The DOI matches its Crossref record; 49 of the 49 references it cites were found in a registry or an index.
Pharmacological perturbation of CDK9 using selective CDK9 inhibition or degradation
Open accessAbstract
Cyclin-dependent kinase 9 (CDK9), an important regulator of transcriptional elongation, is a promising target for cancer therapy, particularly for cancers driven by transcriptional dysregulation. We characterized NVP-2, a selective ATP-competitive CDK9 inhibitor, and THAL-SNS-032, a selective CDK9 degrader consisting of a CDK-binding SNS-032 ligand linked to a thalidomide derivative that binds the E3 ubiquitin ligase Cereblon (CRBN). To our surprise, THAL-SNS-032 induced rapid degradation of CDK9 without affecting the levels of other SNS-032 targets. Moreover, the transcriptional changes elicited by THAL-SNS-032 were more like those caused by NVP-2 than those induced by SNS-032. Notably, compound washout did not significantly reduce levels of THAL-SNS-032-induced apoptosis, suggesting that CDK9 degradation had prolonged cytotoxic effects compared with CDK9 inhibition. Thus, our findings suggest that thalidomide conjugation represents a promising strategy for converting multi-targeted inhibitors into selective degraders and reveal that kinase degradation can induce distinct pharmacological effects compared with inhibition.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“Several mechanisms have been shown to contribute to this increase in selectivity. This includes steric incapability of some targets to form a productive ternary complex, or lack of a suitably positioned lysine residue for ubiquitination.62−69”
From Advancing Targeted Protein Degradation via Multiomics Profiling and Artificial Intelligence (2023) · cites this paper as [64]
In the citing paper
“Similarly, because of a non-linear dependence on binding, degradation target profiles often differ vastly from parental inhibitor selectivity profiles (Olson et al., 2018)”
From Mapping the Degradable Kinome Provides a Resource for Expedited Degrader Development (2020) · cites this paper as Olson et al., 2018
In the citing paper
“It is widely believed that degraders uncouple efficacy from target occupancy (Gadd et al., 2017; Nowak et al., 2018; Olson et al., 2018; Roy et al., 2019).”
From Mapping the Degradable Kinome Provides a Resource for Expedited Degrader Development (2020) · cites this paper as Olson et al., 2018
In the citing paper
“Simultaneously, it led to a marked sensitization (15-fold shift in EC50) to the CDK9-targeting PROTAC THAL-SNS-03240 (Extended Data Fig. 6B and C).”
From Functional E3 ligase hotspots and resistance mechanisms to small-molecule degraders (2023) · cites this paper as [40]
In the citing paper
“For example, selective degradation of CDK9 was achieved by converting the non-selective CDK inhibitor SNS-032 into a degrader[9].”
From Development of dual and selective degraders of cyclin-dependent kinases 4 and 6 (2019) · cites this paper as [9]
In the citing paper
“It has further been shown that PROTAC selectivity does not necessarily mimic that of its target-binding warhead, but rather depends sensitively on the linker 20, 23, 24, 33”
From Rationalizing PROTAC-Mediated Ternary Complex Formation Using Rosetta (2021) · cites this paper as [24]
In the citing paper
“and can have a duration of action that extends beyond clearance and depends on the turnover rate of the protein target rather than residence time 23,24,25 .”
From Targeted protein degradation: expanding the toolbox (2019) · cites this paper as [23]
In the citing paper
“Regarding clinical applications, appropriate dosage may be an issue, as saturating doses of free PROTAC molecules can antagonize the binding of binary PROTAC-protein complexes to their ternary partner and abrogate catalytic degradation, a well-documented phenomenon known as the hook effect in cell assays 23,33,34 .”
From Targeted protein degradation: expanding the toolbox (2019) · cites this paper as [23]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
limma powers differential expression analyses for RNA-sequencing and microarray studies
Ritchie, M. E., Phipson, B., Wu, D., Hu, Y., Law, C. W., Shi, W., & Smyth, G. K. (2015) · Nucleic Acids Research · doi:10.1093/nar/gkv007 · Cited by 40,458
Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources
Huang, D. W., Sherman, B. T., & Lempicki, R. A. (2009) · Nature Protocols · doi:10.1038/nprot.2008.211 · Cited by 35,890
Model-based Analysis of ChIP-Seq (MACS)
Zhang, Y., Liu, T., Meyer, C. A., Eeckhoute, J., Johnson, D. S., Bernstein, B. E., Nusbaum, C., Myers, R. M., Brown, M., Li, W., et al. (2008) · Genome Biology · doi:10.1186/gb-2008-9-9-r137 · Cited by 18,386
Trapnell, C., Williams, B. A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M. J., Salzberg, S. L., Wold, B. J., & Pachter, L. (2010) · Nature Biotechnology · doi:10.1038/nbt.1621 · Cited by 15,556
Huang, D. W., Sherman, B. T., & Lempicki, R. A. (2009) · Nucleic Acids Research · doi:10.1093/nar/gkn923 · Cited by 14,108
Core Transcriptional Regulatory Circuitry in Human Embryonic Stem Cells
Boyer, L. A., Lee, T. I., Cole, M. F., Johnstone, S. E., Levine, S. S., Zucker, J. P., Guenther, M. G., Kumar, R. M., Murray, H. L., Jenner, R. G., et al. (2005) · Cell · doi:10.1016/j.cell.2005.08.020 · Cited by 4,505
Self-citationPhthalimide conjugation as a strategy for in vivo target protein degradation
Winter, G. E., Buckley, D. L., Paulk, J., Roberts, J. M., Souza, A., Dhe-Paganon, S., & Bradner, J. E. (2015) · Science · doi:10.1126/science.aab1433 · Cited by 1,760
Self-citationMalumbres, M. (2014) · Genome biology · doi:10.1186/gb4184 · Cited by 1,730
Transcriptional Amplification in Tumor Cells with Elevated c-Myc
Lin, C. Y., Lovén, J., Rahl, P. B., Paranal, R. M., Burge, C. B., Bradner, J. E., Lee, T. I., & Young, R. A. (2012) · Cell · doi:10.1016/j.cell.2012.08.026 · Cited by 1,543
Self-citationc-Myc Regulates Transcriptional Pause Release
Rahl, P. B., Lin, C. Y., Seila, A. C., Flynn, R. A., McCuine, S., Burge, C. B., Sharp, P. A., & Young, R. A. (2010) · Cell · doi:10.1016/j.cell.2010.03.030 · Cited by 1,279
Self-citation
Cited by
Sorted by citations
Items 201–300 of 575
CDK9 inhibitors in cancer research
Huang, Z. L., Wang, T., Wang, C., & Fan, Y. L. (2022) · RSC Medicinal Chemistry · doi:10.1039/d2md00040g · Cited by 34
Evolution of Small Molecule Kinase Drugs
Lightfoot, H. L., Goldberg, F. W., & Sedelmeier, J. (2018) · ACS Medicinal Chemistry Letters · doi:10.1021/acsmedchemlett.8b00445 · Cited by 34
CDK9 activity is critical for maintaining MDM4 overexpression in tumor cells
Štětková, M., Growková, K., Fojtík, P., Valčíková, B., Palušová, V., Verlande, A., Jorda, R., Kryštof, V., Hejret, V., Alexiou, P., et al. (2020) · Cell Death and Disease · doi:10.1038/s41419-020-02971-3 · Cited by 34
Targeting CDK7 in oncology: The avenue forward
Li, Z., Liu, G., Gao, Y., & Zhao, M. (2022) · Pharmacology & Therapeutics · doi:10.1016/j.pharmthera.2022.108229 · Cited by 34
Identification and characterization of cancer vulnerabilities via targeted protein degradation
Mayor-Ruiz, C., & Winter, G. E. (2019) · Drug Discovery Today: Technologies · doi:10.1016/j.ddtec.2018.12.003 · Cited by 33
Self-citationTan, L., & Gray, N. S. (2018) · Chinese Journal of Chemistry · doi:10.1002/cjoc.201800293 · Cited by 34
Self-citationHa, S., Zhu, J., Xiang, H., & Luo, G. (2023) · Chinese Chemical Letters · doi:10.1016/j.cclet.2023.109192 · Cited by 34
Antitumoral Activity of a CDK9 PROTAC Compound in HER2-Positive Breast Cancer
Noblejas‐López, M. D. M., Gandullo‐Sánchez, L., Galán‐Moya, E. M., López‐Rosa, R., Tébar-García, D., Nieto‐Jiménez, C., Sango, M. G., Burgos, M., Pandiella, A., & Ocaña, A. (2022) · International Journal of Molecular Sciences · doi:10.3390/ijms23105476 · Cited by 35
“One of these compounds, THAL-SNS-032, designed using the CDK9 inhibitor SNS-032 linked to a thalidomide derivative that binds to the E3 ubiquitin ligase cereblon, causes the degradation of CDK9 [15].”
BackgroundAnti-cancer drug molecules targeting cancer cell cycle and proliferation
Patra, D., Bhavya, K., Ramprasad, P., Kalia, M., & Pal, D. (2023) · Advances in protein chemistry and structural biology · doi:10.1016/bs.apcsb.2022.11.011 · Cited by 35
Acetylation of histones and non-histone proteins is not a mere consequence of ongoing transcription
Liebner, T., Kilic, S., Walter, J., Aibara, H., Narita, T., & Choudhary, C. (2024) · Nature Communications · doi:10.1038/s41467-024-49370-2 · Cited by 36
“These inhibitors impact transcription by distinct mechanisms: ActD binds to DNA and prevents RNAPIIbinding and elongation 40 , while NVP-2 inhibits the CDK9 kinase catalytic activity and prevents RNAPII pause release 41 .”
BackgroundChemical Probes for Understudied Kinases: Challenges and Opportunities
Serafim, R. A. M., Elkins, J. M., Zuercher, W. J., Laufer, S., & Gehringer, M. (2021) · Journal of Medicinal Chemistry · doi:10.1021/acs.jmedchem.1c00980 · Cited by 32
Recent Discovery and Development of Inhibitors that Target CDK9 and Their Therapeutic Indications
Zhang, Y., Shan, L., Tang, W., Ge, Y., Li, C., & Zhang, J. (2024) · Journal of Medicinal Chemistry · doi:10.1021/acs.jmedchem.4c00312 · Cited by 32
Toward Development of the Male Pill: A Decade of Potential Non-hormonal Contraceptive Targets
Kent, K., Johnston, M., Strump, N., & Garcia, T. X. (2020) · Frontiers in Cell and Developmental Biology · doi:10.3389/fcell.2020.00061 · Cited by 32
Small-molecule PROTACs: Novel Agents for Cancer Therapy
Wan, Y., Yan, C., Gao, H. J., & Liu, T. (2020) · Future Medicinal Chemistry · doi:10.4155/fmc-2019-0340 · Cited by 32
Williams, T. D., Michalak, E. M., Carey, K. T., Lam, E. Y. N., Anderson, A., Griesbach, E., Chan, Y.-C., Papasaikas, P., Tan, V. W. T., Ngo, L., et al. (2025) · Molecular Cell · doi:10.1016/j.molcel.2024.12.008 · Cited by 35
Itkonen, H. M., Poulose, N., Walker, S., & Mills, I. G. (2019) · Neoplasia · doi:10.1016/j.neo.2019.05.001 · Cited by 30
“Primers used are as follows: MYC F- TACCC TCTCAACGACAGCAG, R- TCTTGACATTCTCCTCGGTG; MCL1 F- TGCTTCGGAAACTGGACATCA, R-TAGCCACA AAGGCACCAAAAG and Luciferase F-TACAACACCCC AACATCTTCGA, R- GGAAGTTCACCGGCGTCAT.”
BackgroundInfluentialCurrent and emerging therapeutic approaches for T‐cell acute lymphoblastic leukaemia
Pocock, R., Farah, N., Richardson, S. E., & Mansour, M. R. (2021) · British Journal of Haematology · doi:10.1111/bjh.17310 · Cited by 30
“An alternative PROteolysis Targeting Chimeras (PROTAC) approach was recently developed where THAL-SNS-032 targeted CDK9 protein for proteosomal degradation, inducing apoptosis in T-ALL cell lines in vitro.(101)”
MethodWu, X., bruyn, M. D., Hulan, J. M., Brasil, H., Sun, Z., & Barta, K. (2022) · Green Chemistry · doi:10.1039/d2gc03777g · Cited by 30
Progress of small molecules for targeted protein degradation: PROTACs and other technologies
Zhao, H., Xin, M., & Zhang, S. (2023) · Drug Development Research · doi:10.1002/ddr.22026 · Cited by 31
“Besides, 61 displayed more longlasting cytotoxicity than NVP‐2 after washout (Olson et al., 2018).”
BackgroundIntrinsic signaling pathways modulate targeted protein degradation
Yuki, M., Akizuki, Y., Honda, R., Takao, M., Tsuchimoto, A., Hashimoto, S., Iio, H., Kato, M., Kaiho-Soma, A., Saeki, Y., et al. (2024) · Nature Communications · doi:10.1038/s41467-024-49519-z · Cited by 30
A comprehensive review of emerging approaches in machine learning for de novo PROTAC design
Gharbi, Y., & Mercado, R. (2024) · Digital Discovery · doi:10.1039/d4dd00177j · Cited by 32
Chemical inhibitors of transcription-associated kinases
Clopper, K. C., & Taatjes, D. J. (2022) · Current Opinion in Chemical Biology · doi:10.1016/j.cbpa.2022.102186 · Cited by 31
Progress of proteolysis-targeting chimeras (PROTACs) delivery system in tumor treatment
Fan, L., Tong, W., Wei, A., & Mu, X. (2024) · International Journal of Biological Macromolecules · doi:10.1016/j.ijbiomac.2024.133680 · Cited by 30
Ramalingam, S., Ramamurthy, V. P., Gediya, L. K., Murigi, F. N., Purushottamachar, P., Huang, W., Choi, E. Y., Zhang, Y., Vasaitis, T. S., Kane, M. A., et al. (2019) · Cancers · doi:10.3390/cancers11030299 · Cited by 28
Robert, T., Johnson, J. L., Guichaoua, R., Yaron, T. M., Bach, S., Cantley, L. C., & Colas, P. (2020) · Frontiers in Chemistry · doi:10.3389/fchem.2020.00147 · Cited by 28
“The selectivity of NVP-2 was recently characterized in detail, using a competition binding assay with a panel of 468 recombinant purified kinases (that did not include CDK10) followed by in vitro enzymatic assays on the kinase hits, and a target engagement assay on cell lysates (Olson et al., 2018).”
MethodShao, H., Foley, D., Huang, S., Abbas, A. Y., Lam, F., Gershkovich, P., Bradshaw, T. D., Pepper, C. J., Fischer, P. M., & Wang, S. (2021) · European Journal of Medicinal Chemistry · doi:10.1016/j.ejmech.2021.113244 · Cited by 28
“[15] In the past few years, selective CDK9 inhibitors such as NVP2[26], JSH-150 [27], AZD5473 [28] and compound 30i [29] have been reported.”
BackgroundNatural product-based PROteolysis TArgeting Chimeras (PROTACs)
Liu, M., Martyn, A. P., & Quinn, R. J. (2022) · Natural Product Reports · doi:10.1039/d2np00038e · Cited by 29
Tokarski, R. J., Sharpe, C., Huntsman, A. C., Mize, B. K., Ayinde, O. R., Stahl, E. H., Lerma, J. R., Reed, A., Carmichael, B., Muthusamy, N., et al. (2023) · European Journal of Medicinal Chemistry · doi:10.1016/j.ejmech.2023.115342 · Cited by 29
Targeted therapy for fusion-driven high-risk acute leukemia
Pikman, Y., & Stegmaier, K. (2018) · Blood · doi:10.1182/blood-2018-04-784157 · Cited by 29
Reversible Covalent PROTACs: Novel and Efficient Targeted Degradation Strategy
Yuan, M., Chu, Y., & Duan, Y. (2021) · Frontiers in Chemistry · doi:10.3389/fchem.2021.691093 · Cited by 27
“, 2017) and cyclin-dependent kinase 9 (CDK9) (Olson et al., 2017).”
InfluentialAutophagy mediated targeting degradation, a promising strategy in drug development
Zhang, J., Pan, X., Ji, W., & Zhou, J. (2024) · Bioorganic Chemistry · doi:10.1016/j.bioorg.2024.107466 · Cited by 28
Targeting CDKs in cancer therapy: advances in PROTACs and molecular glues
Marei, H. E. S., Bedair, K., Hasan, A., Al-Mansoori, L., Gaiba, A., Morrione, A., Cenciarelli, C., & Giordano, A. (2025) · npj Precision Oncology · doi:10.1038/s41698-025-00931-8 · Cited by 31
Emerging modes-of-action in drug discovery
Valeur, E., Narjes, F., Ottmann, C., & Plowright, A. T. (2019) · MedChemComm · doi:10.1039/c9md00263d · Cited by 29
Selective degradation-inducing probes for studying cereblon (CRBN) biology
Powell, C. E., Du, G., Bushman, J. W., He, Z., Zhang, T., Fischer, E. S., & Gray, N. S. (2021) · RSC Medicinal Chemistry · doi:10.1039/d0md00382d · Cited by 29
Self-citationCordsmeier, A., Rinkel, S., Jeninga, M. D., Schulze‐Luehrmann, J., Ölke, M., Schmid, B., Hasler, D., Meister, G., Häcker, G. A., Petter, M., et al. (2022) · PLoS Pathogens · doi:10.1371/journal.ppat.1010266 · Cited by 27
“The small molecule THAL-SNS032 (THAL) however has been proven to induce potent and selective degradation of CDK9 [32].”
BackgroundOrhan, E., Velázquez, C., Tabet, I., Fenou, L., Rodier, G., Orsetti, B., Jacot, W., Sardet, C., & Theillet, C. G. (2024) · Cancer Letters · doi:10.1016/j.canlet.2024.216820 · Cited by 25
Inhibitors and PROTACs of CDK2: challenges and opportunities
Zeng, Y., Ren, X., Jin, P., Fan, Z., Liu, M., Zhang, Y., Li, L., Zhuo, M., Wang, J., Li, Z., et al. (2024) · Expert Opinion on Drug Discovery · doi:10.1080/17460441.2024.2376655 · Cited by 26
“For example, a highly selective CDK9 PROTAC, Thal-SNS-032, was designed based on the pan-CDK inhibitor SNS-032 [102], and a CDK6-selective PROTAC, BSJ-03-123, originated from the dual CDK4/6 inhibitor Palbociclib [103].”
Yang, F., Zhang, N., Yang, Y., Dong, C., Wu, L., Wang, W.-K., Wang, H.-X., Wen, Z., Cai, M.-Z., Li, H.-Z., et al. (2025) · Signal Transduction and Targeted Therapy · doi:10.1038/s41392-025-02444-z · Cited by 30
“43 Clinical validation of CRBN expression was performed via immunohistochemical (IHC) analysis of six prostate cancer samples, revealing high CRBN expression in 83.3% of the tumor cells (Fig.”
InfluentialMcAnulty, J., & DiFeo, A. V. (2020) · International Journal of Molecular Sciences · doi:10.3390/ijms21249486 · Cited by 28
“However, several groups succeeded in creating CDK9-specific inhibitors and PROTAC degraders [38,54,89].”
BackgroundAddressing Transcriptional Dysregulation in Cancer through CDK9 Inhibition
Toure, M. A., & Koehler, A. N. (2023) · Biochemistry · doi:10.1021/acs.biochem.2c00609 · Cited by 25
Recent advances in dual PROTACs degrader strategies for disease treatment
Liu, J., Liu, Y., Tang, J., Gong, Q., Yan, G., Fan, H., Zhang, X., & Pu, C. (2024) · European Journal of Medicinal Chemistry · doi:10.1016/j.ejmech.2024.116901 · Cited by 25
CRBN‐PROTACs in Cancer Therapy: From Mechanistic Insights to Clinical Applications
Thapa, R., Bhat, A. A., Gupta, G., Jyothi, S. R., Kaur, I., Kumar, S., Sharma, N., Prasad, G. V. S., Pramanik, A., & Ali, H. (2024) · Chemical Biology & Drug Design · doi:10.1111/cbdd.70009 · Cited by 26
“One of the key milestones in developing PROTACs as a field has been ligand development and optimization for Cereblon (CRBN) (Olson et al. 2018).”
Zhao, Y., Herrera, P. A. M., Chang, D., Hamelin, R., Long, M. J. C., & Aye, Y. (2022) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.2120687119 · Cited by 22
Selective CDK9 Inhibition by Natural Compound Toyocamycin in Cancer Cells
Pandey, S., Djibo, R., Darracq, A., Calendo, G., Zhang, H., Henry, R. A., Andrews, A. J., Baylin, S. B., Madžo, J., Najmanovich, R., et al. (2022) · Cancers · doi:10.3390/cancers14143340 · Cited by 25
“It mediates gene transcription elongation through phosphorylation of serine 2 residues of the Y1S2P3T4S5P6S7 heptapeptide repeats in the C-terminus domain (CTD) of RNA polymerase II [50,51].”
BackgroundGao, G., Li, J., Cao, Y., Li, X., Qian, Y., Wang, X., Li, M., Qiu, Y., Wu, T., Wang, L., et al. (2023) · European Journal of Medicinal Chemistry · doi:10.1016/j.ejmech.2023.115858 · Cited by 24
Li, X., Seebacher, N. A., Xiao, T., Hornicek, F. J., & Duan, Z. (2018) · Journal of Orthopaedic Research® · doi:10.1002/jor.24189 · Cited by 26
“These results are consistent with findings in other tumor types.(56,57) Taken together, our studies suggest that CDK9 might be a novel therapeutic target in synovial sarcomas, perhaps most effective in combination with apoptosisinducing cytotoxic chemotherapy.”
ResultKwiatkowski, N., Liang, T., Sha, Z., Collier, P. N., Yang, A., Sathappa, M., Paul, A., Su, L., Zheng, X., Aversa, R., et al. (2025) · Cell Chemical Biology · doi:10.1016/j.chembiol.2025.03.006 · Cited by 23
Self-citationProteolysis-Targeting Chimera (PROTAC): Is the Technology Looking at the Treatment of Brain Tumors?
Severini, L. L., Bufalieri, F., Infante, P., & Marcotullio, L. D. (2022) · Frontiers in Cell and Developmental Biology · doi:10.3389/fcell.2022.854352 · Cited by 23
“The extent of cellular damage depends on the rate of the depleted protein resynthesis (Chan et al., 2018; Cromm et al., 2018; Olson et al., 2018; Testa et al., 2018; Smith et al., 2019).”
BackgroundFunctional characterization of the human Cdk10/Cyclin Q complex
Düster, R., Ji, Y., Pan, K., Urlaub, H., & Geyer, M. (2022) · Open Biology · doi:10.1098/rsob.210381 · Cited by 22
“The difference in the efficacy of SNS-032 in favour of Cdk9 could explain the specific effect of the SNS-032-based Cdk9 degrader THAL-SNS-032, which degrades Cdk10 only after a longer incubation period [40].”
BackgroundEmerging approaches to CDK inhibitor development, a structural perspective
Hope, I., Endicott, J., & Watt, J. E. (2022) · RSC Chemical Biology · doi:10.1039/d2cb00201a · Cited by 22
Recent Advances in Optically Controlled PROTAC
Ouyang, M., Feng, Y. N., Chen, H., Liu, Y., Tan, C., & Tan, Y. C. (2023) · Bioengineering · doi:10.3390/bioengineering10121368 · Cited by 25
“…of pomalidomide as an E3 ligand in various recently developed photocaged PROTACs, researchers have explored the use of pomalidomide-derived PROTACs to achieve the controlled degradation of other POIs, such as cyclin-dependent kinase [38,39], the BCR-ABL [40] fusion protein, Tau [41], and others.”
BackgroundSynthesis, biological evaluation and clinical trials of Cereblon-based PROTACs
Vicente, A. T. S., Moura, S. P. S. P., & Salvador, J. A. R. (2025) · Communications Chemistry · doi:10.1038/s42004-025-01598-9 · Cited by 23
“Replacement of DMF with DMSO, dioxane or dimethylacetamide (DMA) has been reported to avoid the formation of this by-product during the linker attachment step 69,72 .”
Manda, S., Lee, N. K., Oh, D., & Lee, J. (2020) · Molecules · doi:10.3390/molecules25081948 · Cited by 22
“Furthermore, the enhanced selectivity of kinase degraders, as compared to their parental kinase inhibitors, were implicated as having potential applications for clinical study [23,27].”
BackgroundInhibition of CDK9 activity compromises global splicing in prostate cancer cells
Hu, Q., Poulose, N., Girmay, S., Helevä, A., Doultsinos, D., Gondane, A., Steele, R. E., Liu, X., Loda, M. F., Liu, S., et al. (2021) · RNA Biology · doi:10.1080/15476286.2021.1983287 · Cited by 23
“Even a low dose of the CDK9 inhibitor NVP2 led to a loss of AR full-length protein in LNCaP cells (Fig.”
BackgroundInfluentialRNA-mediated ribonucleoprotein assembly controls TDP-43 nuclear retention
dos Passos, P. M., Hemamali, E. H., Mamede, L. D., Hayes, L. R., & Ayala, Y. M. (2024) · PLoS Biology · doi:10.1371/journal.pbio.3002527 · Cited by 23
Induced degradation of protein kinases by bifunctional small molecules: a next-generation strategy
Groppe, J. C. (2019) · Expert Opinion on Drug Discovery · doi:10.1080/17460441.2019.1660641 · Cited by 22
“In order to specifically target the multifunctional cyclindependent kinase, Gray and coworkers recently reported the development of a PROTAC for CDK9 (Thal-SNS-032) based on a selective CDK2/7/9 inhibitor (SNS-032) [71].”
BackgroundWu, M., Han, J., Liu, Z., Zhang, Y., Huang, C. Z., Li, J., & Zeng, L. (2020) · Life Sciences · doi:10.1016/j.lfs.2020.118228 · Cited by 22
JMJD5 couples with CDK9 to release the paused RNA polymerase II
Liu, H., Ramachandran, S., Fong, N., Phang, T. L., Lee, S., Parsa, P., Liu, X., Harmacek, L. D., Danhorn, T., Song, T., et al. (2020) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.2005745117 · Cited by 21
“A375 cells with THAL-SNS-032, a CDK9-binding inhibitor SNS032 conjugated to a thalidomide derivative for E3 ubiquitin ligase (24).”
BackgroundMethodChen, Y., Xia, Z., Suwal, U., Rappu, P., Heino, J., Wever, O. D., & Geest, B. G. D. (2024) · Chemical Science · doi:10.1039/d4sc03555k · Cited by 21
“7 Unlike inhibitors, which o en interact with the active site of a protein, PROTACs can induce favorable target-ligase protein – protein interactions (PPIs), and result in the eventual degradation of POI, including target proteins that have thus far been considered undruggable.”
BackgroundBalzarini, M., Tong, J., Gui, W., Jayalath, I. M., Schell, B.-B., & Kodadek, T. J. (2024) · ACS Chemical Biology · doi:10.1021/acschembio.4c00422 · Cited by 33
Targeted degradation of CDK9 potently disrupts the MYC-regulated network
Toure, M. A., Motoyama, K., Xiang, Y., Urgiles, J., Kabinger, F., Koglin, A.-S., Iyer, R. S., Gagnon, K., Kumar, A., Ojeda, S., et al. (2025) · Cell chemical biology · doi:10.1016/j.chembiol.2025.03.001 · Cited by 22
Targeted Protein Degradation: An Emerging Therapeutic Strategy in Cancer
Barghout, S. H. (2020) · Anti-Cancer Agents in Medicinal Chemistry · doi:10.2174/1871520620666200410082652 · Cited by 21
Wang, C., Zhang, Y., Zhang, T., Shi, L., Geng, Z., & Xing, D. (2022) · Journal of Enzyme Inhibition and Medicinal Chemistry · doi:10.1080/14756366.2022.2076675 · Cited by 22
“For example, Olson et al. developed potent and highly selective cyclin-dependent kinase 9 (CDK9) PROTACs that induce proteasome-mediated selective degradation of CDK9.”
BackgroundSelf-citationLight-Activating PROTACs in Cancer: Chemical Design, Challenges, and Applications
Negi, A., Kesari, K. K., & Voisin‐Chiret, A. S. (2022) · Applied Sciences · doi:10.3390/app12199674 · Cited by 21
Graham, T. G. W., Dugast‐Darzacq, C., Dailey, G. M., Weng, B., Anantakrishnan, S., Darzacq, X., & Tjian, R. (2025) · Molecular Cell · doi:10.1016/j.molcel.2025.06.028 · Cited by 21
Development of a Potent Protein Degrader against Oncogenic BCR-ABL Protein
Shibata, N., Ohoka, N., Hattori, T., & Naito, M. (2019) · Chemical and Pharmaceutical Bulletin · doi:10.1248/cpb.c18-00703 · Cited by 21
Soosainathan, A., Iravani, M., Botty, R. E., Alexander, J. J., Sourd, L., Morisset, L., Painsec, P., Orha, R., Nikitorowicz-Buniak, J., Pancholi, S., et al. (2023) · Cancer Research · doi:10.1158/0008-5472.can-23-0650 · Cited by 20
“These compounds were chosenfortheirhighselectivityforCDK9overotherkinases,including CDK7 (11, 12).”
Targeting c-MYC has a key role in hepatocellular carcinoma therapy
Dai, P., & Wang, L. (2025) · Critical Reviews in Oncology/Hematology · doi:10.1016/j.critrevonc.2025.104786 · Cited by 22
The Vital Role of Proteomics in Characterizing Novel Protein Degraders
Zhang, A. X., Cassidy, K. B., Dahl, G., Moreau, K., Pachl, F., & Zuhl, A. M. (2021) · SLAS DISCOVERY · doi:10.1177/2472555220985776 · Cited by 21
Application of PROTACs in target identification and validation
Liu, Y., Liang, J. Y., Zhu, R., Yang, Y., Wang, Y., Wei, W., Li, H., & Chen, L. (2024) · Acta Materia Medica · doi:10.15212/amm-2024-0010 · Cited by 21
Cyclin-dependent kinase 9 as a potential specific molecular target in NK-cell leukemia/lymphoma
Kinoshita, S., Ishida, T., Ito, A., Narita, T., Masaki, A., Suzuki, S., Yoshida, T., Ri, M., Kusumoto, S., Komatsu, H., et al. (2018) · Haematologica · doi:10.3324/haematol.2018.191395 · Cited by 20
“Accumulating reports indicate that CDK9 kinase activity is crucial during the evolution and/or maintenance of many types of human malignancy.(10-17) CDK9 is also known to have an important role for Epstein–Barr Nuclear Antigen 2 (EBNA2)-dependent transcriptional activation and immortalization of EBV-infected cells.”
BackgroundInfluentialIdentification of PDE6D as a potential target of sorafenib via PROTAC technologyPreprint
Li, Y., Meng, Q., Wang, P., Liu, X., Fu, Q., Xie, Y., Zhou, Y., Qi, X., & Huang, N. (2020) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2020.05.06.079947 · Cited by 20
Negi, A., Kieffer, C., & Voisin‐Chiret, A. S. (2022) · ChemistrySelect · doi:10.1002/slct.202200981 · Cited by 19
Novel Medicinal Chemistry Strategies Targeting CDK5 for Drug Discovery
Tang, W., Lin, C., Yu, Q., Zhang, D., Liu, Y., Zhang, L., Zhou, Z., Zhang, J., & Ouyang, L. (2023) · Journal of Medicinal Chemistry · doi:10.1021/acs.jmedchem.3c00566 · Cited by 19
CDK9 inhibitors for the treatment of solid tumors
Mo, C., Wei, N., Li, T., Bhat, M. A., Mohammadi, M., & Kuang, C. (2024) · Biochemical Pharmacology · doi:10.1016/j.bcp.2024.116470 · Cited by 19
Allostery in Disease: Anticancer Drugs, Pockets, and the Tumor Heterogeneity Challenge
Nussinov, R., Yavuz, B. R., & Jang, H. (2025) · Journal of Molecular Biology · doi:10.1016/j.jmb.2025.169050 · Cited by 19
Zhong, Y., Xu, J., Cao, H., Gao, J., Ding, S., Ren, Z., Yang, H., Sun, Y., Cheng, M., Li, J., et al. (2025) · Acta Pharmaceutica Sinica B · doi:10.1016/j.apsb.2025.03.047 · Cited by 19
Sun, R., & Fisher, R. P. (2025) · Molecular Cell · doi:10.1016/j.molcel.2025.03.021 · Cited by 18
Conformational Dynamics and Binding Kinetics Drive Mutant Selective Degradation of EGFR
Rosenberg, S., Shanahan, F., Yamazoe, S., Kschonsak, M., Zeng, Y. J., Lee, J., Plise, E. G., Yen, I., Rose, C. M., Quinn, J. G., et al. (2021) · Cell chemical biology · doi:10.1016/j.chembiol.2023.01.007 · Cited by 18
Jiang, B., Weinstock, D. M., Donovan, K. A., Sun, H.-W., Wolfe, A., Amaka, S., Donaldson, N. L., Wu, G., Jiang, Y. Z., Wilcox, R. A., et al. (2023) · Cell chemical biology · doi:10.1016/j.chembiol.2023.03.007 · Cited by 19
Self-citationThe reversible inhibitor SR-4835 binds Cdk12/cyclin K in a noncanonical G-loop conformation
Schmitz, M., Kaltheuner, I. H., Anand, K., Düster, R., Moecking, J., Monastyrskyi, A., Duckett, D. R., Roush, W. R., & Geyer, M. (2023) · Journal of Biological Chemistry · doi:10.1016/j.jbc.2023.105501 · Cited by 20
“NVP-2, described as a speci fi c and highly effective ATP-competitive Cdk9 inhibitor (46), displayed an IC 50 of 40.9 nM toward Cdk12.”
BackgroundInfluentialMcSwiggen, D. T., Liu, H., Tan, R., Puig, S. A., Akella, L. B., Berman, R., Bretan, M., Chen, H., Darzacq, X., Ford, K., et al. (2024) · eLife · doi:10.7554/elife.93183.3 · Cited by 18
Kaji, T., Koga, H., Kuroha, M., Akimoto, T., & Hayata, K. (2020) · Scientific Reports · doi:10.1038/s41598-020-59966-5 · Cited by 16
O-GlcNAc transferase couples MRE11 to transcriptionally active chromatin to suppress DNA damage
Gondane, A., Girmay, S., Helevä, A., Pallasaho, S., Loda, M. F., & Itkonen, H. M. (2022) · Journal of Biomedical Science · doi:10.1186/s12929-022-00795-1 · Cited by 17
“Data is representative of four biological replicates A B TBP- O-GlcNAc- OGT- MRE11- GAPDH- CDK9 Nucleus+ cytosol Chromatin NVP2: - + + OSMI-4: - +- - + + - +- p-S2-Pol II- p-H2AX- Actin- LNCaP LN95 22RV1 RWPE-1 OS M D OS M D OS M D OS M D NVP2 (nM) NVP2 (nM) NVP2 (nM) NVP2 (nM) 20 200 20 200 20 200 20 200 LNCaP LN95 2…”
BackgroundInfluentialDevelopment and Characterization of Selective FAK Inhibitors and PROTACs with In Vivo Activity
Koide, E., Mohardt, M. L., Doctor, Z. M., Yang, A., Hao, M., Donovan, K. A., Kuismi, C. C., Nelson, A. J., Abell, K., Aguiar, M., et al. (2023) · ChemBioChem · doi:10.1002/cbic.202300141 · Cited by 18
Self-citationProteolysis-targeting chimeras in biotherapeutics: Current trends and future applications
Li, Q., Zhou, L., Qin, S., Huang, Z., Li, B., Li, B., Yang, M., Nice, E. C., Zhu, H., & Huang, C. (2023) · European Journal of Medicinal Chemistry · doi:10.1016/j.ejmech.2023.115447 · Cited by 17
Wilms, G., Schofield, K., Maddern, S., Foley, C., Shaw, Y., Smith, B. E., Basantes, L. E., Schwandt, K., Babendreyer, A., Chavez, T., et al. (2024) · Journal of Medicinal Chemistry · doi:10.1021/acs.jmedchem.4c01130 · Cited by 19
Targeted selective degradation of Bruton’s tyrosine kinase by PROTACs
Liu, S., Da, Y., Wang, F., Yan, R., Shu, Y., Lin, P., & Lin, J. (2020) · Medicinal Chemistry Research · doi:10.1007/s00044-020-02526-3 · Cited by 17
Design and pharmaceutical applications of proteolysis-targeting chimeric molecules
Liang, Y., Nandakumar, K. S., & Cheng, K. (2020) · Biochemical Pharmacology · doi:10.1016/j.bcp.2020.114211 · Cited by 16
Self-citationJang, J., To, C., Clercq, D. J. H. D., Park, E., Ponthier, C. M., Shin, B. H., Mushajiang, M., Nowak, R. P., Fischer, E. S., Eck, M. J., et al. (2020) · Angewandte Chemie · doi:10.1002/ange.202003500 · Cited by 17
Self-citationCDK11, a splicing-associated kinase regulating gene expression
Hluchý, M., & Blažek, D. (2024) · Trends in Cell Biology · doi:10.1016/j.tcb.2024.08.004 · Cited by 16
Bhutada, I., Khambati, F. A., Cheng, S., Tiek, D. M., Duckett, D. R., Lawrence, H. R., Vogelbaum, M. A., Mo, Q., Chellappan, S., & Padmanabhan, J. (2023) · Neuro-Oncology · doi:10.1093/neuonc/noad143 · Cited by 16
Wang, M., Yu, T., Wang, Q.-Y., Han, X., Hu, X., Ye, S., Long, X., Wang, Y., Zhu, H., Luo, W., et al. (2023) · Acta Pharmacologica Sinica · doi:10.1038/s41401-023-01192-6 · Cited by 17
“The CDK9 selective inhibitor NVP-2 was bought from MedChemEx-press (Monmouth Junction, NJ, USA) [13, 14].”
Wang, K., Jiang, M., Liu, H., Meng, C., Li, M., & Lu, H. (2024) · Bioorganic Chemistry · doi:10.1016/j.bioorg.2024.107319 · Cited by 17
CDK9 targeting PROTAC L055 inhibits ERα-positive breast cancer
Chen, W., Wu, Y., Yang, C., Ren, W., Hou, L., Liang, H., Wu, T., Kong, Y., Wu, J., Rao, Y., et al. (2024) · Biomedicine & Pharmacotherapy · doi:10.1016/j.biopha.2024.116972 · Cited by 16
The Molecular Context of Vulnerability for CDK9 Suppression in Triple Wild-Type Melanoma
Guhan, S. M., Shaughnessy, M., Rajadurai, A., Taylor, M., Kumar, R., Ji, Z., Rashid, S., Flaherty, K. T., & Tsao, H. (2021) · Journal of Investigative Dermatology · doi:10.1016/j.jid.2020.12.035 · Cited by 15
The Role of E3 Ligase Pirh2 in Disease
Daks, A. A., Fedorova, O., Parfenyev, S. E., Nevzorov, I. A., Shuvalov, O. Y., & Barlev, N. A. (2022) · Cells · doi:10.3390/cells11091515 · Cited by 19
HEXIM1 is an essential transcription regulator during human erythropoiesis
Lv, X., Murphy, K. E., Murphy, Z. C., Getman, M. R., Rahman, N. F., Nakamura, Y., Blanc, L., Gallagher, P. G., Palis, J., Mohandas, N., et al. (2023) · Blood · doi:10.1182/blood.2022019495 · Cited by 15
Chen, J., Ni, X., Yang, J. M., Yang, H., Liu, X., Chen, M., Sun, C., & Wang, Y. (2024) · Journal of Cellular and Molecular Medicine · doi:10.1111/jcmm.18327 · Cited by 15
Metadata
- Authors
- Olson, C. M., Jiang, B., Erb, M. A., Liang, Y., Doctor, Z. M., Zhang, Z., Zhang, T., Kwiatkowski, N., Boukhali, M., Green, J. L., Haas, W., Nomanbhoy, T., Fischer, E. S., Young, R. A., Bradner, J. E., Winter, G. E., & Gray, N. S.
- Affiliations
- Harvard University (US)
- California Sea Grant (US)
- Whitehead Institute for Biomedical Research (US)
- Corresponding author
- Gray, Nathanael S
- ORCID
- Venue
- Nature Chemical Biology
- Published
- 2017-12-18
- Volume
- 14
- Issue
- 2
- Pages
- 163-170
- ISSN
- 1552-4450 (ISSN-L)
- 1552-4469
- PMC
- PMC5912898
- OpenAlex
- W2781383440
- Cited by
- 552
- References
- 49
- Citations by year
- 2026: 41 · 2025: 78 · 2024: 71 · 2023: 63 · 2022: 69 · 2021: 77 · 2020: 77 · 2019: 51 · 2018: 24 · 2017: 1
- FWCI
- 17.42
- Type
- journal article
- Language
- en
- Open access
- green
- europepmc.org
- Licence
- www.springer.com/tdm (tdm)
- Locations
- Nature Chemical Biology (publishedVersion)
- PubMed (publishedVersion)
- Europe PMC (PubMed Central) (acceptedVersion)
- PubMed Central (acceptedVersion)
- DSpace@MIT (Massachusetts Institute of Technology) (submittedVersion)
- PMC
- Funders
- National Cancer Institute (R01CA179483, R01CA218278)
- National Institute of General Medical Sciences (T32GM007753)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Protein Degradation and Inhibitors
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Histone Deacetylase Inhibitors Research
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Ubiquitin and proteasome pathways
- Keywords
- CDK9, transcription elongation, CDK9 inhibitor, SNS-032, cereblon, E3 ubiquitin ligase, apoptosis, transcriptional dysregulation, cancer therapy
- MeSH terms
- Humans, Ligands, Oxazoles, Peptide Hydrolases, Phosphorylation, Protein Binding, Protein Conformation, Thalidomide, Thiazoles, Apoptosis, Crystallography, X-Ray, Inhibitory Concentration 50, Proteomics, Cyclin-Dependent Kinase 9, Ubiquitin-Protein Ligases, Cell Line, Tumor, Protein Kinase Inhibitors, Adaptor Proteins, Signal Transducing, Cell Proliferation
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
