The DOI matches its Crossref record; 21 of the 21 references it cites were found in a registry or an index.
Frizzled-7 signalling controls tissue separation during Xenopus gastrulation
Abstract
Cell signalling through Frizzled receptors has evolved to considerable complexity within the metazoans. The Frizzled-dependent signalling cascade comprises several branches, whose differential activation depends on specific Wnt ligands, Frizzled receptor isoforms and the cellular context. In Xenopus laevis embryos, the canonical beta-catenin pathway contributes to the establishment of the dorsal-ventral axis. A different branch, referred to as the planar cell polarity pathway, is essential for cell polarization during elongation of the axial mesoderm by convergent extension. Here we demonstrate that a third branch of the cascade is independent of Dishevelled function and involves signalling through trimeric G proteins and protein kinase C (PKC). During gastrulation, Frizzled-7 (Fz7)-dependent PKC signalling controls cell-sorting behaviour in the mesoderm. Loss of zygotic Fz7 function results in the inability of involuted anterior mesoderm to separate from the ectoderm, which leads to severe gastrulation defects. This result provides a developmentally relevant in vivo function for the Fz/PKC pathway in vertebrates.
Overview
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“Ca2+ can also activate PKC which regulates the process of tissue separation during gastrulation via activation of the small GTPase CDC42.100”
From Wnt signal transduction pathways (2008) · cites this paper as [100]
Citations
Cites
Yost, C., Torres, M., Miller, J., Huang, E., Kimelman, D., & Moon, R. T. (1996) · Genes & Development · doi:10.1101/gad.10.12.1443 · Cited by 1,167
Silberblick/Wnt11 mediates convergent extension movements during zebrafish gastrulation
Heisenberg, C.-P., Tada, M., Rauch, G.-J., Saúde, L., Concha, M. L., Geisler, R., Stemple, D. L., Smith, J. C., & Wilson, S. W. (2000) · Nature · doi:10.1038/35011068 · Cited by 1,013
Dishevelled controls cell polarity during Xenopus gastrulation
Wallingford, J. B., Rowning, B. A., Vogeli, K. M., Rothbächer, U., Fraser, S. E., & Harland, R. M. (2000) · Nature · doi:10.1038/35011077 · Cited by 751
Mechanism and function of signal transduction by the Wnt/β-catenin and Wnt/Ca2+ pathways
Miller, J. R., Hocking, A. M., Brown, J. D., & Moon, R. T. (1999) · Oncogene · doi:10.1038/sj.onc.1203245 · Cited by 689
Slusarski, D. C., Corces, V. G., & Moon, R. T. (1997) · Nature · doi:10.1038/37138 · Cited by 680
Tada, M., & Smith, J. C. (2000) · Development · doi:10.1242/dev.127.10.2227 · Cited by 675
Glycogen synthase kinase-3 and dorsoventral patterning in Xenopus embryos
He, X., Saint‐Jeannet, J., Woodgett, J. R., VARMUS, H. E., & Dawid, I. B. (1995) · Nature · doi:10.1038/374617a0 · Cited by 484
Sheldahl, L. C., Park, M., Malbon, C. C., & Moon, R. T. (1999) · Current Biology · doi:10.1016/s0960-9822(99)80310-8 · Cited by 475
Analysis of Dishevelled signalling pathways during Xenopus development
Sokol, S. Y. (1996) · Current Biology · doi:10.1016/s0960-9822(96)00750-6 · Cited by 406
Hsu, S.-C., Galcerán, J., & Grosschedl, R. (1998) · Molecular and Cellular Biology · doi:10.1128/mcb.18.8.4807 · Cited by 363
Flagged first, then by citations
Cited by
Sorted by citations
Items 201–261 of 261
xGit2 and xRhoGAP 11A regulate convergent extension and tissue separation in Xenopus gastrulation
Köster, I., Jungwirth, M. S., & Steinbeißer, H. (2010) · Developmental Biology · doi:10.1016/j.ydbio.2010.03.025 · Cited by 9
“MoFz7 was injected as described (Winklbauer et al., 2001).”
BackgroundInfluentialBrachet's cleft: a model for the analysis of tissue separation in Xenopus
Gorny, A., & Steinbeißer, H. (2011) · Wiley Interdisciplinary Reviews Developmental Biology · doi:10.1002/wdev.24 · Cited by 9
Kim, G., Park, E. C., & Han, J. (2011) · Methods in molecular biology · doi:10.1007/978-1-61779-510-7_7 · Cited by 8
Nelson, K. K., & Nelson, R. W. (2004) · BMC Developmental Biology · doi:10.1186/1471-213x-4-13 · Cited by 8
“Other Wnt-mediated signals activate a distinct protein kinase C-dependent signaling pathway, which appears to affect Cdc42 signaling and to provide cues that maintain tissue separation during gastrulation [7,8].”
Reorganization of actin cytoskeleton by FRIED, a Frizzled‐8 associated protein tyrosine phosphatase
Itoh, K., Lisovsky, M., Hikasa, H., & Sokol, S. Y. (2005) · Developmental Dynamics · doi:10.1002/dvdy.20526 · Cited by 8
“Fz7 has been shown to act through protein kinase C to regulate germ layer separation during gastrulation (Winklbauer et al., 2001).”
BackgroundMeasuring CamKII Activity in Xenopus Embryos as a Read-out for Non-canonical Wnt Signaling
Kühl, M., & Pandur, P. (2008) · Methods in molecular biology · doi:10.1007/978-1-59745-249-6_13 · Cited by 7
Furry is required for cell movements during gastrulation and functionally interacts with NDR1
Cervino, A. S., Moretti, B., Stuckenholz, C., Grecco, H. E., Davidson, L. A., & Cirio, M. C. (2021) · Scientific Reports · doi:10.1038/s41598-021-86153-x · Cited by 7
“…effectors and having a role in the same cellular processes (Djiane et al., 2000; Goto and Keller, 2002; Goto et al., 2005; He and Adler, 2002; Keller, 2002; Kraft et al., 2012; Tada and Smith, 2000; Takeuchi et al., 2003; Wallingford, 2012; Wallingford et al., 2000; Winklbauer et al., 2001).”
BackgroundRetinoic Acid is Required for Normal Morphogenetic Movements During Gastrulation
Gur, M., Edri, T., Moody, S. A., & Fainsod, A. (2022) · Frontiers in Cell and Developmental Biology · doi:10.3389/fcell.2022.857230 · Cited by 7
Zhang, B., Romaker, D., Ferrell, N. J., & Wessely, O. (2013) · Developmental Biology · doi:10.1016/j.ydbio.2013.01.017 · Cited by 6
“This pathway involves G-proteins and, indeed, Ptx has been shown to perturb Wnt activity during tissue separation of the Xenopus gastrula (Winklbauer et al., 2001; Katanaev et al., 2005; Angers and Moon, 2009).”
Kumar, R., Ciprianidis, A., Theiß, S., Steinbeißer, H., & Kaufmann, L. T. (2016) · Differentiation · doi:10.1016/j.diff.2016.10.002 · Cited by 7
“How does interaction of Nlk1 with PAPC promote gastrulation movements? On the one hand, PAPC regulates gastrulation movements by interacting with Fz7 and modulating cell adhesion (Kraft et al., 2012; Luu et al., 2015; Winklbauer et al., 2001).”
BackgroundInfluentialZebrafish Mir Antagonizes Frizzled 7-Induced Gastrulation Defects
Knowlton, M. N., & Kelly, G. M. (2004) · Zebrafish · doi:10.1089/zeb.2004.1.133 · Cited by 8
Pou‐V factor Oct25 regulates early morphogenesis in Xenopus laevis
Julier, A., Goll, C., Korte, B., Knöchel, W., & Wacker, S. (2012) · Development Growth & Differentiation · doi:10.1111/j.1440-169x.2012.01371.x · Cited by 5
“…of the (suprablastoporal) endoderm (Rhumbler 1902; Lewis 1947; Keller 1981), vegetal rotation of the vegetal cell mass (Winklbauer & Schürfeld 1999; Winklbauer et al. 2001; Keller et al. 2003), involution (Shih & Keller 1994; Winklbauer & Keller 1996) and convergence and extension (Keller et al.…”
BackgroundYe, Z., Xu, J., Feng, X., Jia, Y., Fu, Z., Hong, Y., Li, H., Lu, K., Lin, J., Song, M., et al. (2019) · Gene Expression Patterns · doi:10.1016/j.gep.2019.02.005 · Cited by 4
Barua, D., & Winklbauer, R. (2022) · Developmental Biology · doi:10.1016/j.ydbio.2022.07.007 · Cited by 5
Self-citationFrizzled-7-dependent Tissue Separation in the Xenopus Gastrula
Winklbauer, R., & Luu, O. (2008) · Methods in molecular biology · doi:10.1007/978-1-60327-469-2_31 · Cited by 4
“, pertussis toxin as an inhibitor of G protein signaling; dishevelled constructs) (9) .”
BackgroundSelf-citationHow Cell-Cell Adhesion Contributes to Early Embryonic Development
Ruan, G., Wedlich, D., & Köhler, A. (2004) · Springer eBooks · doi:10.1007/978-3-662-10416-3_13 · Cited by 4
Three novel pigmentation mutants generated by genome‐wide random ENU mutagenesis in the mouse
Tsipouri, V., Curtin, J. A., Nolan, P. M., Vizor, L., Parsons, C. A., Clapham, C. M., Latham, I. D., Rooke, L. J., Martin, J. E., Peters, J., et al. (2004) · Comparative and Functional Genomics · doi:10.1002/cfg.382 · Cited by 4
Turovsky, E. A., Babaev, A. A., Tarabykin, V. S., & Turovskaya, M. V. (2017) · Biochemistry (Moscow) Supplement Series A Membrane and Cell Biology · doi:10.1134/s1990747817040109 · Cited by 4
“The mechanism, by which CaMKII implements preconditioning, may have pre- and postsynaptic nature.”
BackgroundInfluentialSubcellular phenomena in colorectal cancer
Mirams, G. R. (2008) · Nottingham ePrints (University of Nottingham) · Cited by 4
Foord, S. M. (2003) · Science s STKE · doi:10.1126/stke.2003.190.pe25 · Cited by 4
Planar cell polarity emerges through polarized accumulation of Wnt11
Mii, Y., Suzuki, M., Koyama, H., Nakayama, K., Takada, R., Kobayashi, T., Tsutsumi, M., Nemoto, T., Matsuyama, M., Fujimori, T., et al. (2026) · Science Advances · doi:10.1126/sciadv.aea0326 · Cited by 3
“The following MOs were used in this study: wnt11b , CCAGTGAC-GGGTCGGAGCCATTGGT ( 69 ); vangl2 , GAGTACCGGCTTTTGT-GGCGATCCA ( 70 ) and CGTTGGCGGATTTGGGTCCCCCCGA ( 71 ); and fzd7 , CCAACAAGTGATCTCTGGACAGCAG ( 72 ) and GCGGAGTGAGCAGAAATCGGCTGAT ( 73 ).”
Tran, B. M., Flanagan, D. J., Phesse, T. J., & Vincan, E. (2021) · Handbook of experimental pharmacology · doi:10.1007/164_2021_524 · Cited by 4
Balancing cell behavior at boundaries
Wilkinson, D. G. (2015) · The Journal of Cell Biology · doi:10.1083/jcb.201501107 · Cited by 3
“uk Previous studies suggested that PAPC and noncanonical Wnt signaling in mesoderm cells act synergistically to promote boundary formation at Brachet’s cleft (Kim et al., 1998; Winklbauer et al., 2001).”
BackgroundWolanski, M., KhosrowShahian, F., Kelly, L. E., El‐Hodiri, H. M., & Crawford, M. J. (2008) · genesis · doi:10.1002/dvg.20449 · Cited by 3
Molecular mechanisms of ectodermal dysplasia syndromes
Laurikkala, J. (2004) · Työväentutkimus Vuosikirja · Cited by 3
Shi, J., & Lyu, C. (2026) · International Journal of Molecular Sciences · doi:10.3390/ijms27073250 · Cited by 2
Wnt Signaling during EarlyXenopusDevelopment
Fagotto, F. (2014) · Wiley eBooks · doi:10.1002/9781118492833.ch8 · Cited by 2
Polarized contact behavior in directionally migrating Xenopus gastrula mesendoderm
Nagel, M., & Winklbauer, R. (2023) · The International Journal of Developmental Biology · doi:10.1387/ijdb.230123rw · Cited by 1
“in an in vitro assay for tissue separation (Wacker et al., 2000; Winklbauer et al., 2001), small mesoderm explants stay on the surface of large, explanted ectoderm layers, exhibiting separation behavior, whereas ectodermal test explants reintegrate rapidly into their layer of origin (fig.”
InfluentialSelf-citationLi, Z., Wang, J., Li, C., & Zhu, Y. (2026) · Animals · doi:10.3390/ani16030387 · Cited by 1
“…WNT-2b, WNT-3a, WNT-8a, and WNT-8b) primarily signal through the canonical WNT/ β -catenin pathway, two (WNT-4 and WNT-5a) function mainly through the WNT/Ca 2+ pathway [30], and one (WNT-11) preferentially activates the WNT/JNK pathway, although cross-talk between pathways has been reported [31].”
Foord, S. M. (2003) · Science Signaling · doi:10.1126/scisignal.1902003pe25 · Cited by 1
Herbert Steinbeisser: a life with the Xenopus embryo
Robertis, E. M. D., & Niehrs, C. (2014) · The International Journal of Developmental Biology · doi:10.1387/ijdb.140117ed · Cited by 1
Identification and functional characterization of PTK7 ligands in Xenopus laevis
Peradziryi, H. (2011) · eDiss (Georg-August-Universität Göttingen) · doi:10.53846/goediss-3158 · Cited by 1
Myosin II in early Xenopus morphogenesis
Rolo, A. (2007) · doi:10.18130/v3fc9j · Cited by 1
Analyzing PTK7/RACK1 interaction in neural morphogenesis
Wehner, P. (2012) · eDiss (Georg-August-Universität Göttingen) · doi:10.53846/goediss-1462 · Cited by 1
The function of PTK7 during Xenopus neural crest migration
Shnitsar, I. (2009) · eDiss (Georg-August-Universität Göttingen) · doi:10.53846/goediss-3239 · Cited by 1
Analyzing the Function of PTK7 in Cell Migration
Podleschny, M. (2012) · eDiss (Georg-August-Universität Göttingen) · doi:10.53846/goediss-1579 · Cited by 1
The role of the histone variant H2A.Z in early Xenopus laevis development
Brown, K. D. (2007) · ANU Open Research (Australian National University) · doi:10.25911/5d7a282977819
“Whether the calcium mediated pathway inhibits convergent extension is uncertain, with experiments blocking the Ca mediated pathway producing conflicting results (Torres et al., 1996; Wallingford et al., 2002; Winklbauer et al., 2001).”
ResultMolecular Mechanisms of Wnt Pathway Specificity
Schambony, A., Zaman, G. J. R., & Verkaar, F. (2014) · Wiley eBooks · doi:10.1002/9781118444122.ch7
IKK and Beta-Catenin in Breast Cancer
Teo, M. (2002) · Defense Technical Information Center (DTIC) · doi:10.21236/ada407807
PKCs as Mediators of the Hedgehog and Wnt Signaling Pathways
Galdo, N. A. R. (2010) · Humana Press eBooks · doi:10.1007/978-1-60761-543-9_13 · Cited by 1
Wnt Signalling and Regulation of Gastrulation Movements
Shi, D. (2004) · Springer eBooks · doi:10.1007/978-3-662-10416-3_12
Cell Movements during Early Vertebrate Morphogenesis
Münsterberg, A., & Wheeler, G. N. (2005) · Wiley eBooks · doi:10.1002/9783527619689.ch4
Kim, T. (2012) · Microbiology and Biotechnology Letters · doi:10.4014/kjmb.1202.02007
“Wnts bind to Frizzled (Fz) receptors and co-receptors to initiate distinct signaling pathways classified as either canonical or noncanonical pathways [8, 18, 30].”
BackgroundBerry, C. (2002) · QJM · doi:10.1093/qjmed/95.7.487
Local Wnt11 Signalling and its role in coordinating cell behaviour in zebrafish embryos
Witzel, S. (2006) · Max Planck Institute for Plasma Physics
Krämer, A. (2006) · MACAU: Open Access Repository of Kiel University (University Library Kiel)
DEVELOPMENT OF THE ADRENO-GENITAL SYSTEM
Oulu, B. (2002)
Wang, Y. (2007) · heiDOK (Heidelberg University) · doi:10.11588/heidok.00007912
How to Assay Non-Canonical Wnt Signaling: A Critical Analysis
Whitman, M., & Sater, A. (2006) · CRC Press eBooks · doi:10.1201/9781420004786-8
Frizzled receptor 6 and risk of metastatic recurrence in early triple negative breast cancer
Corda, G. (2015) · Brunel University Research Archive (BURA) (Brunel University London)
Turovsky, E. A., Babaev, A. A., Tarabykin, V. S., & Туровская, М. В. (2017) · Биологические мембраны Журнал мембранной и клеточной биологии · doi:10.7868/s0233475517050073
NANOG at the exit of pluripotency: new roles in the gastrulating mouse embryo
de Aja, J. S. (2018) · LA Referencia (Red Federada de Repositorios Institucionales de Publicaciones Científicas)
Steinbeißer, H. (2004) · Faculty Opinions – Post-Publication Peer Review of the Biomedical Literature · doi:10.3410/f.1022322.254621
Herman, M. A. (2003) · Faculty Opinions – Post-Publication Peer Review of the Biomedical Literature · doi:10.3410/f.1012063.184220
Katoh, M. (2008) · AfCS-Nature Molecule Pages · doi:10.1038/mp.a000965.01
Usami, C., & Inomata, H. (2022) · Genes to Cells · doi:10.1111/gtc.12937
“…protocadherin (PAPC), EphA4, and ankyrin repeats domain protein 5 (xANR5), is involved in tissue separation between the BCR and mesoderm, and that the knockdown of these genes by MOs suppresses boundary formation (Chung et al., 2007; Medina et al., 2004; Park et al., 2011; Winklbauer et al., 2001).”
BackgroundSuzuki, M., Takada, R., Kobayashi, T., Matsuyama, M., Takada, S., & Mii, Y. (2025) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2025.08.12.669988
“To obtain mechanistic insights into the relationship between HS chains and PCP, especially association of HS chains and core PCP components in a polarized manner, we focused on Frizzled 7 (Fzd7), a receptor of Wnt11, as well as one of the core PCP components 41 .”
Prudent, J. (2011) · theses.fr (ABES) · doi:10.70675/1f03460cze5d6z42c6za18ez352e34a4dee4
Metadata
- Authors
- Winklbauer, R., Medina, A., Swain, R. K., & Steinbeisser, H.
- Affiliations
- Max Planck Institute for Developmental Biology (DE)
- Venue
- Nature
- Published
- 2001-10
- Volume
- 413
- Issue
- 6858
- Pages
- 856-860
- ISSN
- 0028-0836 (ISSN-L)
- 1476-4687
- OpenAlex
- W1664587663
- Cited by
- 263
- References
- 21
- Citations by year
- 2026: 3 · 2025: 1 · 2023: 2 · 2022: 5 · 2021: 3 · 2020: 3 · 2019: 4 · 2018: 5 · 2017: 7 · 2016: 9 · 2015: 8 · 2014: 8 · 2013: 5 · 2012: 11
- FWCI
- 8.96
- Type
- journal article
- Language
- en
- Open access
- closed
- Licence
- www.springer.com/tdm (tdm)
- Locations
- Nature (publishedVersion)
- PubMed (publishedVersion)
- RePEc: Research Papers in Economics (submittedVersion)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Wnt/β-catenin signaling in development and cancer
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Developmental Biology and Gene Regulation
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Planarian Biology and Electrostimulation
- Keywords
- Frizzled-7, Wnt signaling, gastrulation, Xenopus laevis, protein kinase C, trimeric G proteins, cell sorting, mesoderm, ectoderm, planar cell polarity, convergent extension, dorsal-ventral axis, β-catenin signaling
- MeSH terms
- Animals, Cytoskeletal Proteins, Embryo, Nonmammalian, Fibroblast Growth Factors, Gastrula, Mesoderm, Morphogenesis, Protein Kinase C, Receptors, Cell Surface, Xenopus laevis, Signal Transduction, Trans-Activators, Gene Expression, Oligonucleotides, Antisense, Cell Polarity, GTP-Binding Proteins, Xenopus Proteins, Receptors, G-Protein-Coupled, beta Catenin
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
