Polymerase Chain Reaction Amplification of a Repetitive DNA Sequence Specific for Mycobacterium tuberculosis
Abstract
A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI site. The specific PCR product was obtained with input DNA from 11 different strains of M. tuberculosis and Mycobacterium bovis and one strain of Mycobacterium simiae. No product was detected with DNA from 28 strains of the Mycobacterium avium complex, Mycobacterium scrofulaceum, Mycobacterium kansasii, Mycobacterium fortuitum, Mycobacterium chelonei, and Mycobacterium gordonae. The PCR product was detected by gel electrophoresis after 30 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for an assay to detect M. tuberculosis directly in clinical material.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
False-positive reactions are a major problem with PCR methods for detection of M. tuberculosis.
“False-positive reactions are a major problem with PCR methods for the detection of the M. tuberculosis (Eisenach et al., 1990; Friess et al., 1990; DelPortillo et al., 1991; Eisenach et al., 1991).”
From Application of PCR from the fine needle aspirates for the diagnosis of cervical tuberculous lymphadenitis. (1996) · cites this paper as Eisenach et al., 1990
Cited by
Sorted by citations
Chakravorty, S., Sen, M. K., & Tyagi, J. S. (2005) · Journal of Clinical Microbiology · doi:10.1128/jcm.43.9.4357-4362.2005 · Cited by 282 · see citing works
Rapid Detection of Mycobacterium tuberculosis by Recombinase Polymerase Amplification
Boyle, D. S., McNerney, R., Teng Low, H., Leader, B. T., Pérez-Osorio, A. C., Meyer, J. C., O'Sullivan, D. M., Brooks, D. G., Piepenburg, O., & Forrest, M. S. (2014) · PLoS ONE · doi:10.1371/journal.pone.0103091 · Cited by 164 · see citing works
Identification of the Causative Organism of Tuberculous Lymphadenitis in Ethiopia by PCR
Kidane, D., Olobo, J. O., Habte, A., Negesse, Y., Aseffa, A., Abate, G., Yassin, M. A., Bereda, K., & Harboe, M. (2002) · Journal of Clinical Microbiology · doi:10.1128/jcm.40.11.4230-4234.2002 · Cited by 126 · see citing works
Molecular Exploration of the First-Century Tomb of the Shroud in Akeldama, Jerusalem
Matheson, C. D., Vernon, K. K., Lahti, A., Fratpietro, R., Spigelman, M., Gibson, S., Greenblatt, C. L., & Donoghue, H. D. (2009) · PLoS ONE · doi:10.1371/journal.pone.0008319 · Cited by 68 · see citing works
Kim, S. S., Chung, S. M., Kim, J. N., Lee, M. A., & Ha, E. H. (1996) · Journal of Korean medical science · doi:10.3346/jkms.1996.11.2.127 · Cited by 36 · see citing works
Sekar, B., Selvaraj, L., Alexis, A., Ravi, S., Arunagiri, K., & Rathinavel, L. (2008) · Indian Journal of Medical Microbiology · doi:10.1016/s0255-0857(21)01813-2 · Cited by 45 · see citing works
- Authors
- Eisenach, K. D., Donald Cave, M., Bates, J. H., & Crawford, J. T.
- Affiliations
- John L. McClellan Memorial Veterans Hospital (US)
- ORCID
- Eisenach, K. D.
- Venue
- Journal of Infectious Diseases
- Publisher
- Oxford University Press (OUP)
- Published
- 1990-05-01
- Volume
- 161
- Issue
- 5
- Pages
- 977-981
- ISSN
- 0022-1899 (ISSN-L)
- 1537-6613
- OpenAlex
- W1968649252
- Cited by
- 748
- References
- 0
- Citations by year
- 2026: 6 · 2025: 2 · 2024: 7 · 2023: 11 · 2022: 11 · 2021: 12 · 2020: 8 · 2019: 11 · 2018: 9 · 2017: 21 · 2016: 21 · 2015: 21 · 2014: 18 · 2013: 27 · 2012: 29
- FWCI
- 39.00
- Type
- journal article
- Language
- en
- Open access
- closed
- Locations
- The Journal of Infectious Diseases (publishedVersion)
- PubMed (publishedVersion)
- Topics
- Health Sciences › Medicine › Infectious Diseases › Tuberculosis Research and Epidemiology
- Health Sciences › Medicine › Epidemiology › Mycobacterium research and diagnosis
- Health Sciences › Medicine › Surgery › Infectious Diseases and Tuberculosis
- Keywords
- Mycobacterium tuberculosis, repetitive DNA, PCR detection, diagnostic assay, primer design, Mycobacterium bovis, Mycobacterium simiae, Mycobacterium avium complex
- MeSH terms
- Base Sequence, Cloning, Molecular, DNA, Bacterial, Electrophoresis, Agar Gel, Gene Amplification, Humans, Molecular Sequence Data, Mycobacterium tuberculosis, Nucleic Acid Hybridization, Repetitive Sequences, Nucleic Acid, Temperature, Polymerase Chain Reaction
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
