see citing works
Li, R., & Zhu, S. (2020) · Molecular Aspects of Medicine · doi:10.1016/j.mam.2020.100859 · Cited by 84 · see citing works
Distinct cellular roles for PDCD10 define a gut-brain axis in cerebral cavernous malformation
Tang, A. T., Sullivan, K. R., Hong, C. C., Goddard, L. M., Mahadevan, A., Ren, A. A., Pardo, H., Peiper, A. M., Griffin, E., Tanes, C., et al. (2019) · Science Translational Medicine · doi:10.1126/scitranslmed.aaw3521 · Cited by 76 · see citing works
Epithelial Cells as a Transmitter of Signals From Commensal Bacteria and Host Immune Cells
Goto, Y. (2019) · Frontiers in Immunology · doi:10.3389/fimmu.2019.02057 · Cited by 75 · see citing works
Xiao, J., Wang, F., Liong, E. C., So, K., & Tipoe, G. L. (2018) · International Journal of Biological Macromolecules · doi:10.1016/j.ijbiomac.2018.09.151 · Cited by 73 · see citing works
Epithelial‐immune cell crosstalk for intestinal barrier homeostasis
Yao, Y., Shang, W., Bao, L., Peng, Z., & Wu, C. (2024) · European Journal of Immunology · doi:10.1002/eji.202350631 · Cited by 77 · see citing works
Essential immunologic orchestrators of intestinal homeostasis
Zhou, L., & Sonnenberg, G. F. (2018) · Science Immunology · doi:10.1126/sciimmunol.aao1605 · Cited by 72 · see citing works
Gut microbiota, NLR proteins, and intestinal homeostasis
Guo, H., Gibson, S. A., & Ting, J. P. ‐. (2020) · The Journal of Experimental Medicine · doi:10.1084/jem.20181832 · Cited by 70 · see citing works
Gour, N., Lajoie, S., Smole, U., White, M. J., Hu, D., Goddard, P. C., Huntsman, S., Eng, C. S., Mak, A. C. Y., Oh, S. S., et al. (2018) · Science Immunology · doi:10.1126/sciimmunol.aam9841 · Cited by 66 · see citing works
Ai, L., Ren, Y., Zhu, M., Lu, S., Qian, Y., Chen, Z., & Xu, A. (2021) · Gut · doi:10.1136/gutjnl-2020-321094 · Cited by 65 · see citing works
The contrasting roles of inflammasomes in cancer.
He, Q., Fu, Y., Tian, D., & Yan, W. (2018) · Europe PMC (PubMed Central) · Cited by 64 · see citing works
Divergent Roles for the IL-1 Family in Gastrointestinal Homeostasis and Inflammation
McEntee, C. P., Finlay, C. M., & Lavelle, E. C. (2019) · Frontiers in Immunology · doi:10.3389/fimmu.2019.01266 · Cited by 62 · see citing works
Lamkanfi, M., & Dixit, V. M. (2017) · Nature · doi:10.1038/548534a · Cited by 63 · see citing works
Microbiota-immune interactions: from gut to brain
Salvo‐Romero, E., Stokes, P., & Gareau, M. G. (2020) · LymphoSign Journal · doi:10.14785/lymphosign-2019-0018 · Cited by 61 · see citing works
Canonical and noncanonical inflammasomes in intestinal epithelial cells
Winsor, N. J., Krustev, C., Bruce, J. K., Philpott, D. J., & Girardin, S. E. (2019) · Cellular Microbiology · doi:10.1111/cmi.13079 · Cited by 60 · see citing works
The microbiome and cytosolic innate immune receptors
Liwinski, T., Zheng, D., & Elinav, E. (2020) · Immunological Reviews · doi:10.1111/imr.12901 · Cited by 57 · see citing works
NLRP6 in host defense and intestinal inflammation
Venuprasad, K., & Theiss, A. L. (2021) · Cell Reports · doi:10.1016/j.celrep.2021.109043 · Cited by 57 · see citing works
Darnaud, M., Vadder, F. D., Bogeat, P., Boucinha, L., Bulteau, A., Bunescu, A., Couturier, C., Delgado, A., Dugua, H., Elie, C., et al. (2021) · Nature Communications · doi:10.1038/s41467-021-26963-9 · Cited by 54 · see citing works
Watanabe, D., Guo, Y., & Kamada, N. (2021) · EMBO Molecular Medicine · doi:10.15252/emmm.202013452 · Cited by 52 · see citing works
Receptors Mediating Host-Microbiota Communication in the Metaorganism: The Invertebrate Perspective
Dierking, K., & Pita, L. (2020) · Frontiers in Immunology · doi:10.3389/fimmu.2020.01251 · Cited by 50 · see citing works
NLRP6 modulates neutrophil homeostasis in bacterial pneumonia-derived sepsis
Cai, S., Paudel, S., Jin, L., Ghimire, L., Taylor, C. M., Wakamatsu, N., Bhattarai, D., & Jeyaseelan, S. (2020) · Mucosal Immunology · doi:10.1038/s41385-020-00357-4 · Cited by 50 · see citing works
Sepsis roadmap: What we know, what we learned, and where we are going
Kumar, V. (2019) · Clinical Immunology · doi:10.1016/j.clim.2019.108264 · Cited by 50 · see citing works
Lemarchand, E., Barrington, J., Chenery, A., Haley, M., Coutts, G., Allen, J. E., Allan, S. M., & Brough, D. (2019) · Stroke · doi:10.1161/strokeaha.118.023620 · Cited by 49 · see citing works
Microbial sensing in the intestine
Wan, T., Wang, Y., He, K., & Zhu, S. (2023) · Protein & Cell · doi:10.1093/procel/pwad028 · Cited by 49 · see citing works
Inflammatory cell death in intestinal pathologies
Sharma, D., & Kanneganti, T. (2017) · Immunological Reviews · doi:10.1111/imr.12602 · Cited by 48 · see citing works
Guo, J., Song, C., Liu, Y., Wu, X., Dong, W., Zhu, H., Xiang, Z., & Qin, C. (2022) · Animal Models and Experimental Medicine · doi:10.1002/ame2.12257 · Cited by 40 · see citing works
Therapeutic implications of inflammasome in inflammatory bowel disease
Khatri, V., & Kalyanasundaram, R. (2021) · The FASEB Journal · doi:10.1096/fj.202002622r · Cited by 47 · see citing works
Host NLRP6 exacerbates graft-versus-host disease independent of gut microbial composition
Toubai, T., Fujiwara, H., Rossi, C., Riwes, M. M., Tamaki, H., Zajac, C. K., Liu, C., Mathew, A. V., Byun, J., Oravecz-Wilson, K. I., et al. (2019) · Nature Microbiology · doi:10.1038/s41564-019-0373-1 · Cited by 43 · see citing works
Epithelial inflammasomes in the defense against Salmonella gut infection
Fattinger, S. A., Sellin, M. E., & Hardt, W. (2020) · Current Opinion in Microbiology · doi:10.1016/j.mib.2020.09.014 · Cited by 41 · see citing works
Mitochondrial DAMPs: Key mediators in neuroinflammation and neurodegenerative disease pathogenesis
Yu, H., Ren, K., Jin, Y., Zhang, L., Liu, H., Huang, Z., Zhang, Z., Chen, X., Yang, Y., & Wei, Z. (2024) · Neuropharmacology · doi:10.1016/j.neuropharm.2024.110217 · Cited by 44 · see citing works
Loss of NLRP6 expression increases the severity of acute kidney injury
Rivas, L. V., Cuarental, L., Núñez, G., Sanz, A. B., Ortíz, A., & Sánchez-Niño, M. D. (2019) · Nephrology Dialysis Transplantation · doi:10.1093/ndt/gfz169 · Cited by 42 · see citing works
Long, L. L., Svenson, K. L., Mourino, A. J., Michaud, M., Fahey, J. R., Waterman, L., Vandegrift, K. L., & Adams, M. D. (2021) · Lab Animal · doi:10.1038/s41684-021-00777-0 · Cited by 42 · see citing works
Nlrp3-dependent IL-1β inhibits CD103+ dendritic cell differentiation in the gut
Mak’Anyengo, R., Duewell, P., Reichl, C., Hörth, C., Lehr, H., Fischer, S. E., Clavel, T., Denk, G., Hohenester, S. D., Kobold, S., et al. (2018) · JCI Insight · doi:10.1172/jci.insight.96322 · Cited by 40 · see citing works
The inflammasomes, immune guardians at defence barriers
Palazón‐Riquelme, P., & López‐Castejón, G. (2018) · Immunology · doi:10.1111/imm.12989 · Cited by 40 · see citing works
Contradictory Effects of NLRP3 Inflammasome Regulatory Mechanisms in Colitis
Wagatsuma, K., & Nakase, H. (2020) · International Journal of Molecular Sciences · doi:10.3390/ijms21218145 · Cited by 38 · see citing works
Estrogen receptor β activation inhibits colitis by promoting NLRP6-mediated autophagy
Fan, W., Ding, C., Liu, S., Gao, X., Shen, X., Boevre, M. D., Gao, Z., Li, M., Zhang, S., Miao, Y., et al. (2022) · Cell Reports · doi:10.1016/j.celrep.2022.111454 · Cited by 37 · see citing works
Mooser, C., de Agüero, M. G., & Ganal-Vonarburg, S. C. (2018) · Current Opinion in Microbiology · doi:10.1016/j.mib.2018.07.007 · Cited by 36 · see citing works
Rapin, A., Chuat, A., Lebon, L., Zaiss, M. M., Marsland, B. J., & Harris, N. L. (2019) · International Journal for Parasitology · doi:10.1016/j.ijpara.2019.09.005 · Cited by 37 · see citing works
Inflammasomes in Colitis and Colorectal Cancer: Mechanism of Action and Therapies.
Pandey, A., Shen, C. X., & Man, S. M. (2019) · Europe PMC (PubMed Central) · Cited by 37 · see citing works
Epithelial Pyroptosis in Host Defense
Churchill, M. J., Mitchell, P. S., & Rauch, I. (2021) · Journal of Molecular Biology · doi:10.1016/j.jmb.2021.167278 · Cited by 38 · see citing works
Mamantopoulos, M., Ronchi, F., McCoy, K. D., & Wullaert, A. (2018) · Gut Microbes · doi:10.1080/19490976.2017.1421888 · Cited by 36 · see citing works
Xiao, H., Chen, H., Jiang, R., Zhang, L., Wang, L., Gan, H. K., Jiang, N., Zhao, J., Zhai, X., & Liang, P. (2020) · Journal of Molecular Medicine · doi:10.1007/s00109-020-01962-3 · Cited by 36 · see citing works
Rewiring host–microbe interactions and barrier function during gastrointestinal inflammation
Yang-Jensen, S. K., Pærregaard, S. I., Brandum, E. P., Jørgensen, A. S., Hjortø, G. M., & Jensen, B. A. H. (2022) · Gastroenterology report · doi:10.1093/gastro/goac008 · Cited by 36 · see citing works
Hausmann, A., Russo, G., Grossmann, J., Zünd, M., Schwank, G., Aebersold, R. H., Liu, Y., Sellin, M. E., & Hardt, W. (2020) · Cellular Microbiology · doi:10.1111/cmi.13191 · Cited by 32 · see citing works
Inflammasome activation by Gram-positive bacteria: Mechanisms of activation and regulation
Keestra-Gounder, A. M., & Nagao, P. E. (2023) · Frontiers in Immunology · doi:10.3389/fimmu.2023.1075834 · Cited by 31 · see citing works
Targeting colonic macrophages improves glycemic control in high-fat diet-induced obesity
Rohm, T. V., Keller, L., Bosch, A. J. T., AlAsfoor, S., Baumann, Z., Thomas, A., Wiedemann, S. J., Steiger, L., Dalmas, É., Wehner, J., et al. (2022) · Communications Biology · doi:10.1038/s42003-022-03305-z · Cited by 31 · see citing works
Qin, Y., Wang, Z., Chen, H., Nie, G., & Zhao, R. (2025) · Matter · doi:10.1016/j.matt.2025.102084 · Cited by 32 · see citing works
Innate Immune Influences on the Gut Microbiome: Lessons from Mouse Models
Robertson, S. J., Goethel, A., Girardin, S. E., & Philpott, D. J. (2018) · Trends in Immunology · doi:10.1016/j.it.2018.10.004 · Cited by 31 · see citing works
- Authors
- Mamantopoulos, M., Ronchi, F., Van Hauwermeiren, F., Vieira-Silva, S., Yilmaz, B., Martens, L., Saeys, Y., Drexler, S. K., Yazdi, A. S., Raes, J., Lamkanfi, M., McCoy, K. D., & Wullaert, A.
- Affiliations
- Ghent University (BE)
- University of Bern (CH)
- University of Basel (CH)
- University of Tübingen (DE)
- VIB-KU Leuven Center for Microbiology (BE)
- Corresponding author
- McCoy, Kathy D.
- Wullaert, Andy
- ORCID
- Venue
- Immunity
- Publisher
- Elsevier BV
- Published
- 2017-08
- Volume
- 47
- Issue
- 2
- Pages
- 339-348.e4
- ISSN
- 1074-7613 (ISSN-L)
- OpenAlex
- W2742175177
- Cited by
- 181
- References
- 39
- Citations by year
- 2026: 4 · 2025: 14 · 2024: 18 · 2023: 14 · 2022: 17 · 2021: 15 · 2020: 28 · 2019: 33 · 2018: 28 · 2017: 9
- FWCI
- 10.94
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- Locations
- Immunity (publishedVersion)
- PubMed (publishedVersion)
- Ghent University Academic Bibliography (Ghent University) (submittedVersion)
- BORIS (University Library Bern) (submittedVersion)
- Digital Access to Libraries (submittedVersion, other-oa)
- Lirias (submittedVersion)
- Funders
- SNSF (SNSF310030_134902, PMPDP3_145453)
- European Research Council (FP/2007-2013, 281785, 281600, 683144)
- Marie Heim-Vögtlin fellowship
- ECCO (Odysseus grant G.0C49.13N)
- Fund for Scientific Research-Flanders
- Ghent University Concerted Research Actions (BOF14/GOA/013)
- Baillet Latour Medical Research Grant
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Gut microbiota and health
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Inflammasome and immune disorders
- Life Sciences › Immunology and Microbiology › Immunology › Immune Response and Inflammation
- Keywords
- NLRP6, ASC, inflammasome, gut microbiota composition, commensal microbiota, host innate immunity, dysbiosis, germ-free mice, host-microbe interactions
- MeSH terms
- Genetic Background, Gastrointestinal Microbiome, Animals, Bacteria, Cells, Cultured, Colitis, Female, Immunity, Innate, Mice, Inbred C57BL, Receptors, Cell Surface, RNA, Ribosomal, 16S, Sodium Dodecyl Sulfate, Mice, Knockout, Apoptosis Regulatory Proteins, Mice, CARD Signaling Adaptor Proteins, Inflammasomes, Microbiota, Dysbiosis
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
