Cited by 315Escherichia coli research studiesEnterobacteriaceae and Cronobacter ResearchAntibiotic Resistance in Bacteria

The DOI matches its Crossref record; 50 of the 50 references it cites were found in a registry or an index.

Aerobactin, but Not Yersiniabactin, Salmochelin, or Enterobactin, Enables the Growth/Survival of Hypervirulent (Hypermucoviscous) Klebsiella pneumoniae Ex Vivo and In Vivo

Open access

Russo, Thomas A., Olson, Ruth, MacDonald, Ulrike, Beanan, Janet, Davidson, Bruce A.·2015·Infection and Immunity

DOI 10.1128/iai.00430-15PMC PMC4496593

Open this paper in CoChat — free account Open PDF

Abstract

The siderophore aerobactin is the dominant siderophore produced by hypervirulent Klebsiella pneumoniae (hvKP) and was previously shown to be a major virulence factor in systemic infection. However, strains of hvKP commonly produce the additional siderophores yersiniabactin, salmochelin, and enterobactin. The roles of these siderophores in hvKP infection have not been optimally defined. To that end, site-specific gene disruptions were created in hvKP1 (wild type), resulting in the generation of hvKP1Δ iucA (aerobactin deficient), hvKP1Δ iroB (salmochelin deficient), hvKP1Δ entB (enterobactin and salmochelin deficient), hvKP1Δ irp2 (yersiniabactin deficient), and hvKP1Δ entB Δ irp2 (enterobactin, salmochelin, and yersiniabactin deficient). The growth/survival of these constructs was compared to that of their wild-type parent hvKP1 ex vivo in human ascites fluid, human serum, and human urine and in vivo in mouse systemic infection and pulmonary challenge models. Interestingly, in contrast to aerobactin, the inability to produce enterobactin, salmochelin, or yersiniabactin individually or in combination did not decrease the ex vivo growth/survival in human ascites or serum or decrease virulence in the in vivo infection models. Surprisingly, none of the siderophores increased growth in human urine. In human ascites fluid supplemented with exogenous siderophores, siderophores increased the growth of hvKP1Δ iucA , with the relative activity being enterobactin > aerobactin > yersiniabactin > salmochelin, suggesting that the contribution of aerobactin to virulence is dependent on both innate biologic activity and quantity produced. Taken together, these data confirm and extend a role for aerobactin as a critical virulence factor for hvKP. Since it appears that aerobactin production is a defining trait of hvKP strains, this factor is a potential antivirulence target.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1128/iai.00430-15

Cites

50 of 50 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

Guide for the Care and Use of Laboratory Animals: Eighth Edition
(2011) · doi:10.17226/12910 · Cited by 16,199
Lipocalin 2 mediates an innate immune response to bacterial infection by sequestrating iron
Flo, T. H., Smith, K. D., Sato, S., Rodriguez, D. J., Holmes, M. A., Strong, R. K., Akira, S., & Aderem, A. (2004) · Nature · doi:10.1038/nature03104 · Cited by 1,877
Siderophore-Based Iron Acquisition and Pathogen Control
Miethke, M., & Marahiel, M. A. (2007) · Microbiology and Molecular Biology Reviews · doi:10.1128/mmbr.00012-07 · Cited by 1,774
Chemistry and biology of siderophores
Hider, R. C., & Kong, X. (2010) · Natural Product Reports · doi:10.1039/b906679a · Cited by 1,722
Guide for the Care and Use of Laboratory Animals (8th edn)
Albus, U. (2012) · Laboratory Animals · doi:10.1258/la.2012.150312 · Cited by 1,706
Iron and infection
Weinberg, E. D. (1978) · Microbiological Reviews · doi:10.1128/mmbr.42.1.45-66.1978 · Cited by 1,254
Microbial Iron Compounds
Neilands, J. B. (1981) · Annual Review of Biochemistry · doi:10.1146/annurev.bi.50.070181.003435 · Cited by 1,232
Hypervirulent (hypermucoviscous) Klebsiella pneumoniae
Shon, A. S. Y., Bajwa, R. P. S., & Russo, T. A. (2013) · Virulence · doi:10.4161/viru.22718 · Cited by 1,217
Self-citation
Untitled work
(2018) · doi:10.1001/jama · Cited by 932
Tracking a Hospital Outbreak of Carbapenem-Resistant Klebsiella pneumoniae with Whole-Genome Sequencing
Snitkin, E. S., Zelazny, A. M., Thomas, P. J., Stock, F., Program, N. C. S., Henderson, D. K., Palmore, T. N., & Segre, J. A. (2012) · Science Translational Medicine · doi:10.1126/scitranslmed.3004129 · Cited by 863

Show all 49 references

Research works printed but not linked: 1

10.1128/mr.42.1.45-66.1978 · DOI · Paper page

Sorted by citations

Items 101–200 of 315

Animal models of Klebsiella pneumoniae mucosal infections
Assoni, L., Couto, A. J. M., Vieira, B., Milani, B., Lima, A. S., Converso, T. R., & Darrieux, M. (2024) · Frontiers in Microbiology · doi:10.3389/fmicb.2024.1367422 · Cited by 34
Complement Susceptibility in Relation to Genome Sequence of Recent Klebsiella pneumoniae Isolates from Thai Hospitals
Loraine, J., Heinz, E., Almeida, J. D. S., Milevskyy, O., Voravuthikunchai, S. P., Srimanote, P., Kiratisin, P., Thomson, N. R., & Taylor, P. W. (2018) · mSphere · doi:10.1128/msphere.00537-18 · Cited by 31
“Iron-sequestering systems have been implicated in the determination of C= resistance through their role in metabolic adaptation (49, 50) and are considered major virulence effectors in Klebsiella infections (1, 7, 51).”
Background
Outbreak of KPC-2 Carbapenem-resistant Klebsiella pneumoniae ST76 and Carbapenem-resistant K2 Hypervirulent Klebsiella pneumoniae ST375 strains in Northeast China: molecular and virulent characteristics
Su, S., Zhang, J., Zhao, Y., Yu, L., Wang, Y., Wang, Y., Bao, M., Fu, Y., Li, C., & Zhang, X. (2020) · BMC Infectious Diseases · doi:10.1186/s12879-020-05143-y · Cited by 31
The Siderophore Synthetase IucA of the Aerobactin Biosynthetic Pathway Uses an Ordered Mechanism
Mydy, L. S., Bailey, D. C., Patel, K. D., Rice, M. R., & Gulick, A. M. (2020) · Biochemistry · doi:10.1021/acs.biochem.0c00250 · Cited by 31
“pneumoniae was identified in the mid-1980s (6), recent genetic evidence has clearly demonstrated that of the four siderophores encoded within the hvKP genome aerobactin contributes most significantly to virulence (7, 8).”
Background
WGS-Based Phenotyping and Molecular Characterization of the Resistome, Virulome and Plasmid Replicons in Klebsiella pneumoniae Isolates from Powdered Milk Produced in Germany
Wareth, G., Linde, J., Hammer, P., Pletz, M. W., Neubauer, H., & Sprague, L. (2022) · Microorganisms · doi:10.3390/microorganisms10030564 · Cited by 31
Siderophore biosynthesis coordinately modulated the virulence-associated interactive metabolome of uropathogenic Escherichia coli and human urine
Su, Q., Guan, T., & Lv, H. (2016) · Scientific Reports · doi:10.1038/srep24099 · Cited by 31
Siderophores and beyond: A comprehensive review of iron acquisition in Klebsiella pneumoniae
Lan, P., Lu, Y., Fu, Y., Yu, Y., & Zhou, J. (2025) · Virulence · doi:10.1080/21505594.2025.2550621 · Cited by 30
“Additionally, aerobactin effectively enhances the success rate of K. pneumoniae infection modeling in mouse lungs and subcutaneous tissues, compared to enterobactin, salmochelin, and yersiniabactin [36].”
Hypervirulent Klebsiella pneumoniae Infections in Pediatric Populations in Beijing (2017–2019)
Li, Y., Dong, L., Gao, W., Zhen, J., Dong, F., & Yao, K. (2021) · The Pediatric Infectious Disease Journal · doi:10.1097/inf.0000000000003253 · Cited by 30
“Aerobactin is the specific genetic biomarker for hvKp and is regarded as one of the most essential virulence factors conferring hypervirulence, encoding by iuc genes.(5) Consistent with previous research,(6) aerobactin-positive (iucA-positive tested by PCR) K.”
Background
Essentiality of the virulence plasmid-encoded factors in disease pathogenesis of the major lineage of hypervirulent Klebsiella pneumoniae varies in different infection niches
Lim, C., Zhang, C.-Y., Cheam, G., Chu, W. H. W., Chen, Y., Yong, M., Lim, K. Y. E., Lam, M. M. C., Teo, T., & Gan, Y. (2025) · EBioMedicine · doi:10.1016/j.ebiom.2025.105683 · Cited by 29
Hypervirulent Klebsiella pneumoniae as a hospital-acquired pathogen in the intensive care unit in Mansoura, Egypt
El-Mahdy, R. H., El-Kannishy, G. M., & Salama, H. (2018) · GERMS · doi:10.18683/germs.2018.1141 · Cited by 29
Antibody Dependent Enhancement of Acinetobacter baumannii Infection in a Mouse Pneumonia Model
Lin, S. X. W., Olson, R., Beanan, J. M., MacDonald, U., Russo, T. A., & Balthasar, J. P. (2019) · Journal of Pharmacology and Experimental Therapeutics · doi:10.1124/jpet.118.253617 · Cited by 27
“To explore the potential efficacy of 8E3 in animals, mice underwent pulmonary challenge with AB899 at an inoculum of ∼1 10(9) CFU (Russo et al., 2015).”
BackgroundSelf-citation
Siderophore Biosynthesis Governs the Virulence of Uropathogenic Escherichia coli by Coordinately Modulating the Differential Metabolism
Su, Q., Guan, T., He, Y., & Lv, H. (2016) · Journal of Proteome Research · doi:10.1021/acs.jproteome.6b00061 · Cited by 28
Elizabethkingia anophelis: Physiologic and Transcriptomic Responses to Iron Stress
Chen, S., Johnson, B. K., Yu, T. Y., Nelson, B. N., & Walker, E. D. (2020) · Frontiers in Microbiology · doi:10.3389/fmicb.2020.00804 · Cited by 30
Virulence factors of Klebsiella pneumoniae: Insights into canonical and emerging mechanisms driving pathogenicity and drug resistance
Singh, R. P., Kapoor, A., Sinha, A., Ma, Y., & Shankar, M. (2025) · The Microbe · doi:10.1016/j.microb.2025.100289 · Cited by 31
Detection of extensively drug-resistant and hypervirulent Klebsiella pneumoniae ST15, ST147, ST377 and ST442 in Iran
Davoudabadi, S., Goudarzi, H., Goudarzi, M., Ardebili, A., Faghihloo, E., Sharahi, J. Y., & Hashemi, A. (2021) · Acta Microbiologica et Immunologica Hungarica · doi:10.1556/030.2021.01562 · Cited by 27
The evolution of three siderophore biosynthetic clusters in environmental and host-associating strains of Pantoea
Soutar, C. D., & Stavrinides, J. (2018) · Molecular Genetics and Genomics · doi:10.1007/s00438-018-1477-7 · Cited by 25
Carbapenem-resistant hypermucoviscous Klebsiella pneumoniae clinical isolates from a tertiary hospital in China: Antimicrobial susceptibility, resistance phenotype, epidemiological characteristics, microbial virulence, and risk factors
Wang, Q., Chen, M., Ou, Q., Zheng, L., Chen, X., Mao, G., Fang, J., Jin, D., & Tang, X. (2022) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2022.1083009 · Cited by 25
“Hence, SP-related encoding genes, especially iutA, are key markers in the identification of hvKP (Russo et al., 2015; Han et al., 2022).”
Background
Multidrug resistant Klebsiella Pneumoniae reservoir and their capsular resistance genes in cow farms of district Peshawar, Pakistan
Saddam, S., Khan, M., Jamal, M., Rehman, S. U., Sláma, P., & Horký, P. (2023) · PLoS ONE · doi:10.1371/journal.pone.0282245 · Cited by 25
Interaction of multidrug-resistant hypervirulent Klebsiella pneumoniae with components of human innate host defense
DeLeo, F. R., Porter, A. R., Kobayashi, S. D., Freedman, B. A., Hao, M., Jiang, J., Lin, Y.-T., Kreiswirth, B. N., & Chen, L. (2023) · mBio · doi:10.1128/mbio.01949-23 · Cited by 24
“Aerobactin, a siderophore encoded by iucA , has also been shown by multiple studies to contribute to the hypervirulence phenotype of hvKp (27–29).”
Background
Hypervirulent Capsular Serotypes K1 and K2 Klebsiella pneumoniae Strains Demonstrate Resistance to Serum Bactericidal Activity and Galleria mellonella Lethality
AL-Busaidi, B. N., AL-Muzahmi, M., Al-Shabibi, Z., Rizvi, M., Al-Rashdi, A., Al‐Jardani, A., Farzand, R., & AL-Jabri, Z. (2024) · International Journal of Molecular Sciences · doi:10.3390/ijms25031944 · Cited by 27
Clinical and genomic characterization of hypervirulent Klebsiella pneumoniae (hvKp) infections via passive surveillance in Southern California, 2020–2022
Kamau, E. T., Ranson, E. L., Tsan, A. T., Bergmann‐Leitner, E. S., Garner, O. B., & Yang, S. (2022) · Frontiers in Microbiology · doi:10.3389/fmicb.2022.1001169 · Cited by 24
Detection of Virulence Factors and Antibiotic Resistance among Klebsiella pneumoniae Isolates from Iran
Davoudabadi, S., Goudarzi, M., & Hashemi, A. (2023) · BioMed Research International · doi:10.1155/2023/3624497 · Cited by 24
“kfu F: GGCCTTTGTCCAGAGCTACG [43] R: GGGTCTGGCGCAGAGTATGC”
Influential
Genomic characterization of colistin-resistant Klebsiella pneumoniae isolated from intensive care unit patients in Egypt
Attalla, E. T., Khalil, A. M., Zakaria, A. S., Baker, D., & Mohamed, N. M. (2023) · Annals of Clinical Microbiology and Antimicrobials · doi:10.1186/s12941-023-00632-9 · Cited by 27
“94% of the isolates, is reported to play the utmost significant role in virulence among the four siderophore systems, both in vivo and in vitro [50].”
Background
What defines hypervirulent Klebsiella pneumoniae?
Stanton, T. D., & Wyres, K. L. (2024) · EBioMedicine · doi:10.1016/j.ebiom.2024.105331 · Cited by 23
Clinical and Microbiological Prognostic Factors of in-Hospital Mortality Caused by Hypervirulent Klebsiella pneumoniae Infections: A Retrospective Study in a Tertiary Hospital in Southwestern China
Tang, Y., Liu, H., Zhao, J., Yi, M., Yuan, Y., & Xia, Y. (2020) · Infection and Drug Resistance · doi:10.2147/idr.s276642 · Cited by 23
Molecular Epidemiology of Antimicrobial Resistance, Virulence and Capsular Serotypes of Carbapenemase-Carrying Klebsiella pneumoniae in China
Zhao, L., Xia, X., Yuan, T., Zhu, J., Shen, Z., & Li, M. (2022) · Antibiotics · doi:10.3390/antibiotics11081100 · Cited by 23
“Among the siderophores of aerobactin, yersiniabactin, and salmochelin, aerobactin is considered the decisive genetic feature and potential antivirulence target of HvKP [28].”
Background
A Comprehensive Genomic Analysis of the Emergent Klebsiella pneumoniae ST16 Lineage: Virulence, Antimicrobial Resistance and a Comparison with the Clinically Relevant ST11 Strain
de Sales, R. O., Leaden, L., Migliorini, L. B., & Severino, P. (2022) · Pathogens · doi:10.3390/pathogens11121394 · Cited by 23
Iron-Uptake Systems of Chicken-Associated Salmonella Serovars and Their Role in Colonizing the Avian Host
Wellawa, D. H., Allan, B. J., White, A. P., & Köster, W. L. (2020) · Microorganisms · doi:10.3390/microorganisms8081203 · Cited by 23
“In a similar manner the hypervirulent Klebsiella pneumoniae strain solely uses aerobactin to confer its hypervirulent phenotype which leads to septicemia in humans [93].”
Background
IscR Regulation of Type 3 Fimbriae Expression in Klebsiella pneumoniae CG43
Lin, T., Tseng, C.-Y., Lai, Y., Wu, C.-C., Huang, C.-F., & Lin, C.-T. (2017) · Frontiers in Microbiology · doi:10.3389/fmicb.2017.01984 · Cited by 22
“In K. pneumoniae, CPS and ironacquisition systems are critical and important virulence factors for successful infection (Lin et al., 2004; Regueiro et al., 2006; Russo et al., 2015).”
Background
Clinical and virulence factors related to the 30-day mortality of Klebsiella pneumoniae bacteremia at a tertiary hospital: a case–control study
Namikawa, H., Niki, M., Niki, M., Yamada, K., Nakaie, K., Sakiyama, A., Oinuma, K.-I., Tsubouchi, T., Tochino, Y., Takemoto, Y., et al. (2019) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-019-03676-y · Cited by 21
Molecular epidemiology of virulence and antimicrobial resistance determinants in Klebsiella pneumoniae from hospitalised patients in Kilimanjaro, Tanzania
Sonda, T., Kumburu, H. H., van Zwetselaar, M., Alifrangis, M., Mmbaga, B. T., Lund, O., Kibiki, G. S., & Aarestrup, F. M. (2018) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-018-3324-5 · Cited by 21
Enterobactin: A key player in bacterial iron acquisition and virulence and its implications for vaccine development and antimicrobial strategies
Amiri, M., Golchin, M., Jamshidian-Mojaver, M., Farzin, H., & Hajizadeh, A. (2025) · Virulence · doi:10.1080/21505594.2025.2563018 · Cited by 23
“Dual-pathway inhibition simultaneously targeting enterobactin ( entB ) and aerobactin ( iucA ) reduces bacterial loads more effectively than single-target approaches in preclinical models [78].”
Innate Bacteriostatic Mechanisms Defend the Urinary Tract
Munoz, J. A., Uhlemann, A., & Barasch, J. M. (2021) · Annual Review of Physiology · doi:10.1146/annurev-physiol-052521-121810 · Cited by 21
The Ferric uptake regulator (Fur) and iron availability control the production and maturation of the antibacterial peptide microcin E492
Marcoleta, A. E., Gutiérrez-Cortez, S., Hurtado, F., Argandoña, Y., Corsini, G., Monasterio, O., & Lagos, R. (2018) · PLOS ONE · doi:10.1371/journal.pone.0200835 · Cited by 19
Phenotypic and Genomic Characterization of Virulence Heterogeneity in Multidrug-Resistant ST11 Klebsiella pneumoniae During Inter-Host Transmission and Evolution
Liu, C., Du, P., Zhao, J., Li, B., Wang, C., Sun, L., Lu, B., Wang, Y., Liu, Y., & Cao, B. (2020) · Infection and Drug Resistance · doi:10.2147/idr.s243836 · Cited by 19
Genomic analysis of hypervirulent Klebsiella pneumoniae reveals potential genetic markers for differentiation from classical strains
Spadar, A., Perdigão, J., Campino, S. G., & Clark, T. G. (2022) · Scientific Reports · doi:10.1038/s41598-022-17995-2 · Cited by 19
Identification of hypervirulent Klebsiella pneumoniae carrying terW gene by MacConkey-potassium tellurite medium in the general population
Wu, X., Zhan, F., Zhang, J., Chen, S., & Yang, B. (2022) · Frontiers in Public Health · doi:10.3389/fpubh.2022.946370 · Cited by 19
“It is known that the rmpA gene is an important regulator of the extracellular polysaccharide synthesis capsule forming mucous colonies (9– 11), and the iutA gene is a virulence gene responsible for encoding aerobactin siderophore (11, 12).”
Background
Effects of aerobactin-encoding gene iucB and regulator of mucoid phenotype rmpA on the virulence of Klebsiella pneumoniae causing liver abscess
Liu, S., Huang, Z., Kong, J., Zhao, Y., Xu, M., Zhou, B., Zheng, X., Ye, D., Zhou, T., Cao, J., et al. (2022) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2022.968955 · Cited by 19
“pneumoniae through experiments in vitro/vivo (Russo et al., 2015).”
Highly conserved composite transposon harbouring aerobactin iuc3 in Klebsiella pneumoniae from pigs
Kaspersen, H. P., Franklin‐Alming, F. V., Hetland, M. A. K., Bernhoff, E., Löhr, I. H., Jiwakanon, J., Urdahl, A. M., Leangapichart, T., & Sunde, M. (2023) · Microbial Genomics · doi:10.1099/mgen.0.000960 · Cited by 19
“pneumoniae, and is often associated with hypervirulence [8, 9].”
Prevalence and characteristics of surgical site hypervirulent Klebsiella pneumoniae isolates
Zhao, Q., Guo, L., Wang, L., Zhao, Q., & Shen, D. (2020) · Journal of Clinical Laboratory Analysis · doi:10.1002/jcla.23364 · Cited by 19
Global dissemination of conjugative virulence plasmids co-harboring hypervirulence and multidrug resistance genes in Klebsiella pneumoniae
Xu, Q., Sun, R.-Y., Liu, X., Heng, H., Yang, X., Xie, M., Yang, C., Ye, L., Chan, E. W., Zhang, R., et al. (2025) · mSystems · doi:10.1128/msystems.01675-24 · Cited by 18
“Experimental studies have indicated that aerobactin is the predominant contributor to hypervirulence and is more specific to hv Kp compared with enterobactin and yersiniabactin (51).”
Mobile genetic elements in Klebsiella pneumoniae
Pan, T., & Li, Q. (2025) · Journal of Bacteriology · doi:10.1128/jb.00012-25 · Cited by 18
“Thus, the continued emergence and mechanistic diversity of plasmid-mediated HGT await further investigation.”
How Klebsiella pneumoniae controls its virulence
Nguyen, T. N. T., Howells, G., & Short, F. L. (2025) · PLoS Pathogens · doi:10.1371/journal.ppat.1013499 · Cited by 19
“Regulation differences may contribute to the variation in the virulence contributions of individual sidero-phores across strain backgrounds, or the dominance of aerobactin in the secreted siderophore pool of at least one hvKp strain [124,125].”
Genetics and pathology associated with Klebsiella pneumoniae and Klebsiella spp. isolates from North American Pacific coastal marine mammals
Chang, R. K., Miller, M. A., Shahin, K., Batac, F., Field, C. L., Duignan, P. J., Struve, C., Byrne, B. A., Murray, M. J., Greenwald, K., et al. (2021) · Veterinary Microbiology · doi:10.1016/j.vetmic.2021.109307 · Cited by 18
Genomic insights into virulence factors affecting tissue-invasive Klebsiella pneumoniae infection
Matono, T., Morita, M., Nakao, N., Teshima, Y., & Ohnishi, M. (2022) · Annals of Clinical Microbiology and Antimicrobials · doi:10.1186/s12941-022-00494-7 · Cited by 18
“Furthermore, experimental studies showed that aerobactin was the most critical hvKpspecific siderophore and enhanced pathogenesis, more so than yersiniabactin, salmochelin, or enterobactin [26, 27].”
Background
Hypervirulent Klebsiella pneumoniae detection methods: a minireview
Zhang, Q.-B., Zhu, P., Zhang, S., Rong, Y.-J., Huang, Z., Sun, L.-W., & Cai, T. (2023) · Archives of Microbiology · doi:10.1007/s00203-023-03665-y · Cited by 19
“Both cKp and hvKp have siderophores, but the siderophore content in hvKp is 6–10 times higher than that in cKp (Russo et al. 2015).”
Capsular type K54, clonal group 29 and virulence plasmids: an analysis of K54 and non-K54 closely related isolates ofKlebsiella pneumoniae
Turton, J. F., Payne, Z., Micah, K., & Turton, J. A. (2018) · Epidemiology and Infection · doi:10.1017/s0950268818001826 · Cited by 18
“However, this goes against observations that suggest that the virulence plasmid is a requirement for hypervirulence, rmpA/rmpA2 and aerobactin, in particular being strongly associated with the hypervirulent syndrome [10, 28, 29].”
Background
An outbreak of extensively drug-resistant and hypervirulent Klebsiella pneumoniae in an intensive care unit of a teaching hospital in Southwest China
Liu, S., Ding, Y., Xu, Y., Li, Z., Zeng, Z., & Liu, J. (2022) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2022.979219 · Cited by 18
“Besides, aerobactin plays a decisive role in the virulence of hvKp, and peg-344, iucA, rmpA, and rmpA2 as markers to identify hvKp has been shown to have high accuracy (Russo et al., 2015; Russo et al., 2018).”
Background
Development of a quadruple qRT-PCR assay for simultaneous identification of hypervirulent and carbapenem-resistant Klebsiella pneumoniae
Xu, Z., Li, B., Jiang, Y., Huang, J., Su, L., Wu, W., Pang, Q.-L., Li, Z., Zhang, J., Li, X., et al. (2023) · Microbiology Spectrum · doi:10.1128/spectrum.00719-23 · Cited by 17
“Notably, the icuA gene was found in all (31/31) the identified hvKp strains, which is consistent with previous findings that aerobactin is the dominant siderophore and a critical virulence factor for hvKp (9, 10).”
Result
Host and pathogen factors in Klebsiella pneumoniae upper urinary tract infections in renal transplant patients
Gołębiewska, J., Krawczyk, B., Wysocka, M., Ewiak, A., Komarnicka, J., Bronk, M., Rutkowski, B., & Dębska-Ślizień, A. M. (2019) · Journal of Medical Microbiology · doi:10.1099/jmm.0.000942 · Cited by 17
Transmission of ST45 and ST2407 extended-spectrum β-lactamase-producing Klebsiella pneumoniae in neonatal intensive care units, associated with contaminated environments
Shi, Q., Zhao, J., Li, W., Zhu, F., Ji, J., Meng, Y., Wu, Z., Jiang, Z., Han, X., Jiang, Y., et al. (2022) · Journal of Global Antimicrobial Resistance · doi:10.1016/j.jgar.2022.10.006 · Cited by 15
The Yersinia high-pathogenicity island (HPI) carried by a new integrative and conjugative element (ICE) in a multidrug-resistant and hypervirulent Klebsiella pneumoniae strain SCsl1
Liu, D., Yang, Y., Gu, J., Tuo, H., Li, P., Xie, X., Ma, G., Liu, J., & Zhang, A. (2019) · Veterinary Microbiology · doi:10.1016/j.vetmic.2019.108481 · Cited by 16
Genomic Features and Virulence Characteristics of a Community-Acquired Bloodstream Infection-Causing Hypervirulent Klebsiella pneumoniae ST86 Strain Harboring KPC-2-Encoding IncX6 Plasmid
Liu, Z., Chu, W., Li, X., Tang, W., Ye, J., Zhou, Q., & Guan, S. (2020) · Microbial Drug Resistance · doi:10.1089/mdr.2019.0394 · Cited by 16
“…considered one of the most important siderophores, accounting for increased side-rophore production, and is a major virulence determinant of hvKP. 38 Our in vitro and in vivo virulence assessments showed that the virulence of KPN55602 was similar to that of the ST23 reference strain KPN54798…”
Molecular Epidemiology of Hypervirulent K. pneumoniae and Problems of Health-Care Associated Infections
Tutelyan, A. V., Shlykova, D. S., Voskanyan, S. L., Михайлович, Г. А., & Писарев, В. М. (2022) · Bulletin of Experimental Biology and Medicine · doi:10.1007/s10517-022-05424-3 · Cited by 15
“Although the data do not support a role for salmochelin in the development of systemic infection, in combination with microcin E492 it can provide a competitive advantage in gastrointestinal colonization [109,110,125].”
BackgroundResult
A systematic review of hypervirulent Klebsiella pneumoniae research: bibliometric and topic modeling perspectives
Tian, T., Han, H., Guan, Z.-H., Zhang, K., Huang, X. C., Wang, W., Zhang, X., Zhang, F., Wei, L., Zhang, X., et al. (2025) · Frontiers in Medicine · doi:10.3389/fmed.2025.1545678 · Cited by 15
Characterization of bla KPC-2 -Harboring Klebsiella pneumoniae Isolates and Mobile Genetic Elements from Outbreaks in a Hospital in Ecuador
Reyes, J., Cárdenas, P., Tamayo‐Trujillo, R., Villavicencio, F. X., Aguilar, A. C., Melano, R. G., & Trueba, G. A. (2020) · Microbial Drug Resistance · doi:10.1089/mdr.2019.0433 · Cited by 15
Clinical and Microbiological Characteristics of Klebsiella pneumoniae Bloodstream Infection in a Chinese Hospital: Hypervirulent and Multiclonal
Sheng, Z.-K., Li, J., Chen, T., Zhu, Y., Yu, X., He, X., Zheng, Y., Ma, C., Zheng, M., Wang, P., et al. (2022) · Infection and Drug Resistance · doi:10.2147/idr.s371477 · Cited by 15
“Previous studies showed that various virulence factors could concurrently be present in hvKP.(3) This study revealed that BSI hvKP strongly related to rmpA, iroBCD cluster, ybtS, clbA, and allS.”
BackgroundInfluential
Repurposed dihydroorotate dehydrogenase inhibitors with efficacy against drug-resistant Acinetobacter baumannii
Russo, T. A., Umland, T. C., Deng, X., Mazouni, F. E., Kokkonda, S., Olson, R., MacDonald, U., Beanan, J. M., Alvarado, C. L., Tomchick, D. R., et al. (2022) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.2213116119 · Cited by 14
Self-citation
Inorganic Polyphosphate Affects Biofilm Assembly, Capsule Formation, and Virulence of Hypervirulent ST23 Klebsiella pneumoniae
Rojas, D., Marcoleta, A. E., Gálvez-Silva, M., Varas, M. A., Díaz, M., Hernández, M., Vargas, C., Nourdin, G., Koch, E. S., Saldivia, P., et al. (2024) · ACS Infectious Diseases · doi:10.1021/acsinfecdis.3c00509 · Cited by 15
Effective Photodynamic Therapy with Ir(III) for Virulent Clinical Isolates of Extended-Spectrum Beta-Lactamase Klebsiella pneumoniae
Núñez, C., Palavecino, A., González, I., Dreyse, P., & Palavecino, C. E. (2021) · Pharmaceutics · doi:10.3390/pharmaceutics13050603 · Cited by 15
“Moreover, virulence genes, such as siderophores, which have an essential role in bacterial survival and virulence [49,50], have been previously associated with the MDR-K.”
Background
Infection metallomics for critical care in the post‐COVID era
Patil, R. H., Luptáková, D., & Havlı́ček, V. (2021) · Mass Spectrometry Reviews · doi:10.1002/mas.21755 · Cited by 15
Genomic and phylogenetic analysis of hypervirulent Klebsiella pneumoniae ST23 in Ireland
Maguire, M., DeLappe, N., Clarke, C., Touhy, A., MacDonald, U., Hutson, A. D., Cormican, M., Brennan, W., Devane, G., Morris, D., et al. (2025) · Microbial Genomics · doi:10.1099/mgen.0.001373 · Cited by 14
Self-citation
Phenotypic and Genotypic Detection of Hypervirulent Klebsiella pneumoniae Isolated from Hospital-Acquired Infections
Taha, M. S., Elkolaly, R. M., Elhendawy, M., Elatrozy, H. I. S., Amer, A. F., Helal, R. A. E. F., Salem, H., Elfeky, Y. G., Harkan, A. I., Mashaal, R. G., et al. (2024) · Microorganisms · doi:10.3390/microorganisms12122469 · Cited by 14
Clinical Outcomes, Microbiological Characteristics and Risk Factors for Difficult-to-Treat Resistance to Klebsiella pneumoniae Infection
Yang, P., Liu, C., Wu, Z., Zheng, J., Yi, J., Wu, N., Wu, Z., Lu, M., Cui, L., & Shen, N. (2022) · Infection and Drug Resistance · doi:10.2147/idr.s377064 · Cited by 14
“was the dominant siderophore produced by the hvKp strains and the critical siderophore that enhances virulence ex vivo and in vivo.(33) Aerobactin significantly enhances the survival of isolates in human ascites, in the serum, and in outbred mouse systemic and pulmonary infection models, which accounts for >80 to 90%…”
Background
Geno- and Phenotypic Characteristics of a Klebsiella pneumoniae ST20 Isolate with Unusual Colony Morphology
Sydow, K., Eger, E., Schwabe, M., Heiden, S. E., Bohnert, J. A., Franzenburg, S., Jurischka, C., Schierack, P., & Schaufler, K. (2022) · Microorganisms · doi:10.3390/microorganisms10102063 · Cited by 13
“This matches the WGS data, where only yersiniabactin and enterobactin siderophore systems were found, while aerobactin, the dominant siderophore in hvKp [64], was absent.”
BackgroundResult
Community-acquired liver abscess caused by capsular genotype K2-ST375 hypervirulent Klebsiella pneumoniae isolates
Hoashi, K., Harada, S., Ishii, Y., Aoki, K., Ishikawa, S., Oshiro, Y., & Shinzato, T. (2019) · IDCases · doi:10.1016/j.idcr.2019.e00577 · Cited by 14
“pneumoniae isolate showed that, compared with other siderophores produced by the species, aerobactin had most significant impact on the bacterial growth in human ascites and serum as well as virulence in a mouse infection model [17].”
Result
Carbapenem resistance and hypervirulence in Klebsiella pneumoniae are raising global public health concerns in the 21st century
Thacharodi, A., Ahmed, T., Hassan, S., Singh, P. K., Saraswathi, A., & Pugazhendhi, A. (2026) · iScience · doi:10.1016/j.isci.2026.114782 · Cited by 13
“89 Salmochelin, aerobactin, and yersiniabactin are more common in hvKp strains than in classical K. pneumoniae (cKp) strains.”
Urban wastewater contributes to the emergence of carbapenem-resistant Klebsiella pneumoniae (CRKP) in an urban receiving river in eastern India
Sahoo, S., Sahoo, R. K., Gaur, M., Behera, D. U., Sahu, A., Das, A., Dey, S., Dixit, S., & Subudhi, E. (2022) · Letters in Applied Microbiology · doi:10.1093/lambio/ovac005 · Cited by 12
Population dynamics and characteristics of Klebsiella pneumoniae from healthy poultry in Norway
Kaspersen, H. P., Urdahl, A. M., Franklin‐Alming, F. V., Ilag, H. K., Hetland, M. A. K., Bernhoff, E., Löhr, I. H., & Sunde, M. (2023) · Frontiers in Microbiology · doi:10.3389/fmicb.2023.1193274 · Cited by 13
“The loss of the salmochelin locus in the 2020 ST4710 isolates may therefore be related to fitness, since salmochelin does not contribute significantly to siderophore production in the presence of the aerobactin locus (Russo et al., 2015).”
Background
The Rapid Emergence of Hypervirulent Klebsiella Species and Burkholderia pseudomallei as Major Health Threats in Southeast Asia: The Urgent Need for Recognition as Neglected Tropical Diseases
Kain, M. J. W., Reece, N., Parry, C. M., Rajahram, G. S., Paterson, D. L., & Woolley, S. (2024) · Tropical Medicine and Infectious Disease · doi:10.3390/tropicalmed9040080 · Cited by 13
The First Case of Community-Acquired Pneumonia Due to Capsular Genotype K2-ST86 Hypervirulent Klebsiella pneumoniae in Okinawa, Japan: A Case Report and Literature Review
Hirai, J., Sakanashi, D., Kinjo, T., Haranaga, S., & Fujita, J. (2020) · Infection and Drug Resistance · doi:10.2147/idr.s252637 · Cited by 13
An integrated IncFIB/IncFII plasmid confers hypervirulence and its fitness cost and stability
Zhao, Q., Feng, Y., & Zong, Z. (2022) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-022-04407-6 · Cited by 13
“Typically, pLVPK-like plasmids are not self-transmissible due to the lack of a complete conjugation module [2, 3].”
Background
Association of Virulence with Antimicrobial Resistance among Klebsiella pneumoniae Isolated from Hospital Settings in Bangladesh
Kawser, Z., & Shamsuzzaman, S. (2022) · International Journal of Applied and Basic Medical Research · doi:10.4103/ijabmr.ijabmr_747_21 · Cited by 13
“pneumoniae, aerobactin (encoded by iutA), salmochelin (also known as catechol receptors) (encoded by iroN), and yersiniabactin are the representative siderophores.[6,7] The convergence of hypervirulence and multidrug resistance (MDR) in K.”
Background
The Anti-Virulence Effect of Sub-Minimal Inhibitory Concentrations of Levofloxacin on Hypervirulent Klebsiella pneumoniae
Ma, X., Zhang, L., Yue, C., Liu, Y., & Li, J. (2022) · Infection and Drug Resistance · doi:10.2147/idr.s370273 · Cited by 13
“Recent data have directly demonstrated only aerobactin plays in hvKp growth/survival ex vivo and for the enhanced virulence of the hvKp in vivo.(32) As such, it has been proposed as an anti-virulence target.”
Background
Specificity and mechanism of TonB-dependent ferric catecholate uptake by Fiu
Yang, T., Zou, Y., Ng, H. L., Kumar, A., Newton, S. M., & Klebba, P. E. (2024) · Frontiers in Microbiology · doi:10.3389/fmicb.2024.1355253 · Cited by 11
Discovery, functional characterization, and structural studies of the NRPS-independent siderophore synthetases
Patel, K. D., Fisk, M. B., & Gulick, A. M. (2024) · Critical Reviews in Biochemistry and Molecular Biology · doi:10.1080/10409238.2025.2476476 · Cited by 12
“Genetic disruption of the aerobactin cluster results in strains with reduced virulence in animal infection models (Russo et al. 2015), pointing to the primary role that aerobactin plays in vivo in iron acquisition.”
Low prevalence of hypervirulent Klebsiella pneumoniae in Anatolia, screened via phenotypic and genotypic testing
Örsten, S., Demirci‐Duarte, S., Ünalan-Altıntop, T., Çakar, A., Sancak, B., Ergünay, K., & Özkuyumcu, C. (2020) · Acta Microbiologica et Immunologica Hungarica · doi:10.1556/030.2020.01143 · Cited by 12
Clinical Outcomes and Microbiological Characteristics of Sequence Type 11 Klebsiella pneumoniae Infection
Yang, P., Wu, Z., Liu, C., Zheng, J., Wu, N., Wu, Z., Yi, J., Lu, M., & Shen, N. (2022) · Frontiers in Medicine · doi:10.3389/fmed.2022.889020 · Cited by 12
“Studies have demonstrated that genetic traits perform better than hypermucoviscosity as a marker for differentiating hvKp and cKp (14, 15).”
Background
Molecular epidemiological characteristics of carbapenem-resistant Klebsiella pneumoniae among children in China
Jin, Z., Wang, Z., Gong, L., Yi, L., Liu, N., Luo, L., & Gong, W. (2022) · AMB Express · doi:10.1186/s13568-022-01437-3 · Cited by 12
“pneumoniae has four kinds of iron carriers, namely enterobactin, aerobactin, salmochelin, and yersiniabactin, among which aerobactin, salmochelin, and yersiniabactin are the most common in hvKP (Lawlor et al. 2007; Hsieh et al. 2008; Russo et al. 2015; Lam et al. 2018).”
Background
Study on Virulence Genes, Drug Resistance and Molecular Epidemiology of Klebsiella pneumoniae with High Virulence in Inner Mongolia, China
Li, H., Zhang, L., Zhang, W., Li, J., Li, Y., & Hu, T.-P. (2023) · Infection and Drug Resistance · doi:10.2147/idr.s391468 · Cited by 12
“5% of PLA-derived KPN isolates carry this gene.(33,34) In addition, in KPN strains, common virulence factors are aerobic actin (aero), irp2, iucD, iutA, iron, kfu, ybtA, entB (encoding siderophore), wcaG, fimH (encoding type-1 bacteria [hair]) and mrkD (encoding type-3 fimbriae).”
Background
Forging biofilms: metal-induced microbial responses in biofilm formation
Price, S. L., & Skaar, E. P. (2025) · Journal of Bacteriology · doi:10.1128/jb.00247-25 · Cited by 15
“The ability of K. pneumoniae strains to produce multiple siderophores has been linked with hypervirulence and hypermucoviscosity, which enhances liver abscess formation (180, 181).”
Emergence of Ceftazidime–Avibactam Resistance and Decreased Virulence in Carbapenem-Resistant ST11 Klebsiella pneumoniae During Antibiotics Treatment
Xu, M., Qian, C., Jia, H., Feng, L., Shi, S., Zhang, Y., Wang, L., Cao, J., Zhou, T., & Zhou, C. (2022) · Infection and Drug Resistance · doi:10.2147/idr.s387187 · Cited by 11
“It has been reported that aerobactin encoded by the iucABCD operon accounts for >90% of the siderophore activity and plays a crucial role in the growth and survival of hvKP in vivo and in vitro.(35) However, our results showed that FK8578 still has a high fatality rate in G.”
Result
Utilizing an iron( iii )-chelation masking strategy to prepare mono- and bis-functionalized aerobactin analogues for targeting pathogenic bacteria
Ho, Y.-H., Ho, S., Hsu, C., Shie, J., & Wang, T. A. (2017) · Chemical Communications · doi:10.1039/c7cc05197b · Cited by 11
Genome-Based Analysis of a Sequence Type 1049 Hypervirulent Klebsiella pneumoniae Causing Bacteremic Neck Abscess
Lan, P., Zhao, D., Gu, J. Y., Shi, Q., Yan, R., Jiang, Y., Zhou, J., & Yu, Y. (2021) · Frontiers in Microbiology · doi:10.3389/fmicb.2020.617651 · Cited by 11
Genome-Based Analysis of a Multidrug-Resistant Hypervirulent Klebsiella pneumoniae
Lv, F., Wang, W., Luo, Y., Wang, H., Zhi, T., Li, X., Guo, Z., & Zhao, Z. (2022) · Microbial Drug Resistance · doi:10.1089/mdr.2021.0307 · Cited by 10
“Especially, aerobactin is the dominant siderophore and has been regarded as the critical virulence factor for systemic infection with hvKP. 10 Therefore, the major virulence genes ( rmpA , rmpA2 , iucA , and iroB ) have usually been used as potential biomarkers for differentiating hvKP from cKP. 13…”
Phenotypic and genetic characterization of hypervirulent Klebsiella pneumoniae in patients with liver abscess and ventilator-associated pneumonia
Guo, M., Gao, B., Su, J., Zeng, Y., Cui, Z., Liu, H., Guo, X., Zhu, Y., Wei, B., Zhao, Y., et al. (2023) · BMC Microbiology · doi:10.1186/s12866-023-03022-5 · Cited by 10
“In this study, we found that iucA , one of the genes in the iuc operon encoding aerobactin, a critical mediator of virulence, and it is significant differences in genome distribution between the VAP and PLA strains, although the strains studied were somewhat different in cKp and hvKp [40, 41].”
Background
Genetic Characterization of a Conjugative Plasmid That Encodes Azithromycin Resistance in Enterobacteriaceae
Liu, X., Yang, X., Ye, L., Chan, E. W., & Chen, S. (2022) · Microbiology Spectrum · doi:10.1128/spectrum.00788-22 · Cited by 10
“90% of the siderophore activity, despite the fact that hvKP produces multiple siderophores (17).”
Background
Clinical and Microbiologic Analysis of Klebsiella pneumoniae Infection: Hypermucoviscosity, Virulence Factor, Genotype, and Antimicrobial Susceptibility
Hyun, M., Lee, J. Y., & Kim, H. A. (2024) · Diagnostics · doi:10.3390/diagnostics14080792 · Cited by 9
“Many studies on hypervirulent K. pneumoniae have been conducted over the years, and some researchers suggested that not only hypermucoviscosity but also aerobactin could be used to evaluate hypervirulence [12–14].”
Background
Conjugative transmission of virulence plasmid in Klebsiella pneumoniae mediated by a novel IncN-like plasmid
Xu, Q., Xie, M., Yang, X., Liu, X., Ye, L., Chen, K., Chan, E. W., & Chen, S. (2024) · Microbiological Research · doi:10.1016/j.micres.2024.127896 · Cited by 9
The dissemination of multidrug-resistant and hypervirulent Klebsiella pneumoniae clones across the Kingdom of Saudi Arabia
Huang, J., Alhejaili, A. Y., Alkherd, U. H., Milner, M., Zhou, G., AlZahrani, D., Banzhaf, M., Alzaidi, A. A., Rajeh, A. A., Al-Otaiby, M. A., et al. (2024) · Emerging Microbes & Infections · doi:10.1080/22221751.2024.2427793 · Cited by 10
“A total of 163 strains contained the siderophore aerobactin iuc locus, which is known to be directly associated with sepsis and the promotion of bacterial growth in the bloodstream [10,22] (Figure 2, Figure 4B).”
Evolution and transmission potential of iuc3-positive virulence plasmids in hypervirulent Klebsiella pneumoniae
Wang, J., Ji, X., García, P., Li, J., Zhang, L., Wang, H., Wang, R., & He, T. (2025) · Microbiological Research · doi:10.1016/j.micres.2025.128242 · Cited by 9
The Genus Klebsiella: An Ever-Expanding Panorama of Infections, Disease-Associated Syndromes, and Problems for Clinical Microbiologists
Janda, J. M. (2015) · Cited by 9
Characterization of Virulence Factors And Antibacterial Activity of Curcumin in Hypervirulent Klebsiella Pneumoniae
Karami‐Zarandi, M., Ghaleh, H. E. G., & Ranjbar, R. (2022) · Future Microbiology · doi:10.2217/fmb-2021-0222 · Cited by 8
ST218 Klebsiella pneumoniae became a high-risk clone for multidrug resistance and hypervirulence
Yang, P., Liu, C., Du, P., Yi, J., Wu, Z., Zheng, J., Shen, N., Cui, L., & Lu, M. (2024) · BMC Microbiology · doi:10.1186/s12866-024-03205-8 · Cited by 8
“Thomas and his colleagues found that aerobactin plays important roles in hypervirulence [5].”
Background
Enhanced invasion and survival of antibiotic- resistant Klebsiella pneumoniae pathotypes in host cells and strain-specific replication in blood
Klaper, K., Pfeifer, Y., Heinrich, L., Prax, M., Krut, O., Bekeredjian‐Ding, I., Wahl, A., Fischer, M. A., Kaspar, H., Borgmann, S., et al. (2025) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2025.1522573 · Cited by 8
New insights and perspectives on the virulence of hypervirulent Klebsiella pneumoniae
Mba, I. E., Odunayo, T., Uwazie, C. K., Aina, F. A., Kemisola, A. O., & Uwazie, I. J. (2025) · Folia Microbiologica · doi:10.1007/s12223-025-01261-9 · Cited by 8
“Generally, the key virulence factors that play an important role in the pathogenicity of hvKp include the siderophore, salmochelin, and capsular polysaccharides (Russo et al. 2015).”
Mobile genetic elements in shaping Klebsiella pneumoniae pathogenicity
Li, Y., & Farzana, R. (2026) · Frontiers in Microbiology · doi:10.3389/fmicb.2025.1730961 · Cited by 9
Hypervirulent Klebsiella pneumoniae: Epidemiology, virulence factors, and antibiotic resistance
Hefzy, E. M., Taha, R. M., Salam, S. A. E., Abdelmoktader, A., & Khalil, M. A. F. (2023) · Novel Research in Microbiology Journal · doi:10.21608/nrmj.2023.287177 · Cited by 8
“…transporter), iuc (biosynthetic genes for such siderophore aerobactin), rmpA, and rmpA2 (regulators that promote the capsule formation), are the most wellknown virulence factors with an experimental evidence for conferring the hypervirulent phenotype (Russo et al., 2015; Bulger et al., 2017).”
Background
Proline-rich antimicrobial peptide Api137 is bactericidal in porcine blood infected ex vivo with a porcine or human Klebsiella pneumoniae strain
Krieger, A.-K., Knappe, D., Öhlmann, S., Mayer, L., Eder, I. B., Köller, G., Hoffmann, R., Rieckmann, K., & Baums, C. G. (2020) · Journal of Global Antimicrobial Resistance · doi:10.1016/j.jgar.2020.12.012 · Cited by 8
Fatal fulminant community-acquired pneumonia caused by hypervirulent Klebsiella pneumoniae K2-ST86
Yamamoto, H., Iijima, A., Kawamura, K., Matsuzawa, Y., Suzuki, M., & Arakawa, Y. (2020) · Medicine · doi:10.1097/md.0000000000020360 · Cited by 8
“[9] Moreover, aerobactin, a dominant siderophore produced by hvKp, is required for the in vivo growth of the bacterial pathogens and is considered a crucial factor for their hypervirulence.([10]) In addition, glucose intolerance, presumably due to chronic alcohol changes, might have affected the catastrophic phenotype…”
Background

Authors: Russo, T. A., Olson, R., MacDonald, U., Beanan, J., & Davidson, B. A.
Affiliations: VA Western New York Healthcare System (US)
ORCID: Russo, Thomas A.
MacDonald, Ulrike
Davidson, Bruce A.
Venue: Infection and Immunity
Publisher: American Society for Microbiology
Published: 2015-08
Volume: 83
Issue: 8
Pages: 3325-3333
ISSN: 0019-9567 (ISSN-L)
1098-5522
DOI: 10.1128/iai.00430-15
PMC: PMC4496593
OpenAlex: W2283434174
Semantic Scholar: e716de1372bc2153e94e76130028b8b30a86c6b0
Cited by: 305
References: 49
Citations by year: 2026: 32 · 2025: 32 · 2024: 34 · 2023: 33 · 2022: 56 · 2021: 28 · 2020: 25 · 2019: 16 · 2018: 24 · 2017: 11 · 2016: 13 · 2015: 1
FWCI: 12.66
Type: journal article
Language: en
Open access: bronze
doi.org
Licence: journals.asm.org/non-commercial-tdm-license (tdm)
Locations: Infection and Immunity (publishedVersion)
Europe PMC (PubMed Central) (publishedVersion)
PubMed Central (publishedVersion)
PubMed (publishedVersion)
Funders: U.S. Department of Veterans Affairs
National Institutes of Health (W81XWH)
National Institute of Allergy and Infectious Diseases (R21AI088318)
Telemedicine and Advanced Technology Research Center
Topics: Life Sciences › Immunology and Microbiology › Microbiology › Escherichia coli research studies
Life Sciences › Immunology and Microbiology › Microbiology › Enterobacteriaceae and Cronobacter Research
Health Sciences › Medicine › Microbiology (medical) › Antibiotic Resistance in Bacteria
Keywords: aerobactin, yersiniabactin, salmochelin, enterobactin, siderophores, hypervirulent Klebsiella pneumoniae, hypermucoviscous Klebsiella pneumoniae, virulence factors, iron acquisition, iucA, IRP2, entB, iroB, systemic infection, pulmonary infection, ascitic fluid, human serum, human urine
MeSH terms: Animals, Enterobactin, Glucosides, Humans, Hydroxamic Acids, Klebsiella Infections, Klebsiella pneumoniae, Male, Phenols, Thiazoles, Virulence, Siderophores, Microbial Viability, Mice, Young Adult

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Aerobactin, but Not Yersiniabactin, Salmochelin, or Enterobactin, Enables the Growth/Survival of Hypervirulent (Hypermucoviscous) Klebsiella pneumoniae Ex Vivo and In Vivo

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks