The DOI matches its Crossref record; 54 of the 54 references it cites were found in a registry or an index.
Mechanisms of Increased Resistance to Chlorhexidine and Cross-Resistance to Colistin following Exposure of Klebsiella pneumoniae Clinical Isolates to Chlorhexidine
Open accessAbstract
Klebsiella pneumoniae is an opportunistic pathogen that is often difficult to treat due to its multidrug resistance (MDR). We have previously shown that K. pneumoniae strains are able to “adapt” (become more resistant) to the widely used bisbiguanide antiseptic chlorhexidine. Here, we investigated the mechanisms responsible for and the phenotypic consequences of chlorhexidine adaptation, with particular reference to antibiotic cross-resistance. In five of six strains, adaptation to chlorhexidine also led to resistance to the last-resort antibiotic colistin. Here, we show that chlorhexidine adaptation is associated with mutations in the two-component regulator phoPQ and a putative Tet repressor gene ( smvR ) adjacent to the major facilitator superfamily (MFS) efflux pump gene, smvA . Upregulation of smvA (10- to 27-fold) was confirmed in smvR mutant strains, and this effect and the associated phenotype were suppressed when a wild-type copy of smvR was introduced on plasmid pACYC. Upregulation of phoPQ (5- to 15-fold) and phoPQ -regulated genes, pmrD (6- to 19-fold) and pmrK (18- to 64-fold), was confirmed in phoPQ mutant strains. In contrast, adaptation of K. pneumoniae to colistin did not result in increased chlorhexidine resistance despite the presence of mutations in phoQ and elevated phoPQ , pmrD , and pmrK transcript levels. Insertion of a plasmid containing phoPQ from chlorhexidine-adapted strains into wild-type K. pneumoniae resulted in elevated expression levels of phoPQ , pmrD , and pmrK and increased resistance to colistin, but not chlorhexidine. The potential risk of colistin resistance emerging in K. pneumoniae as a consequence of exposure to chlorhexidine has important clinical implications for infection prevention procedures.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Indeed, AMR has become one of the major threats to human health, emerging and spreading, particularly in hospital environments, as a result of the selective pressures exerted by the widespread use of disinfectants and antibiotics in these settings [16].”
From Profiling the resistome and virulome of Bacillus strains used for probiotic-based sanitation: a multicenter WGS analysis (2025) · cites this paper as [16]
Experimental — accuracy not yet measured
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
Trimmomatic: a flexible trimmer for Illumina sequence data
Bolger, A. M., Lohse, M., & Usadel, B. (2014) · Bioinformatics · doi:10.1093/bioinformatics/btu170 · Cited by 65,548
The Sequence Alignment/Map format and SAMtools
Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R., & 1000 Genome Project Data Processing Subgroup (2009) · Bioinformatics · doi:10.1093/bioinformatics/btp352 · Cited by 62,041
Fast and accurate short read alignment with Burrows-Wheeler transform
Li, H., & Durbin, R. (2009) · Bioinformatics · doi:10.1093/bioinformatics/btp324 · Cited by 58,607
The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data
McKenna, A., Hanna, M., Banks, E., Sivachenko, A., Cibulskis, K., Kernytsky, A., Garimella, K., Altshuler, D., Gabriel, S., Daly, M., et al. (2010) · Genome Research · doi:10.1101/gr.107524.110 · Cited by 27,895
SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing
Bankevich, A., Nurk, S., Antipov, D., Gurevich, A. A., Dvorkin, M. V., Kulikov, A. S., Lesin, V. M., Nikolenko, S., Pham, S., Prjibelski, A. D., et al. (2012) · Journal of Computational Biology · doi:10.1089/cmb.2012.0021 · Cited by 26,312
Antiseptics and Disinfectants: Activity, Action, and Resistance
McDonnell, G. E., & Russell, A. D. (1999) · Clinical Microbiology Reviews · doi:10.1128/cmr.12.1.147 · Cited by 4,795
The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2016 update
Afgan, E., Baker, D., van den Beek, M., Blankenberg, D. J., Bouvier, D., Čech, M., Chilton, J. M., Clements, D., Coraor, N., Eberhard, C., et al. (2016) · Nucleic Acids Research · doi:10.1093/nar/gkw343 · Cited by 2,150
Yigit, H., Queenan, A. M., Anderson, G. J., Domenech-Sanchez, A., Biddle, J. W., Steward, C. D., Alberti, S., Bush, K., & Tenover, F. C. (2001) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.45.4.1151-1161.2001 · Cited by 1,639
Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria
Olaitan, A. O., Morand, S., & Rolain, J. (2014) · Frontiers in Microbiology · doi:10.3389/fmicb.2014.00643 · Cited by 1,403
Lipid A Modification Systems in Gram-Negative Bacteria
Raetz, C. R. H., Reynolds, C. M., Trent, M. S., & Bishop, R. E. (2007) · Annual Review of Biochemistry · doi:10.1146/annurev.biochem.76.010307.145803 · Cited by 1,371
Flagged first, then by citations
Cited by
Sorted by citations
Jutkina, J., Marathe, N. P., Flach, C.-F., & Larsson, D. G. J. (2018) · Science of The Total Environment · doi:10.1016/j.scitotenv.2017.10.312 · Cited by 381
Resistance Toward Chlorhexidine in Oral Bacteria – Is There Cause for Concern?
Cieplik, F., Jakubovics, N. S., Buchalla, W., Maisch, T., Hellwig, E., & Al-Ahmad, A. (2019) · Frontiers in Microbiology · doi:10.3389/fmicb.2019.00587 · Cited by 424
Co-selection for antibiotic resistance by environmental contaminants
Murray, L. M., Hayes, A., Snape, J., Kasprzyk‐Hordern, B., Gaze, W. H., & Murray, A. K. (2024) · npj Antimicrobials and Resistance · doi:10.1038/s44259-024-00026-7 · Cited by 366
Shi, X., Xia, Y., Wei, W., & Ni, B. (2022) · Water Research · doi:10.1016/j.watres.2022.119060 · Cited by 297
Disinfectants and antiseptics: mechanisms of action and resistance
Maillard, J., & Pascoe, M. (2023) · Nature Reviews Microbiology · doi:10.1038/s41579-023-00958-3 · Cited by 287
“These include analysing the effects of biocides on membrane integrity of live cells or vesicles and liposomes through the use of microscopy, the uptake of substrates (for example, fluorescent dyes or particles) and the leakage of cellular components (for example,”
BackgroundThe Potential of Human Peptide LL-37 as an Antimicrobial and Anti-Biofilm Agent
Ridyard, K. E., & Overhage, J. (2021) · Antibiotics · doi:10.3390/antibiotics10060650 · Cited by 283
“To kill bacteria, chlorhexidine targets membrane fluidity, which results in the loss of structural integrity of the membrane [96].”
BackgroundBiocidal Agents Used for Disinfection Can Enhance Antibiotic Resistance in Gram-Negative Species
Kampf, G. (2018) · Antibiotics · doi:10.3390/antibiotics7040110 · Cited by 230
Lepelletier, D., Maillard, J., Pozzetto, B., & Simon, A. (2020) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.00682-20 · Cited by 219
“59% when introduced into decolonization protocol in orthopedic surgery (93) ● One study found that in mupirocin-resistant MRSA, the rate of qacA/B gene was 65% and smr gene was 71% (83) ● Reports of cross-resistance to antibiotics (92) ● No significant difference in incidence of SSI between topical 2% CHG (36 [0.”
BackgroundDisinfection spreads antimicrobial resistance
Lu, J., & Guo, J. (2021) · Science · doi:10.1126/science.abg4380 · Cited by 195
Infectious Disease Management and Control with Povidone Iodine
Eggers, M. (2019) · Infectious Diseases and Therapy · doi:10.1007/s40121-019-00260-x · Cited by 170
Relationships Between Oral Microecosystem and Respiratory Diseases
Dong, J., Li, W., Wang, Q., Chen, J., Zu, Y., Zhou, X., & Guo, Q. (2022) · Frontiers in Molecular Biosciences · doi:10.3389/fmolb.2021.718222 · Cited by 151
Rozman, U., Pušnik, M., Kmetec, S., Duh, D., & Turk, S. Š. (2021) · Microorganisms · doi:10.3390/microorganisms9122550 · Cited by 150
Food processing as a risk factor for antimicrobial resistance spread along the food chain
Alexa, E. A., Likotrafiti, E., Álvarez-Molina, A., et al. (2018) · Current Opinion in Food Science · doi:10.1016/j.cofs.2018.09.002 · Cited by 136
“[38] Klebsiella pneumoniae Chlorhexidine Colistin Serial inoculation (up to 6 passages) in the presence of the biocide.”
BackgroundVenter, H., Henningsen, M. L., & Neville, S. L. (2017) · Essays in Biochemistry · doi:10.1042/ebc20160053 · Cited by 138
Bhardwaj, P., Hans, A., Ruikar, K., Guan, Z., & Palmer, K. L. (2017) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.01235-17 · Cited by 123
“It was recently reported that 69 colistin resistance emerged in the Gram-negative pathogen Klebsiella pneumoniae after 70 exposure to CHX (23).”
BackgroundBiocide-Induced Emergence of Antibiotic Resistance in Escherichia coli
Pereira, B. M. P., Wang, X., & Tagkopoulos, I. (2021) · Frontiers in Microbiology · doi:10.3389/fmicb.2021.640923 · Cited by 120
Better together– Salmonella biofilm-associated antibiotic resistance
Aleksandrowicz, A., Carolak, E., Dutkiewicz, A., Błachut, A., Waszczuk, W., & Grzymajło, K. (2023) · Gut Microbes · doi:10.1080/19490976.2023.2229937 · Cited by 116
“Salmonella, it was demonstrated that chlorhexidine resulted in significantly higher transcript levels of narU (5-fold).(108) During nutritional deprivation or extremely slow growth, NarU, which is abundant in the stationary phase, confers a selection advantage.”
BackgroundAddressing the challenges in antisepsis: focus on povidone iodine
Barreto, R. T., Barrois, B., Lambert, J. R., et al. (2020) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2020.106064 · Cited by 110
Amsalu, A., Sapula, S. A., Lopes, M. D. B., Hart, B. J., Nguyen, A. H., Drigo, B., Turnidge, J. D., Leong, L. E. X., & Venter, H. (2020) · Microorganisms · doi:10.3390/microorganisms8111647 · Cited by 116
“Biocides are also frequently used in mass-marketed household products, which could lead to the development of resistance and have severe consequences for their clinical usefulness [75,76]”
BackgroundCaselli, E., Brusaferro, S., Coccagna, M., Arnoldo, L., Berloco, F., Antonioli, P., Tarricone, R., Pelissero, G., Nola, S., La Fauci, V., et al. (2018) · PLOS ONE · doi:10.1371/journal.pone.0199616 · Cited by 101
“Control of surface contamination has been so far approached by conventional chemical-based sanitation, which has limitations, as it cannot prevent recontamination phenomena [16–19], has an high environmental impact, and can contribute to selection of disinfectant-resistant and even antibiotic-resistant pathogens [20,…”
BackgroundMCR: modern colistin resistance
Caniaux, I., van Belkum, A., Zambardi, G., et al. (2016) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-016-2846-y · Cited by 98
Zielińska, S., Wójciak, M., Dziągwa-Becker, M., et al. (2019) · Toxins · doi:10.3390/toxins11070406 · Cited by 93
“An increased resistance to chlorhexidine antiseptic and cross-resistance to colistin antibiotic following exposure to chlorhexidine in Klebsiella pneumoniae is one of the most studied examples of such a phenomenon [32].”
BackgroundAntibiotic Heteroresistance in Klebsiella pneumoniae
Stojowska‐Swędrzyńska, K., Łupkowska, A., Kuczyńska‐Wiśnik, D., & Laskowska, E. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms23010449 · Cited by 87
D’Accolti, M., Soffritti, I., Mazzacane, S., & Caselli, E. (2019) · International Journal of Molecular Sciences · doi:10.3390/ijms20071535 · Cited by 82
“Selected strains can become resistant not only toward the disinfectant itself but also, more importantly, against antimicrobial drugs, as recently reported for the disinfectant chlorhexidine, capable of inducing resistance against the antibiotic colistin [25].”
BackgroundDevelopment of antiseptic adaptation and cross-adapatation in selected oral pathogens in vitro
Verspecht, T., Herrero, E. R., Khodaparast, L., Khodaparast, L., Boon, N., Bernaerts, K., Quirynen, M., & Teughels, W. (2019) · Scientific Reports · doi:10.1038/s41598-019-44822-y · Cited by 80
Bourrel, A. S., Poirel, L., Royer, G., Mercier-Darty, M., Vuillemin, X., Kieffer, N., Clermont, O., Denamur, É., Nordmann, P., Decousser, J., et al. (2019) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dkz090 · Cited by 78
Mouthwash Effects on the Oral Microbiome: Are They Good, Bad, or Balanced?
Brookes, Z. L. S., Teoh, L., Cieplik, F., & Kumar, P. (2023) · International Dental Journal · doi:10.1016/j.identj.2023.08.010 · Cited by 90
“> Wand et al 89 showed that isolates of the opportunistic pathogen Klebsiella pneumoniae can develop resistance to chlorhexidine through sharing mechanisms that correlate with colistin resistance, the last-resort antibiotic, as well as vancomycin.”
BackgroundBacteriophages as a Potential 360-Degree Pathogen Control Strategy
D’Accolti, M., Soffritti, I., Mazzacane, S., & Caselli, E. (2021) · Microorganisms · doi:10.3390/microorganisms9020261 · Cited by 78
“Importantly, phages could also target MDR bacteria, which are also often resistant to disinfectants [49,100].”
BackgroundGiacometti, F., Shirzad‐Aski, H., & Ferreira, S. M. P. (2021) · Antibiotics · doi:10.3390/antibiotics10060671 · Cited by 77
“In contrast, LPS-related changes in phageresistant mutants may reduce the expression of OmpF, tetracycline’ uptake porin, and lead to negative consequences in pathogenic bacterial populations by increasing tetracycline resistance [131,144].”
BackgroundInfluentialAugmented dissemination of antibiotic resistance elicited by non-antibiotic factors
Zhu, S., Yang, B., Wang, Z., & Liu, Y. (2023) · Ecotoxicology and Environmental Safety · doi:10.1016/j.ecoenv.2023.115124 · Cited by 77
Roedel, A., Dieckmann, R., Brendebach, H., et al. (2019) · Applied and Environmental Microbiology · doi:10.1128/aem.01253-19 · Cited by 75
Chlorhexidine Resistance or Cross-Resistance, That Is the Question
Abbood, H. M., Hijazi, K., & Gould, I. M. (2023) · Antibiotics · doi:10.3390/antibiotics12050798 · Cited by 72
“pneumoniae, there have been reports of cross-resistance between CHX and colistin used for the treatment of carbapenem-resistant infections [89,92].”
BackgroundBiocide Selective TolC-Independent Efflux Pumps in Enterobacteriaceae
Slipski, C. J., Zhanel, G. G., & Bay, D. C. (2017) · The Journal of Membrane Biology · doi:10.1007/s00232-017-9992-8 · Cited by 72
“…Enterobacteriaceae is particularly concerning, since biocide resistance has demonstrated cross-resistance to a variety of antimicrobials (Chapman 2003b; Braoudaki and Hilton 2004; Gnanadhas et al. 2013), including polymyxins (Wand et al. 2017), which may represent a last line of defense.”
BackgroundHygiene: microbial strategies to reduce pathogens and drug resistance in clinical settings
Caselli, E. (2017) · Microbial Biotechnology · doi:10.1111/1751-7915.12755 · Cited by 71
“tance against Colistin (Wand et al., 2017), an antibiotic considered till 2016 as a last-resort drug for treatment of infections sustained by multidrug-resistant (MDR) Gram-”
BackgroundInfluentialVijayakumar, R., Sandle, T., Al-Aboody, M. S., AlFonaisan, M. K., Alturaiki, W., Mickymaray, S., Premanathan, M., & Alsagaby, S. A. (2018) · Journal of Infection and Public Health · doi:10.1016/j.jiph.2018.05.011 · Cited by 71
Temperature Stability and Effectiveness of Plasma-Activated Liquids over an 18 Months Period
Tsoukou, E., Bourke, P., & Boehm, D. (2020) · Water · doi:10.3390/w12113021 · Cited by 68
Colistin Resistance and Management of Drug Resistant Infections
Sharma, J., Sharma, D., Singh, A., & Kumari, S. (2022) · Canadian Journal of Infectious Diseases and Medical Microbiology · doi:10.1155/2022/4315030 · Cited by 68
“, colistin/polymyxins due to the emergence and rapid spread of particular strains of carbapenemase-producing bacteria [2].”
BackgroundSousa, M., Machado, I., Simões, L. C., & Simões, M. V. (2025) · Environmental Science and Ecotechnology · doi:10.1016/j.ese.2025.100557 · Cited by 72
“A study by Wand et al. [101] demonstrated that, when exposed to chlorhexidine, Klebsiella pneumoniae acquired cross-resistance to the antibiotic colistin.”
Sonnevend, Á., Ghazawi, A., Hashmey, R., et al. (2017) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.00418-17 · Cited by 63
“pneumoniae isolates, and the level of chlorhexidine nonsusceptibility did not reach the levels noted in that study (21).”
BackgroundTopical Antiseptic Formulations for Skin and Soft Tissue Infections
Hoang, T. P. N., Ghori, M. U., & Conway, B. R. (2021) · Pharmaceutics · doi:10.3390/pharmaceutics13040558 · Cited by 60
Vieira, A. P. M., Arias, L. S., Neto, F. N. D. S., et al. (2018) · Colloids and Surfaces B Biointerfaces · doi:10.1016/j.colsurfb.2018.11.023 · Cited by 58
Cluster-Randomized Trial of Devices to Prevent Catheter-Related Bloodstream Infection
Brunelli, S. M., Wyck, D. B. V., Njord, L., et al. (2018) · Journal of the American Society of Nephrology · doi:10.1681/asn.2017080870 · Cited by 57
“34 per 1000 CVC-days in ClearGuard versus Liu meta-analysis, respectively), but with several advantages: (1) ClearGuard antimicrobial is confined proximally to the CVC clamp, thus being prevented from entering the bloodstream as occurs with antimicrobial lock solutions18,19; (2) ClearGuard dose is fixed, thus eliminat…”
BackgroundResultInfluentialHashemi, M., Holden, B., Coburn, J., Taylor, M., Weber, S., Hilton, B., Zaugg, A. L., McEwan, C. M., Carson, R. H., Andersen, J. L., et al. (2019) · Frontiers in Microbiology · doi:10.3389/fmicb.2019.00210 · Cited by 57
“Additionally, recent studies found that various clinical isolates of Klebsiella pneumoniae, from before and after the widespread use of chlorhexidine, show a significant difference in susceptibility to the antimicrobial (Bock et al., 2016; Wand et al., 2017).”
BackgroundShein, A. M. S., Wannigama, D. L., Higgins, P. G., Hurst, C. P., Abe, S., Hongsing, P., Chantaravisoot, N., Saethang, T., Luk-in, S., Liao, T., et al. (2022) · Scientific Reports · doi:10.1038/s41598-022-17083-5 · Cited by 57
Exploring the Hospital Microbiome by High-Resolution 16S rRNA Profiling
Rampelotto, P. H., Sereia, A. F. R., de Oliveira, L. F. V., & Margis, R. (2019) · International Journal of Molecular Sciences · doi:10.3390/ijms20123099 · Cited by 61
“In addition, disinfectants can select resistant bacterial strains against themselves and also against antibiotics [42], which has been recently reported for chlorhexidine induction of resistance against Colistin [43], an antibiotic considered, until 2016, as a last-resort drug for treatment of infections sustained by…”
BackgroundDydak, K., Junka, A., Dydak, A., Brożyna, M., Paleczny, J., Fijałkowski, K., Kubielas, G., Aniołek, O., & Bartoszewicz, M. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22083996 · Cited by 57
Klassert, T. E., Zubiría-Barrera, C., Neubert, R., Stock, M., Schneegans, A., López, M., Driesch, D., Zakonsky, G., Gastmeier, P., Slevogt, H., et al. (2022) · Clinical Microbiology and Infection · doi:10.1016/j.cmi.2022.02.032 · Cited by 58
Spread of mcr-1–Driven Colistin Resistance on Hospital Surfaces, Italy
Caselli, E., D’Accolti, M., Soffritti, I., Piffanelli, M., & Mazzacane, S. (2018) · Emerging infectious diseases · doi:10.3201/eid2409.171386 · Cited by 52
D’Accolti, M., Soffritti, I., Piffanelli, M., Bisi, M., Mazzacane, S., & Caselli, E. (2018) · Infection and Drug Resistance · doi:10.2147/idr.s170071 · Cited by 53
“20,21 This last aspect, in particular, represents a highly undesirable side effect of chemical cleaning, as MDR pathogens have been constantly and rapidly growing in the recent decades and a high proportion of HAIs is currently sustained by them.”
BackgroundBock, L. J., Hind, C. K., Sutton, J. M., & Wand, M. E. (2018) · Letters in Applied Microbiology · doi:10.1111/lam.12863 · Cited by 50
“2016) and that this adaptation may lead to increased resistance to antibiotics (Bhardwaj et al. 2016; Buffet-Bataillon et al. 2016; Vijayakumar et al. 2016b; Wand et al. 2017).”
BackgroundSelf-citationWand, M. E., Jamshidi, S., Bock, L. J., Rahman, K. M., & Sutton, J. M. (2019) · Scientific Reports · doi:10.1038/s41598-018-37730-0 · Cited by 53
Self-citationden Poel, B. V., Saegeman, V., & Schuermans, A. (2022) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-022-04403-w · Cited by 48
“pneumoniae isolates to CHG exposure led to an increase of MIC values for colistin from 2 to 4 mg/L to > 64 mg/L [27].”
BackgroundBiofilms as protective cocoons against biocides: from bacterial adaptation to One Health issues
Charron, R., Boulanger, M., Briandet, R., & Bridier, A. (2023) · Microbiology · doi:10.1099/mic.0.001340 · Cited by 51
Valentin, E., Bottomley, A. L., Chilambi, G. S., Harry, E. J., Amal, R., Sotiriou, G. A., Rice, S. A., & Gunawan, C. (2019) · Nanoscale · doi:10.1039/c9nr08424j · Cited by 48
Buxser, S. E. (2021) · PLoS ONE · doi:10.1371/journal.pone.0256336 · Cited by 48
“pneumoniae isolated in the 1940s and 1950s prior to the widespread use of antibiotics [32, 33], were compared to more recently isolated strains [34].”
ResultEger, E., Schwabe, M., Schulig, L., Hübner, N., Bohnert, J. A., Bornscheuer, U. T., Heiden, S. E., Müller, J. U., Adnan, F., Becker, K., et al. (2022) · Microbiology Spectrum · doi:10.1128/spectrum.00148-22 · Cited by 48
“It is well known that cross-resistance (48) and collateral sensitivity (49) may accompany”
BackgroundMao, X., Hiergeist, A., Auer, D. L., Scholz, K. J., Muehler, D., Hiller, K., Maisch, T., Buchalla, W., Hellwig, E., Gessner, A., et al. (2022) · Frontiers in Microbiology · doi:10.3389/fmicb.2022.934525 · Cited by 47
“Furthermore, selection pressure due to antiseptic treatment may lead to selection of antibiotic-resistant strains (Wand et al., 2017; Verspecht et al., 2019).”
BackgroundAnforderungen an die Hygiene bei der Reinigung und Desinfektion von Flächen
KRINKO (2022) · Bundesgesundheitsblatt - Gesundheitsforschung - Gesundheitsschutz · doi:10.1007/s00103-022-03576-1 · Cited by 55
Krämer, A., Lexow, F., Bludau, A., Köster, A. M., Misailovski, M., Seifert, U., Eggers, M., Rutala, W. A., Dancer, S. J., & Scheithauer, S. (2024) · Clinical Microbiology Reviews · doi:10.1128/cmr.00186-23 · Cited by 47
Risk Factors for Colistin Resistance among Gram-Negative Rods and Klebsiella pneumoniae Isolates
Richter, S. E., Miller, L. G., Uslan, D. Z., Bell, D. S., Watson, K., Humphries, R. M., & McKinnell, J. A. (2018) · Journal of Clinical Microbiology · doi:10.1128/jcm.00149-18 · Cited by 49
“13–15, 21, 23), prior treatment with colistin (18, 21, 23, 24), exposure to chlorhexidine (25), the presence of multiple comorbidities in the patients (21, 22), and increasing age, male sex, length of hospitalization, and the presence of indwelling urinary catheters (22).”
BackgroundIs Chlorhexidine in Dentistry an Ally or a Foe? A Narrative Review
Pałka, Ł., Nowakowska-Toporowska, A., & Dalewski, B. (2022) · Healthcare · doi:10.3390/healthcare10050764 · Cited by 54
“The reason for the recent increase in papers regarding this topic has been connected with the reported emergence of Gram-negative bacteria resistant to colistin, which is a last resort antibiotic after exposure to CHX [5,6].”
BackgroundThe oral microbiome, nitric oxide and exercise performance
Bryan, N. S., Burleigh, M. C., & Easton, C. (2022) · Nitric Oxide · doi:10.1016/j.niox.2022.05.004 · Cited by 46
Schwarz, S. R., Hirsch, S., Hiergeist, A., Kirschneck, C., Muehler, D., Hiller, K., Maisch, T., Al‐Ahmad, A., Gessner, A., Buchalla, W., et al. (2020) · Clinical Oral Investigations · doi:10.1007/s00784-020-03613-w · Cited by 45
Zhang, J., Cheng, L., Li, H., Chen, X., Zhang, L., Shan, T., Wang, J., Chen, D., Shen, J., Zhou, X., et al. (2024) · The Science of The Total Environment · doi:10.1016/j.scitotenv.2024.178020 · Cited by 47
Berglund, B. (2019) · Infectious Microbes & Diseases · doi:10.1097/im9.0000000000000002 · Cited by 43
Chlorhexidine leads to the evolution of antibiotic-resistant Pseudomonas aeruginosa
TagElDein, M. A., Yassin, A. S., El‐Tayeb, O. M., & Kashef, M. T. (2021) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-021-04292-5 · Cited by 43
Kampf, G. (2019) · Microbial Cell · doi:10.15698/mic2019.07.683 · Cited by 41
“pneumoniae 6 clinical strains with a variety of antibiotic resistance markers 6 passages of 2 days at various concentrations 4fold – 16fold 512 Stable for 10 d Cross-resistance*** to colistin (6 strains); no cross-adaptation to BAC, octenidine, hexadecylpyridinium chloride monohydrate and ethanol [16]”
BackgroundThe antiseptic Miramistin: a review of its comparative in vitro and clinical activity
Osmanov, A., Farooq, Z., Richardson, M. D., & Denning, D. W. (2020) · FEMS Microbiology Reviews · doi:10.1093/femsre/fuaa012 · Cited by 42
“Another example is chlorhexidine cross-resistance with sulfamethoxazole, ceftazidime, tetracycline, cefotaxime, and imipenem (Braoudaki and Hilton 2004; Pumbwe, Skilbeck and Wexler 2007; Knapp et al. 2013; Wand et al. 2017).”
BackgroundD’Accolti, M., Soffritti, I., Bini, F., Mazziga, E., Mazzacane, S., & Caselli, E. (2022) · Microorganisms · doi:10.3390/microorganisms10020225 · Cited by 39
“Cross-resistance to antibiotics was also found with triclosan, octenidine, sodium hypochlorite, and didecyldimethylammonium chloride [3,7].”
BackgroundInfluentialPulsed UV as a potential surface sanitizer in food production processes to ensure consumer safety
Garvey, M., & Rowan, N. J. (2019) · Current Opinion in Food Science · doi:10.1016/j.cofs.2019.03.003 · Cited by 38
Hijazi, K., Joshi, C., & Gould, I. M. (2019) · Expert Review of Anti-infective Therapy · doi:10.1080/14787210.2019.1640602 · Cited by 45
“the effect of biocides on the emergence and spread of AMR [44,45].”
BackgroundSix Extensively Drug-Resistant Bacteria in an Injured Soldier, Ukraine
McGann, P., Lebreton, F., Jones, B. T., et al. (2023) · Emerging infectious diseases · doi:10.3201/eid2908.230567 · Cited by 37
“Colistin resistance likely resulted from a previously characterized E82K mutation in the 2-component transcriptional regulator PhoP (4).”
BackgroundLi, L., Short, F. L., Hassan, K. A., Naidu, V., Pokhrel, A., Nagy, S. S., Prity, F. T., Shah, B. S., Afrin, N., Baker, S. G., et al. (2023) · Nature Microbiology · doi:10.1038/s41564-023-01474-z · Cited by 37
Alexis Diomedi, P., Chacón, E., Delpiano, L., Hervé, B., Jemenao, M. I., Medel, M., Quintanilla, M., Gisela Riedel, M., Tinoco, J., & Cifuentes, M. (2017) · Revista chilena de infectología · doi:10.4067/s0716-10182017000200010 · Cited by 37
Muggeo, A., Guillard, T., Klein, F., et al. (2017) · Journal of Global Antimicrobial Resistance · doi:10.1016/j.jgar.2017.10.023 · Cited by 37
D’Accolti, M., Soffritti, I., Lanzoni, L., Bisi, M., Volta, A., Mazzacane, S., & Caselli, E. (2019) · Microbial Biotechnology · doi:10.1111/1751-7915.13415 · Cited by 39
“Other important limitations include the high environmental impact and their potential contribution to the selection of antimicrobial resistant (AMR) strains, thus worsening the AMR concern (Bock et al., 2016; Wand et al., 2017; Fahimipour et al., 2018).”
BackgroundStone, W., Tolmay, J., Tucker, K., & Wolfaardt, G. M. (2020) · Microorganisms · doi:10.3390/microorganisms8111726 · Cited by 37
“Excessive and inefficient use of disinfectants, similar to excessive and inefficient use of antibiotics, may increase a hospital’s risk of becoming an incubator for resistant pathogens [6,11].”
BackgroundCason, C., D’Accolti, M., Campisciano, G., Soffritti, I., Ponis, G., Mazzacane, S., Maggiore, A., Risso, F. M., Comar, M., & Caselli, E. (2021) · Pathogens · doi:10.3390/pathogens10050615 · Cited by 39
Bacteriophages in Infectious Diseases and Beyond—A Narrative Review
Ιωάννου, Π., Baliou, S., & Samonis, G. (2023) · Antibiotics · doi:10.3390/antibiotics12061012 · Cited by 42
“In vitro tests have shown that if PCHS are combined with phages, they retain their stability and activity, allowing them to target bacteria with significant antimicrobial resistance that are often also resistant to disinfectants, thus leading to an additive or synergistic effect [104,109,116].”
BackgroundRoedel, A., Vincze, S., Projahn, M., Roesler, U. H., Robé, C., Hammerl, J. A., Noll, M., Dahouk, S. A., & Dieckmann, R. (2021) · Microorganisms · doi:10.3390/microorganisms9030651 · Cited by 34
“In vitro studies showed that antibiotic cross-resistance can occur during bacterial exposure to subinhibitory concentrations of biocides like QACs [92], biguanides [93], and phenolic compounds [94].”
BackgroundWand, M. E., Darby, E. M., Blair, J. M. A., & Sutton, J. M. (2022) · Journal of Medical Microbiology · doi:10.1099/jmm.0.001496 · Cited by 36
“Primers used have already been described [17] except for acrA primers (KPacrA665R3 TCATTGCTCGACTGGGTGAC; KPacrA586F3 CAGAATGGTCAAACGACCGC) and ramA primers (KPramA332R3 CGACTGTGGTTCTCTTTGCG; KP ramA 260F3 AGACCTTTACCCGCGTCTTC).”
BackgroundMethodInfluentialSelf-citationLemmen, S., & Lewalter, K. (2018) · Infection · doi:10.1007/s15010-018-1137-1 · Cited by 33
“Antiseptic washing Significant reduction of transmission of MRSA and VRE in ICU and BMT Significant reduction of BSI in ICU As an horizontal approach effective for sensitive pathogen, as well Time saving in comparison to washing with water and soap [40] [40, 41] [41] Concern of emergence of resistance against CHG Redu…”
Bertolotti, A., Sbidian, É., Join‐Lambert, O., et al. (2020) · British Journal of Dermatology · doi:10.1111/bjd.19710 · Cited by 33
Efflux-mediated tolerance to cationic biocides, a cause for concern?
Wand, M. E., & Sutton, J. M. (2022) · Microbiology · doi:10.1099/mic.0.001263 · Cited by 35
Self-citationMasci, D., Hind, C. K., Islam, M. K., et al. (2019) · European Journal of Medicinal Chemistry · doi:10.1016/j.ejmech.2019.05.087 · Cited by 33
Self-citationZhang, Z., Yu, J. L., Yao, C., et al. (2020) · Dental Materials · doi:10.1016/j.dental.2020.08.009 · Cited by 32
Soffritti, I., D'Accolti, M., Cason, C., Lanzoni, L., Bisi, M., Volta, A., Campisciano, G., Mazzacane, S., Bini, F., Mazziga, E., et al. (2022) · Infection and Drug Resistance · doi:10.2147/idr.s356740 · Cited by 30
Bleriot, I., Blasco, L., Delgado-Valverde, M., Gual-de-Torrella, A., Ambroa, A., Fernández-García, L., López, M. C., Oteo, J., Wood, T. K., Pascual, Á., et al. (2020) · Toxins · doi:10.3390/toxins12090566 · Cited by 28
“pneumoniae adapted to CHLX also presented resistance to colistin, increasing their MIC values from 2–4 mg/L to 64 mg/L [9].”
BackgroundInfluentialHeterogeneity and Diversity of mcr-8 Genetic Context in Chicken-Associated Klebsiella pneumoniae
Wu, B., Wang, Y., Ling, Z., et al. (2020) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.01872-20 · Cited by 30
“concern because of their resistance to multiple antimicrobial agents (1).”
BackgroundBeier, R. C., Byrd, J. A., Andrews, K., et al. (2020) · Poultry Science · doi:10.1016/j.psj.2020.10.045 · Cited by 30
“, 2016), and the use of biocides has been demonstrated to result in antimicrobial crossresistance (Maris, 1991; Sidhu et al., 2002a; Braoudaki and Hilton, 2004; Beier et al., 2005; Davin-Regli and Pag es, 2012; Al-Jailawi et al., 2013; Gnanadhas et al., 2013; Wales and Davies, 2015; Romaro et al., 2017; Wand et al., 2…”
BackgroundD’Accolti, M., Soffritti, I., Bonfante, F., Ricciardi, W., Mazzacane, S., & Caselli, E. (2021) · Viruses · doi:10.3390/v13112227 · Cited by 29
Priming with biocides: A pathway to antibiotic resistance?
Adkin, P., Hitchcock, A., Smith, L. J., & Walsh, S. (2022) · Journal of Applied Microbiology · doi:10.1111/jam.15564 · Cited by 23
Bacterial cross-resistance to anti-infective compounds. Is it a real problem?
Cândido, E. D. S., de Barros, E., Cardoso, M. H. E. S., & Franco, O. L. (2019) · Current Opinion in Pharmacology · doi:10.1016/j.coph.2019.05.004 · Cited by 29
An Innovative Strategy for the Effective Reduction of MDR Pathogens from the Nosocomial Environment
Caselli, E., D’Accolti, M., Soffritti, I., Lanzoni, L., Bisi, M., Volta, A., Berloco, F., & Mazzacane, S. (2019) · Advances in experimental medicine and biology · doi:10.1007/5584_2019_399 · Cited by 28
Garratt, I., Aranega-Bou, P., Sutton, J. M., Moore, G., & Wand, M. E. (2021) · Applied and Environmental Microbiology · doi:10.1128/aem.00210-21 · Cited by 31
“pneumoniae (40), and smvR mutations were first observed before secondary highlevel tolerance to octenidine in P.”
BackgroundMethodInfluentialSelf-citationAuer, D. L., Mao, X., Anderson, A. C., Muehler, D., Wittmer, A., OHLE, C. V., Wolff, D., Frese, C., Hiller, K., Maisch, T., et al. (2022) · Antibiotics · doi:10.3390/antibiotics11050688 · Cited by 29
“, Klebsiella pneumoniae [9,10,58], and similar observations could be made with respect to CPC [7], phenotypic antibiotic resistance was evaluated.”
BackgroundKaspar, J. R., Godwin, M. J., Velsko, I. M., Richards, V. P., & Burne, R. A. (2019) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.00161-19 · Cited by 28
“Adaptations to 96 CHX may also lead to cross-resistance to other antimicrobials, as was noted recently with 97 clinical strains of Klebsiella pneumoniae that could acquire resistance to the last-resort antibiotic 98 colistin after exposure to CHX (21).”
BackgroundPseudomonas Phage ZCPS1 Endolysin as a Potential Therapeutic Agent
Abdelrahman, F. I., Gangakhedkar, R., Nair, G. A., El–Didamony, G., Askora, A., Jain, V. P., & El‐Shibiny, A. (2023) · Viruses · doi:10.3390/v15020520 · Cited by 27
“coli is resistant to triclosan [45], Klebsiella pneumoniae is resistant to colistin [46], Salmonella spp.”
BackgroundBaig, M. I. R., Kadu, P. K., Bawane, P. P., Nakhate, K. T., Yele, S., Ojha, S. K., & Goyal, S. N. (2023) · The Journal of Antibiotics · doi:10.1038/s41429-023-00649-4 · Cited by 27
Chen, T., Wang, Y., Chi, X., et al. (2024) · Virulence · doi:10.1080/21505594.2024.2349768 · Cited by 27
“Moreover, some authors report K. pneumoniae showing cross-resistance to polymyxin and chlorhexidine [46,47].”
Background
Metadata
- Authors
- Wand, M. E., Bock, L. J., Bonney, L. C., & Sutton, J. M.
- Affiliations
- Public Health England (GB)
- Venue
- Antimicrobial Agents and Chemotherapy
- Publisher
- American Society for Microbiology
- Published
- 2017-01
- Volume
- 61
- Issue
- 1
- ISSN
- 0066-4804 (ISSN-L)
- 1098-6596
- PMC
- PMC5192135
- OpenAlex
- W2540856562
- Cited by
- 313
- References
- 54
- Citations by year
- 2026: 19 · 2025: 25 · 2024: 23 · 2023: 34 · 2022: 46 · 2021: 43 · 2020: 36 · 2019: 47 · 2018: 19 · 2017: 18
- FWCI
- 13.87
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Locations
- Antimicrobial Agents and Chemotherapy (publishedVersion)
- Europe PMC (PubMed Central) (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Funders
- Public Health England (GIA 109506)
- Topics
- Health Sciences › Medicine › Microbiology (medical) › Antibiotic Resistance in Bacteria
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Bacterial Genetics and Biotechnology
- Life Sciences › Immunology and Microbiology › Applied Microbiology and Biotechnology › Antimicrobial agents and applications
- Keywords
- Klebsiella pneumoniae, chlorhexidine, colistin, cross-resistance, PhoPQ two-component system, major facilitator superfamily, multidrug resistance, infection control
- MeSH terms
- Anti-Bacterial Agents, Bacterial Proteins, Chlorhexidine, Colistin, Klebsiella pneumoniae, Microbial Sensitivity Tests, Mutation, Plasmids, Drug Resistance, Bacterial
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
