The DOI matches its Crossref record; 25 of the 26 references it cites were found in a registry or an index.
ER Stress Controls Iron Metabolism Through Induction of Hepcidin
Open accessAbstract
Hepcidin is a peptide hormone that is secreted by the liver and controls body iron homeostasis. Hepcidin overproduction causes anemia of inflammation, whereas its deficiency leads to hemochromatosis. Inflammation and iron are known extracellular stimuli for hepcidin expression. We found that endoplasmic reticulum (ER) stress also induces hepcidin expression and causes hypoferremia and spleen iron sequestration in mice. CREBH (cyclic AMP response element-binding protein H), an ER stress-activated transcription factor, binds to and transactivates the hepcidin promoter. Hepcidin induction in response to exogenously administered toxins or accumulation of unfolded protein in the ER is defective in CREBH knockout mice, indicating a role for CREBH in ER stress-regulated hepcidin expression. The regulation of hepcidin by ER stress links the intracellular response involved in protein quality control to innate immunity and iron homeostasis.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The cited source says what the claim attributes to it.
In the citing paper
“Cytokines such as interleukin (IL)-1, IL-6, or IL-22 as well as bacterial LPS or endoplasmic reticulum stress induce the formation of the master regulator of iron homeostasis, hepcidin, in the liver (Nemeth et al., 2003; Vecchi et al., 2009; Armitage et al., 2011).”
From Iron at the interface of immunity and infection (2014) · cites this paper as Vecchi et al., 2009
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
Control of inositol 1,4,5-trisphosphate-induced Ca2+ release by cytosolic Ca2+
Bootman, M. D., Missiaen, L., Parys, J. B., SMEDT, H. D., & Casteels, R. (1995) · Biochemical Journal · doi:10.1042/bj3060445 · Cited by 5,131
Hepcidin Regulates Cellular Iron Efflux by Binding to Ferroportin and Inducing Its Internalization
Nemeth, E., Tuttle, M. S., Powelson, J., Vaughn, M. B., Donovan, A., Ward, D. M., Ganz, T., & Kaplan, J. (2004) · Science · doi:10.1126/science.1104742 · Cited by 4,803
Yoshida, H., Matsui, T., Yamamoto, A., Okada, T., & Mori, K. (2001) · Cell · doi:10.1016/s0092-8674(01)00611-0 · Cited by 4,054
Mutation of the mouse klotho gene leads to a syndrome resembling ageing
Kuro-o, M., Matsumura, Y., Aizawa, H., Kawaguchi, H., Suga, T., Utsugi, T., Ohyama, Y., Kurabayashi, M., Kaname, T., Kume, E., et al. (1997) · Nature · doi:10.1038/36285 · Cited by 3,837
THE MAMMALIAN UNFOLDED PROTEIN RESPONSE
Schröder, M., & Kaufman, R. J. (2005) · Annual Review of Biochemistry · doi:10.1146/annurev.biochem.73.011303.074134 · Cited by 3,104
Self-citationPigeon, C., Ilyin, G., Courselaud, B., Leroyer, P., Turlin, B., Brissot, P., & Loréal, O. (2001) · Journal of Biological Chemistry · doi:10.1074/jbc.m008923200 · Cited by 1,697
Hepcidin, a putative mediator of anemia of inflammation, is a type II acute-phase protein
Nemeth, E., Valore, E. V., Territo, M., Schiller, G., Lichtenstein, A., & Ganz, T. (2003) · Blood · doi:10.1182/blood-2002-10-3235 · Cited by 1,417
Dysmetabolic Hyperferritinemia: All Iron Overload Is Not Hemochromatosis
Makker, J. S., Hanif, A., Bajantri, B., & Chilimuri, S. S. (2015) · Case Reports in Gastroenterology · doi:10.1159/000373883 · Cited by 1,353
Bone morphogenetic protein signaling by hemojuvelin regulates hepcidin expression
Babitt, J. L., Huang, F. W., Wrighting, D. M., Xia, Y., Sidis, Y., Samad, T. A., Campagna, J. A., Chung, R. T., Schneyer, A. L., Woolf, C. J., et al. (2006) · Nature Genetics · doi:10.1038/ng1777 · Cited by 1,026
Hereditary Hemochromatosis — A New Look at an Old Disease
Pietrangelo, A. (2004) · New England Journal of Medicine · doi:10.1056/nejmra031573 · Cited by 992
Self-citation
Research works printed but not linked: 2
- Cartwright G. E., Semin. Hematol. 3, 351 (1966).5341723
- Hurst H. C., Protein Profile 2, 101 (1995).7780801
Cited by
Sorted by citations
Items 201–300 of 310
mRNA regulation of cardiac iron transporters and ferritin subunits in a mouse model of iron overload
Brewer, C., Wood, R. I., & Wood, J. C. (2014) · Experimental Hematology · doi:10.1016/j.exphem.2014.09.002 · Cited by 19
“GTCAACGGCCACATTTTCAA-3 [18]; L-type calcium channel forward, 5GATGGGATCATGGCTTATGG -3; L-type calcium channel reverse, 5GGCCAGCTTCTTTCTCTCCT-3 [19]; T-type calcium channel forward, 5ACCCTCCCCAAAGAAAGAT-3; T-type calcium channel reverse, 5GCTTACATGGGACTTTTCAG-3 [20]; Gapdh forward, 5-CAATGTGTCCGTCG TGGATCT-3; Gapdh rev…”
Heat stress stimulates hepcidin mRNA expression and C/EBPα protein expression in aged rodent liver
Bloomer, S. A., Kregel, K. C., & Brown, K. E. (2013) · Archives of Gerontology and Geriatrics · doi:10.1016/j.archger.2013.07.012 · Cited by 19
“The induction of hepcidin in vivo after environmental heat stress is a novel observation and confirms previous studies showing that hepcidin is upregulated in response to cellular stress in vitro (Oliveira et al., 2009; Vecchi et al., 2009).”
Pathogens, Metabolic Adaptation, and Human Diseases—An Iron-Thrifty Genetic Model
Pietrangelo, A. (2015) · Gastroenterology · doi:10.1053/j.gastro.2015.08.003 · Cited by 18
Self-citationMiyachi, H., Kobayashi, Y., Relja, B., Fujita, N., Iwasa, M., Gabazza, E. C., & Takei, Y. (2011) · Hepatology Research · doi:10.1111/j.1872-034x.2011.00777.x · Cited by 17
CHOP ‐mediated hepcidin suppression modulates hepatic iron load
Mueller, K., Sunami, Y., Stützle, M., Güldiken, N., Kücükoglu, Ö., Mueller, S., Kulaksiz, H., Schwarz, P., & Strnad, P. (2013) · The Journal of Pathology · doi:10.1002/path.4221 · Cited by 17
“J Pathol 2013; 231: 532–542 Published by John Wiley & Sons, Ltd. www.pathsoc.org.uk www.thejournalofpathology.com C/EBP-homologous protein; CREBH, cyclic AMP-responsive element-binding protein H; EMSA, electrophoretic mobility shift assay; EPO, erythropoietin; GADD153, growth arrest and DNA damage-induced gene 153; Gr…”
BackgroundInfluentialNielsen, O. H., Coskun, M., & Weiß, G. (2016) · Current Opinion in Gastroenterology · doi:10.1097/mog.0000000000000247 · Cited by 19
Serum hepcidin levels in chronic liver disease: a systematic review and meta-analysis
Sharma, R., Zhao, W., Zafar, Y., Murali, A. R., & Brown, K. E. (2023) · Clinical Chemistry and Laboratory Medicine (CCLM) · doi:10.1515/cclm-2023-0540 · Cited by 16
Brunner, J., Plattet, P., Doucey, M., Rosso, L., Curie, T., Montagner, A., Wittek, R., Vandelvelde, M., Zurbriggen, A., Hirling, H., et al. (2012) · PLoS ONE · doi:10.1371/journal.pone.0032803 · Cited by 16
“24 hours post-infection, we monitored CRT expression as a marker of ER stress [18,19] by means of immunofluorescence in fixed and permeabilized Vero cells.”
MethodSubha Palaneeswari, M. (2013) · JOURNAL OF CLINICAL AND DIAGNOSTIC RESEARCH · doi:10.7860/jcdr/2013/6420.3273 · Cited by 19
Iron and ER stress in neurodegenerative disease
Liu, Y., & Connor, J. R. (2012) · BioMetals · doi:10.1007/s10534-012-9544-8 · Cited by 14
“ship of iron and ER stress by showing that both in hepatocyte-derived cells and in mouse liver, ER stress inducers reshaped the expression of iron-related genes, namely ferroprotein and ferritin H, through induction of hepcidin, which controls plasma iron levels and perhaps innate immunity (Oliveira et al. 2009; Vecch…”
BackgroundGenetic Predisposition of Human Plasma Triglyceride Concentrations
Schwarzová, L., Hubacek, J. A., & Vrablı́k, M. (2015) · Physiological Research · doi:10.33549/physiolres.933197 · Cited by 14
Differences in DNA methylation of HAMP in blood cells predicts the development of type 2 diabetes
Ouni, M., Eichelmann, F., Jähnert, M., Krause, C., Saussenthaler, S., Ott, C., Gottmann, P., Speckmann, T., Huypens, P., Wolter, S., et al. (2023) · Molecular Metabolism · doi:10.1016/j.molmet.2023.101774 · Cited by 13
“Beside iron levels, hepcidin expression is regulated by other factors (i) gluconeogenic stimuli (fasting and glucagon) via specific transcription factors like CREB3L3 and PPARGC1A [53], (ii) the unfolded protein response during ER stress via the transcription factor CREBH [54] and via (iii)Toll-like receptors or infla…”
BackgroundDuality of Nrf2 in iron-overload cardiomyopathy
Federti, E., Vinchi, F., Iatcenko, I., Ghigo, A., Mattè, A., Mbiandjeu, S. C. T., Siciliano, A., Chiabrando, D., Tolosano, E., Vance, S. Z., et al. (2023) · Haematologica · doi:10.3324/haematol.2022.281995 · Cited by 13
“56 Indeed, in Nrf2 -/- mice exposed to IO, we found increased Hamp expression independently from Bmp2-6, whose expression is similar to that observed in IO WT animals.”
Bagu, E. T., Layoun, A., Calvé, A., & Santos, M. M. (2013) · BioMetals · doi:10.1007/s10534-013-9683-6 · Cited by 15
Bagu, E. T., & Santos, M. M. (2011) · Journal of Molecular Endocrinology · doi:10.1530/jme-11-0060 · Cited by 15
Bignucolo, A., Lemire, J. A., Auger, C., Castonguay, Z., Appanna, V. P., & Vasu, D. (2012) · InTech eBooks · doi:10.5772/30273 · Cited by 13
“…responses including i) the decreased dietary iron uptake during an overload situation, ii) the anemia seen during infection to prevent free iron from promoting pathogen proliferation and iii) an increase of iron uptake during hypoxia (Atkinson et al, 2011; Choi et al, 2007; Vecchi et al, 2009).”
BackgroundInfluentialWang, X., Wang, L., & Liu, S. (2015) · Chemical Research in Toxicology · doi:10.1021/tx500422q · Cited by 12
Loganathan, R., Kim, J. H., Wells, M. B., & Andrew, D. J. (2020) · Current topics in developmental biology/Current Topics in Developmental Biology · doi:10.1016/bs.ctdb.2020.09.005 · Cited by 12
Sex differences and steroid modulation of cardiac iron in a mouse model of iron overload
Brewer, C., Otto‐Duessel, M., Wood, R. I., & Wood, J. C. (2013) · Translational research · doi:10.1016/j.trsl.2013.08.004 · Cited by 12
“Primer sequences were as follows: hepcidin forward, 5-CTGAGCAGCACCACCTA TCTC-3; hepcidin reverse, 5-TGGCTCTAGGCTA TGTTTTGC-3; b-actin forward, 5-GACGGCCA GGTCATCACTATTG-3; b-actin reverse, 5-CCACA GGATTCCATACCCAAGA-331; Zip14 forward, 5-GA GCCAACTGATAATCCATTGCT-3; Zip14 reverse, 5- GTCAACGGCCACATTTTCAA-332; L-type cal…”
Proteomic Biomarkers for the Early Detection of Acute Kidney Injury
Herget‐Rosenthal, S., Metzger, J., Albalat, A., Bitsika, V., & Mischak, H. (2012) · InTech eBooks · doi:10.5772/45624 · Cited by 12
“The authors were able to resolve one of these peptides as hepcidin-25, the active form of hepcidin, which is secreted by the liver to maintain iron homeostasis and which is up-regulated during acute phase response [83].”
BackgroundHaney, S. L., Varney, M. L., Safranek, H. R., Chhonker, Y. S., G-Dayanandan, N., Talmon, G. A., Murry, D. J., Wiemer, A. J., Wright, D. L., & Holstein, S. A. (2018) · Leukemia Research · doi:10.1016/j.leukres.2018.12.007 · Cited by 12
Mi, X., Li, Q., Wen, X., Xie, J., Wang, Y., & Song, N. (2021) · Neurochemical Research · doi:10.1007/s11064-021-03292-3 · Cited by 13
Johnson, M. A. (2012) · Materials and Methods · doi:10.13070/mm.en.2.115 · Cited by 12
Shanmugam, N. K. N., & Cherayil, B. J. (2013) · Biochemical and Biophysical Research Communications · doi:10.1016/j.bbrc.2013.10.065 · Cited by 11
“Additional signals, for instance, those activated by endoplasmic reticulum stress, have also been shown to influence hepcidin transcription [15,16].”
BackgroundGlycochenodeoxycholate Affects Iron Homeostasis via Up-Regulating Hepcidin Expression
Wang, L.-J., Zhao, G., Wang, X.-F., Liu, X., Li, Y., Qiu, L.-L., Wang, X., & Ren, F. (2022) · Nutrients · doi:10.3390/nu14153176 · Cited by 12
“Thus, it was further verified that either STAT3 or CREBH related signaling was the main functional pathway for GCDCA-induced hepcidin expression.”
BackgroundInfluentialLu, S., Seravalli, J., & Harrison-Findik, D. D. (2015) · Transgenic Research · doi:10.1007/s11248-015-9879-3 · Cited by 11
Krumm, C. S., Xu, X., Bare, C. J., Holman, C. D., Kersten, S., Dow, L. E., Lee, A.-H., & Cohen, D. E. (2021) · Journal of Biological Chemistry · doi:10.1016/j.jbc.2021.100815 · Cited by 11
“(2021) 297(1) 100815 16-fold in Tg-rtTA mice after 3 weeks of doxycycline treatment, and this was sustained at 6 weeks (Fig.”
BackgroundInfluentialIron Liposome: A more Effective Iron Supplement for Sports Anemia and Anemia of Inflammation
Yu, P., & Chang, Y. (2015) · Journal of Pharmaceutical Care & Health Systems · doi:10.4172/2376-0419.s4-002 · Cited by 11
Dysregulation in the Unfolded Protein Response in the FGR Rat Pancreas
Liu, X., Guo, Y., Wang, J., Zhu, L., & Gao, L. (2020) · International Journal of Endocrinology · doi:10.1155/2020/5759182 · Cited by 11
“In response to ER stress, Creb3l3 is cleaved by S1P and S2 and translocate into nucleus [36] and transactivates acute phase response (APR) pathway [37] and hepcidin expression in hepatocytes [38, 39].”
BackgroundNew insights into the role of iron in the development of nonalcoholic fatty liver disease†‡
Sharp, P. (2010) · Hepatology · doi:10.1002/hep.23774 · Cited by 11
Iron metabolism in rheumatic diseases
Givian, A., Azizan, A., Jamshidi, A., Mahmoudi, M., & Farhadi, E. (2025) · Journal of Translational Autoimmunity · doi:10.1016/j.jtauto.2025.100267 · Cited by 10
Liu, K., Chen, P.-Y., Wang, C.-M., Chen, W., Chen, C.-W., Owaga, E., & Chang, J. (2015) · Food & Function · doi:10.1039/c5fo01252j · Cited by 10
Messner, D. J., & Kowdley, K. V. (2010) · Hepatology · doi:10.1002/hep.23507 · Cited by 10
Ironing out macrophages in atherosclerosis
Wang, L., Cai, J., Qiao, T., & Li, K. (2022) · Acta Biochimica et Biophysica Sinica · doi:10.3724/abbs.2022196 · Cited by 12
Iron in the inflammed gut: another pro-inflammatory hit?
Weiß, G. (2010) · Gut · doi:10.1136/gut.2010.229047 · Cited by 9
“Although the exact mechanisms are unknown, studies in animal models using systemic Mycobacterium bovis or bacterial lipopolysaccharide have linked depressivelike behaviour to cytokine-induced changes in tryptophan metabolism and production of kynurenine and its metabolites.(9) More relevant to the gastrointestinal tra…”
BackgroundSaito, A., & Imaizumi, K. (2017) · Neurochemistry International · doi:10.1016/j.neuint.2017.06.012 · Cited by 10
Bloomer, S. A., Olivier, A. K., Bergmann, O. M., Mathahs, M. M., Broadhurst, K. A., Hicsasmaz, H., & Brown, K. E. (2016) · Cell Biochemistry and Function · doi:10.1002/cbf.3238 · Cited by 9
A New Wrinkle in the Fold: Hepcidin Links Inflammation to the Unfolded Protein Response
Domenico, I. D., & Kaplan, J. (2009) · Cell Metabolism · doi:10.1016/j.cmet.2009.09.005 · Cited by 9
“Two recent papers have uncovered a new route to hepcidin induction through activation of the unfolded protein response (UPR) in the endoplasmic reticulum (ER) (Oliveira et al., 2009; Vecchi et al., 2009).”
BackgroundCREB3 protein family: the promising therapeutic targets for cardiovascular and metabolic diseases
Gao, Y.-P., Hu, C., Hu, M. S., Dong, W.-S., Li, K., Ye, Y.-J., Hu, Y., & Zhang, X. (2024) · Cell Biology and Toxicology · doi:10.1007/s10565-024-09939-5 · Cited by 8
Healy, S., McMahon, J. M., & FitzGerald, U. (2018) · Frontiers in Neuroscience · doi:10.3389/fnins.2018.00969 · Cited by 8
Paterson, A. C., & Pietrangelo, A. (2011) · Elsevier eBooks · doi:10.1016/b978-0-7020-3398-8.00005-2 · Cited by 9
Self-citationAriyasu, D., Kubo, E., Higa, D., Shibata, S., Takaoka, Y., Sugimoto, M., Imaizumi, K., Hasegawa, T., & Araki, K. (2019) · Endocrinology · doi:10.1210/en.2019-00306 · Cited by 7
REVIEW PAPER An overall view of the process of the regulation of human iron metabolism
Formanowicz, D., & Formanowicz, P. (2014) · Biotechnologia · doi:10.5114/bta.2011.46534 · Cited by 7
“It should also be mentioned that endoplasmic reticulum stress turns on hepcidin transcription via cyclic AMP response element-binding protein H (CREBH) and/or C/EBP homologous protein (CHOP) (Vecchi et al., 2009; Oliveira et al., 2009).”
BackgroundSukumaran, A., Varghese, J., Tamilselvan, J., Jeyaseelan, V., Mani, T., Simpson, R. J., McKie, A. T., & Jacob, M. (2012) · British Journal Of Nutrition · doi:10.1017/s0007114512000189 · Cited by 7
“They activate an endoplasmic reticulum stress response, which in turn modulates hepcidin expression during inflammatory responses((9,10)).”
BackgroundOh, C., Park, S., Kim, J., & Moon, Y. (2016) · Journal of Biological Chemistry · doi:10.1074/jbc.m116.722520 · Cited by 7
Kits for RNA Extraction, Isolation, and Purification
Johnson, M. (2012) · Materials and Methods · doi:10.13070/mm.en.2.201 · Cited by 6
Hepatocyte-specific deletion of peroxisomal protein PEX13 results in disrupted iron homeostasis
Rishi, G., Bhatia, M., Secondes, E. S., Melino, M., Crane, D. I., & Subramaniam, V. N. (2020) · Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease · doi:10.1016/j.bbadis.2020.165882 · Cited by 6
Cellular Stress Responses and Associated Diseases: A Focus on Heat Shock Proteins
Kumari, B. (2025) · Cell Biochemistry and Biophysics · doi:10.1007/s12013-025-01724-3 · Cited by 5
“Circulating HAMP ultimately causes hypoferremia and splenic iron sequestration in mice [57].”
Iron Deficiency Caused by Intestinal Iron Loss—Novel Candidate Genes for Severe Anemia
Huettmann, C., Stelljes, M., Sivalingam, S., Fobker, M., Vrachimis, A., Exler, A., Wenning, C., Wempe, C., Penke, M., Buneß, A., et al. (2021) · Genes · doi:10.3390/genes12121869 · Cited by 5
Molecular characterization of HEPCIDIN-1 (HAMP1) gene in red-bellied pacu (Piaractus brachypomus)
Petano-Duque, J. M., Lozano‐Villegas, K. J., Céspedes-Rubio, Á. E., & Rondón‐Barragán, I. S. (2022) · Developmental & Comparative Immunology · doi:10.1016/j.dci.2022.104353 · Cited by 5
Barbosa, S., Carreira, S., & O’Hare, P. (2017) · Molecular Biology of the Cell · doi:10.1091/mbc.e17-01-0075 · Cited by 5
“…including differentiation-induced ER stress, cytokines, and metabolic fluctuations, are known to promote CREB3 processing (Murakami et al., 2009; Vecchi et al., 2009; Lee et al., 2010, 2011), much less is known about the key protein determinants and regulatory mechanisms controlling their…”
BackgroundInfluentialLaboratory use of hepcidin in renal transplant recipients
Šimetić, L., & Zibar, L. (2016) · Biochemia Medica · doi:10.11613/bm.2016.003 · Cited by 5
“Potential therapeutics for hepcidin regulation and their effect (15, 28, 77-86).”
BackgroundWu, H., Ren, X., Ge, M., Dong, P., Wang, S., Yi, H., Li, X., Huo, J., Zheng, X., Gao, M., et al. (2021) · Blood Science · doi:10.1097/bs9.0000000000000099 · Cited by 4
“It is post-translationally regulated by hepcidin, a peptide hormone synthesized by the liver in response to iron, inflammation, and a variety of stressors.(4,5) Hepcidin binds to the FPN1 cavity and induces the internalization and degradation of FPN1 in lysosomes, leading to a decreased iron efflux into the blood.”
BackgroundPerspective of Inflammation and Inflammation Markers
Johnkennedy, N., & Mercy, O. C. (2022) · Journal La Medihealtico · doi:10.37899/journallamedihealtico.v3i1.620 · Cited by 4
“Also, they could be a sign of liver failure (Vecchi et al., 2009).”
BackgroundEmerging Role of SMILE in Liver Metabolism
Sadasivam, N., Radhakrishnan, K., Choi, H., & Kim, D. (2023) · International Journal of Molecular Sciences · doi:10.3390/ijms24032907 · Cited by 4
“Recently, the regulation of iron metabolism via inflammatory response signals, excess iron levels, ER stress, IL-6 activated transcription factors, and SMILE-mediated transcriptional activity was shown to act by inhibiting hepcidin production [38,69].”
BackgroundActivators and Inhibitors in Cell Biology Research
Dhaliwal, A. (2013) · Materials and Methods · doi:10.13070/mm.en.3.185 · Cited by 4
Wang, C., Chen, Y., Lee, Y., & Chang, J. (2016) · Molecular Nutrition & Food Research · doi:10.1002/mnfr.201600458 · Cited by 4
“An animal study revealed that tunicamycin injections trigger hepcidin and ferritin secretion and cause hypoferremia and iron retention in the spleen and liver [34].”
BackgroundPietrangelo, A., & Torbenson, M. S. (2017) · Elsevier eBooks · doi:10.1016/b978-0-7020-6697-9.00004-2 · Cited by 4
Self-citationJohnson, M. (2013) · Materials and Methods · doi:10.13070/mm.en.3.193 · Cited by 4
Effect of Endoplasmic Reticular Stress on Free Hemoglobin Metabolism and Liver Injury
Tseng, S., Chang, T., Shih, C., Hsieh, R., Chen, C.-W., Chen, Y.-C., Lin, M.-H., & Chang, J. (2018) · International Journal of Molecular Sciences · doi:10.3390/ijms19071977 · Cited by 4
“Our study agrees with Vecchi and colleague’s observation in which that ER stress impairs intracellular iron efflux via altering hepatic hepcidin-ferroportin expression levels [20].”
BackgroundResultExpression of iron regulatory proteins in full‐term swine placenta
Rajamanickam, K., Leela, V., Suganya, G., Basha, S. H., Parthiban, M., Pazhanivel, N., & Gowri, A. M. (2020) · Reproduction in Domestic Animals · doi:10.1111/rda.13730 · Cited by 3
Hepcidin: A multifaceted hormone in iron homeostasis and tumor biology
Liu, X., Zhang, X., Fan, Y., & Tan, K. (2024) · Vitamins and hormones · doi:10.1016/bs.vh.2024.10.003 · Cited by 2
Zhu, F., Ren, L., Cheng, W., Zhou, H., Li, Y., Liu, N., Rong, G., Liu, Y., Yu, P., Lv, J., et al. (2025) · Small · doi:10.1002/smll.202412093 · Cited by 3
Canavesi, E., & Valenti, L. V. C. (2011) · InTech eBooks · doi:10.5772/22735 · Cited by 2
2. Hepcidin: From Discovery to Differential Diagnosis.
Tomosugi, N. (2010) · Nihon Naika Gakkai Zasshi · doi:10.2169/naika.99.1180 · Cited by 2
CREBH Determines the Severity of Sulpyrine-Induced Fatal Shock
Kamiyama, N., Yamamoto, M., Saiga, H., Su, J., Ohshima, J., Machimura, S., Sasai, M., Kimura, T., Ueda, Y., Kayama, H., et al. (2013) · PLoS ONE · doi:10.1371/journal.pone.0055800 · Cited by 1
Qiao, J., Wang, X., Zhou, C., Li, C., Pang, Y., Li, Q., Luan, Y., & Gou, M. (2025) · Probiotics and Antimicrobial Proteins · doi:10.1007/s12602-025-10654-8 · Cited by 1
Dermatitis herpetiformis, celiac disease and their impact on women and their families
Shahid, M., Mariotti, E. B., Drenovska, K., Vassileva, S., Aimo, C., di Calabria, V. R., Quintarelli, L., Magnatta, A., LANDINI, S., Donati, M., et al. (2025) · Italian Journal of Dermatology and Venereology · doi:10.23736/s2784-8671.25.08178-2 · Cited by 1
Metabolism of Iron Ions and Its Role in Regulating the Functions of Immune System Cells
Orlova, E. G., & Gorbunova, O. L. (2026) · Journal of Evolutionary Biochemistry and Physiology · doi:10.1134/s0022093026020018 · Cited by 1
Pharmaconutrition としての微量元素・ビタミン投与の是非
智, 村., 和彦, 深., & 安原, 洋. (2017) · The Japanese Journal of SURGICAL METABOLISM and NUTRITION · doi:10.11638/jssmn.51.6_339 · Cited by 1
Pietrangelo, A. (2018) · Elsevier eBooks · doi:10.1016/b978-0-323-37591-7.00060-4 · Cited by 1
Self-citationMoreau, R., Fernández, J., Altieri, M. H., & Arroyo, V. (2023) · Elsevier eBooks · doi:10.1016/b978-0-12-817394-7.00008-5 · Cited by 1
CREB-H is a stress-regulator of hepcidin gene expression during early postnatal development
Vecchi, C., Montosi, G., Garuti, C., Canali, S., Sabelli, M., Bergamini, E., Ricci, A., Buzzetti, E., Corradini, E., & Pietrangelo, A. (2023) · Journal of Molecular Medicine · doi:10.1007/s00109-023-02344-1 · Cited by 1
Self-citationJohnson, M. (2012) · Materials and Methods · doi:10.13070/mm.pt.2.115 · Cited by 1
Fe Deficiency, Dietary Bioavailability and Absorption
Tako, E. (2018) · MDPI eBooks · doi:10.3390/books978-3-03897-231-0 · Cited by 1
Pietrangelo, A., & Torbenson, M. S. (2023) · Elsevier eBooks · doi:10.1016/b978-0-7020-8228-3.00004-1 · Cited by 1
Self-citationVecchi, C., & Pietrangelo, A. (2015) · Wiley eBooks · doi:10.1002/9781118663387.ch29 · Cited by 1
Self-citationA Glimpse of Future Hepatitis C Virus Treatment Paradigms
Terrault, N. A., & Khalili, M. (2010) · Hepatology · doi:10.1002/hep.23523 · Cited by 1
Iron Homeostasis: Hepcidin Regulation
Camaschella, C., & Silvestri, L. (2004) · Wiley eBooks · doi:10.1002/9781119951438.eibc2131
Prohepcidin and Hepcidin in Acute Phase Reaction Accompanying Large Cardiac Surgery
Maruna, P., Vokurka, M., & Lindner, J. (2012) · InTech eBooks · doi:10.5772/22324
“Apart from those factors also endoplasmic reticulum stress can induce hepcidin expression (Vecchi et al., 2009).”
BackgroundRegulation of hepcidin and iron homeostasis: progress and prospects
Barrios, M. F., Delgado, N. F., & Hernández-Ramírez, P. (2012) · Revista cubana de hematología, inmunología y hemoterapia
Role Of Crebh In Endotoxin Mediated Modulation Of Hepatic Metabolism
Dandekar, A. P. (2015) · Human Biology
Iron transport and liver injury in mouse models of hereditary haemochromatosis
De Lima, R. (2013) · UWA Profiles and Research Repository (University of Western Australia)
Coelho, D. S. (2013) · Portuguese National Funding Agency for Science, Research and Technology (RCAAP Project by FCT)
Johnson, M. (2012) · Materials and Methods · doi:10.13070/mm.fr.2.115
Johnson, M. (2012) · Materials and Methods · doi:10.13070/mm.ru.2.115
Hypoxia-Dependent Hepcidin Down-Regulation: In Vitro and In Vivo Studies
Ravasi, G. (2016) · BOA (University of Milano-Bicocca)
Possible Role for Hepcidin in Acute Neuroleptic Malignant Syndrome
Gurrera, R. J. (2016) · Brain Disorders & Therapy · doi:10.4172/2168-975x.1000216
“Notably, hepcidin is also strongly induced by interleukin [6,14] which may act synergistically with endoplasmic reticulum stress to increase hepcidin levels further.”
BackgroundIN TRANSLATION Molecular Mechanisms of Hepcidin Regulation: Implications for the Anemia of CKD
Babitt, J. L., & Lin, H. Y.-F. (2010)
TG could Modulate FPN1 in MES 23.5 Cells by Hepcidin
jun, L. Q. (2018) · International Journal of Sciences · doi:10.18483/ijsci.1805
Decreased Activity of the Ghrhr and Gh Promoters Causes Dominantly Inherited GH DeficiencyPreprint
Ariyasu, D., Kubo, E., Higa, D., Shibata, S., Takaoka, Y., Sugimoto, M., Imaizumi, K., Hasegawa, T., & Araki, K. (2019) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/545384
Velaga, R. M. (2014) · London Met Repository (London Metropolitan University)
Impact of the UPR on the expression of relevant genes for cellular iron metabolism
Oliveira, S. J. (2011)
Nelson, J. E., Trinder, D., & Kowdley, K. V. (2010) · Molecular pathology library · doi:10.1007/978-1-4419-7107-4_44
Hepcidin gene expression and biochemical changes in high fat diet induced albino rats
(2016) · Egyptian Journal of Pure and Applied Science · doi:10.21608/ejaps.2016.184573
β-TrCP-mediated ubiquitination and degradation of liver-enriched transcription factor CREB-H
Cheng, Y. (2016) · The HKU Scholars Hub (University of Hong Kong) · doi:10.5353/th_b5816255
Johnson, M. (2012) · 实验材料和方法 · doi:10.13070/mm.cn.2.115
Alfaro-Magallanes, V. M. (2022) · UPM Digital Archive (Technical University of Madrid) · doi:10.20868/upm.thesis.71841
Non-canonical Endoplasmic Reticulum Stress Transducers CREB3 family in cancer and other diseasesPreprint
Han, Y., Li, Z., Cao, Z., Sun, J., & Zhang, J. (2023) · doi:10.22541/au.169596013.37916020/v1
Metadata
- Authors
- Vecchi, C., Montosi, G., Zhang, K., Lamberti, I., Duncan, S. A., Kaufman, R. J., & Pietrangelo, A.
- Affiliations
- Azienda Ospedaliero-Universitaria di Modena (IT)
- Wayne State University (US)
- Medical College of Wisconsin (US)
- Howard Hughes Medical Institute (US)
- Corresponding author
- Pietrangelo, Antonello
- Venue
- Science
- Published
- 2009-08-14
- Volume
- 325
- Issue
- 5942
- Pages
- 877-880
- ISSN
- 0036-8075 (ISSN-L)
- 1095-9203
- PMC
- PMC2923557
- OpenAlex
- W2017168923
- Cited by
- 310
- References
- 26
- Citations by year
- 2026: 2 · 2025: 8 · 2024: 5 · 2023: 14 · 2022: 8 · 2021: 16 · 2020: 15 · 2019: 11 · 2018: 20 · 2017: 18 · 2016: 19 · 2015: 30 · 2014: 27 · 2013: 28 · 2012: 30
- FWCI
- 19.48
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Locations
- Science (publishedVersion)
- PubMed (publishedVersion)
- PubMed Central (acceptedVersion)
- IRIS UNIMORE (University of Modena and Reggio Emilia) (submittedVersion, cc-by)
- Funders
- Howard Hughes Medical Institute
- National Heart, Lung, and Blood Institute (HL 52173, R01HL052173, P01HL057346)
- National Institute of Mental Health (R03MH089782)
- National Institute of Diabetes and Digestive and Kidney Diseases (R01DK042394, DK42394, R37DK042394)
- Topics
- Health Sciences › Medicine › Hematology › Iron Metabolism and Disorders
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Cell Biology › Endoplasmic Reticulum Stress and Disease
- Health Sciences › Medicine › Hematology › Erythropoietin and Anemia Treatment
- Keywords
- endoplasmic reticulum stress, hepcidin, iron homeostasis, CREBH, unfolded protein response, protein quality control, innate immunity, hypoferremia, anemia of chronic disease, hemochromatosis, transcriptional regulation
- MeSH terms
- Animals, Endoplasmic Reticulum, Homeostasis, Humans, Immunity, Innate, Iron, Liver, Mutation, Promoter Regions, Genetic, Spleen, Stress, Physiological, Transcriptional Activation, 3T3 Cells, Cyclic AMP Response Element-Binding Protein, Protein Folding, Mice, Knockout, Antimicrobial Cationic Peptides, RNA Interference, Cell Line, Tumor, Mice, Hepcidins
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
