The DOI matches its Crossref record; 50 of the 50 references it cites were found in a registry or an index.
Aerobactin, but Not Yersiniabactin, Salmochelin, or Enterobactin, Enables the Growth/Survival of Hypervirulent (Hypermucoviscous) Klebsiella pneumoniae Ex Vivo and In Vivo
Open accessAbstract
The siderophore aerobactin is the dominant siderophore produced by hypervirulent Klebsiella pneumoniae (hvKP) and was previously shown to be a major virulence factor in systemic infection. However, strains of hvKP commonly produce the additional siderophores yersiniabactin, salmochelin, and enterobactin. The roles of these siderophores in hvKP infection have not been optimally defined. To that end, site-specific gene disruptions were created in hvKP1 (wild type), resulting in the generation of hvKP1Δ iucA (aerobactin deficient), hvKP1Δ iroB (salmochelin deficient), hvKP1Δ entB (enterobactin and salmochelin deficient), hvKP1Δ irp2 (yersiniabactin deficient), and hvKP1Δ entB Δ irp2 (enterobactin, salmochelin, and yersiniabactin deficient). The growth/survival of these constructs was compared to that of their wild-type parent hvKP1 ex vivo in human ascites fluid, human serum, and human urine and in vivo in mouse systemic infection and pulmonary challenge models. Interestingly, in contrast to aerobactin, the inability to produce enterobactin, salmochelin, or yersiniabactin individually or in combination did not decrease the ex vivo growth/survival in human ascites or serum or decrease virulence in the in vivo infection models. Surprisingly, none of the siderophores increased growth in human urine. In human ascites fluid supplemented with exogenous siderophores, siderophores increased the growth of hvKP1Δ iucA , with the relative activity being enterobactin > aerobactin > yersiniabactin > salmochelin, suggesting that the contribution of aerobactin to virulence is dependent on both innate biologic activity and quantity produced. Taken together, these data confirm and extend a role for aerobactin as a critical virulence factor for hvKP. Since it appears that aerobactin production is a defining trait of hvKP strains, this factor is a potential antivirulence target.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The cited source doesn’t support the claim as written.
In the citing paper
“The elaboration and acquisition of the latter three siderophores are associated with the pathogenesis and hypervirulence of K. pneumoniae (1,44,53,54).”
From Siderophore-mediated iron acquisition by Klebsiella pneumoniae (2024) · cites this paper as [54]
Checked by a reasoning model — may be wrong.
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“However, unlike FeEnt, FeAbn uptake was not inhibited by SCN, reinforcing its importance in the pathogenesis of hvKp1 (54).”
From Siderophore-mediated iron acquisition by Klebsiella pneumoniae (2024) · cites this paper as [54]
Experimental — accuracy not yet measuredIn the citing paper
“The glucosylated ferric catecholate does not adsorb well to siderocalin ( Kumar et al., 2022 ), which promotes the pathogenesis of clinical isolates of E. coli, K. pneumoniae, and Salmonella typhimurium in human and animal hosts ( Russo et al., 2011 , 2015 ).”
From Specificity and mechanism of TonB-dependent ferric catecholate uptake by Fiu (2024) · cites this paper as Russo et al., 2015
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
Guide for the Care and Use of Laboratory Animals: Eighth Edition
(2011) · doi:10.17226/12910 · Cited by 16,199
Lipocalin 2 mediates an innate immune response to bacterial infection by sequestrating iron
Flo, T. H., Smith, K. D., Sato, S., Rodriguez, D. J., Holmes, M. A., Strong, R. K., Akira, S., & Aderem, A. (2004) · Nature · doi:10.1038/nature03104 · Cited by 1,877
Siderophore-Based Iron Acquisition and Pathogen Control
Miethke, M., & Marahiel, M. A. (2007) · Microbiology and Molecular Biology Reviews · doi:10.1128/mmbr.00012-07 · Cited by 1,774
Chemistry and biology of siderophores
Hider, R. C., & Kong, X. (2010) · Natural Product Reports · doi:10.1039/b906679a · Cited by 1,722
Guide for the Care and Use of Laboratory Animals (8th edn)
Albus, U. (2012) · Laboratory Animals · doi:10.1258/la.2012.150312 · Cited by 1,706
Weinberg, E. D. (1978) · Microbiological Reviews · doi:10.1128/mmbr.42.1.45-66.1978 · Cited by 1,254
Neilands, J. B. (1981) · Annual Review of Biochemistry · doi:10.1146/annurev.bi.50.070181.003435 · Cited by 1,232
Hypervirulent (hypermucoviscous) Klebsiella pneumoniae
Shon, A. S. Y., Bajwa, R. P. S., & Russo, T. A. (2013) · Virulence · doi:10.4161/viru.22718 · Cited by 1,217
Self-citation(2018) · doi:10.1001/jama · Cited by 932
Snitkin, E. S., Zelazny, A. M., Thomas, P. J., Stock, F., Program, N. C. S., Henderson, D. K., Palmore, T. N., & Segre, J. A. (2012) · Science Translational Medicine · doi:10.1126/scitranslmed.3004129 · Cited by 863
Research works printed but not linked: 1
- 10.1128/mr.42.1.45-66.1978 · DOI · Paper page
Cited by
Sorted by citations
Items 301–315 of 315
Atypical ocular and vascular manifestations of Klebsiella liver abscess syndrome
Ahsan, S., Desai, K., Horani, G., Mercado, I., Munshi, H., Ekin, U., Mubarak, Y., Mohammed, R., Zahran, A., & Leou, K. (2026) · Radiology Case Reports · doi:10.1016/j.radcr.2026.02.065
“Additionally, siderophore systems, particularly aerobactin, are key virulence factors that facilitate iron acquisition and systemic dissemination [ 2 ,10 ,11 ].”
Gao, D., Huang, J., Pian, Y., Qing, X., Tang, Y., Zhao, J., Lu, C., Leng, B., Yang, H., & Huang, Z. (2026) · Research Square · doi:10.21203/rs.3.rs-8594311/v1
Guo, Y., Shang, Y., Han, W., Gao, H., Wang, B., Zhou, Y., & Yu, F. (2026) · BMC Microbiology · doi:10.1186/s12866-026-05151-z
“Accordingly, iucA represents a robust bio-marker for hvKP [41].”
Maghembe, R. S. (2026) · Discover Bacteria. · doi:10.1007/s44351-026-00053-x
Afzaruddin, S. S., Ishak, N. H., Hamid, S. B. S., Ismail, Z., & Shabani, N. R. M. (2026) · Biochimie · doi:10.1016/j.biochi.2026.06.014 · Cited by 1
Shi, L., Li, Z., Li, X. J., Tang, S., Lai, H., Wu, J., Zhou, Y., & Fu, L. (2026) · Probiotics and Antimicrobial Proteins · doi:10.1007/s12602-026-11133-4
Nguyen, M. N., Weber, A., Xavier, B. B., Ruiz, J. P. R., Kola, A., Behnke, M., Geffers, C., Goossens, H., Harbarth, S., Bonten, M. J. M., et al. (2026) · Microbial Genomics · doi:10.1099/mgen.0.001707
Swain, P. P., Sahoo, R. K., & Subudhi, E. (2026) · World Journal of Microbiology and Biotechnology · doi:10.1007/s11274-026-05162-y
“HvKp strains typically produce multiple siderophore including enterobac-tin, salmochelin, yersiniabactin and aerobactin; with aero-bactin ( iucA ), accounting to approximately 80–90% of total siderophore production, and is considered a defining trait of hvKp (Russo et al. 2015).”
Global Trends and Current Status of Research on Hypervirulent Klebsiella pneumoniae
Huang, Y., Liu, T., Li, B., Dong, F., Li, X., Lin, R., Chen, Y. ‐., Chen, B., Zhang, S., Cheng, Y., et al. (2026) · International Journal of Clinical Practice · doi:10.1155/ijcp/8315039
Ren, Y., Li, X., Ju, L., Yao, Y., Chen, X., & Wang, X. (2026) · International Microbiology · doi:10.1007/s10123-026-00888-z
Zou, Y., He, J., Duan, L., Li, W., Shao, X., Wen, L., He, Y., Qi, N., & Guo, J. J. (2026) · Organic Letters · doi:10.1021/acs.orglett.6c03421
Ahmad, N., Jayalekshmi, S. K., & Zughaier, S. M. (2026) · Journal of Infection and Public Health · doi:10.1016/j.jiph.2026.103363
Duarte-Zambrano, L., Martínez-Barnetche, J., Alvarado‐Delgado, A., & Garza–Ramos, U. (2026) · Emerging Microbes & Infections · doi:10.1080/22221751.2026.2732725
“Isolates deficient in aerobac-tin exhibit significantly reduced growth in vitro and ex vivo [40].”
Zha, H., Shi, Q., 黎永新, Liu, C., & Zhang, X. (2026) · Pathogens · doi:10.3390/pathogens15101089
“…322 56 iroB [20] ATCTCATCATCTACCCTCCGCTC GGTTCGCCGTCGTTTTCAA 322 56 peg-344 [22] GCGGGAAAGGACAGAAAGCCAGTG GAGGGAAGATGAGAAATACGAGC 332 56 irp2 [26] GCATTTTCCGTATCGCTCT GCTTCATAACCTGCCTGATG 2656 56 iutA [25] GGCTGGACATCATGGGAACTGG CGTCGGGAACGGGTAGAATCG 302 66 ybts [20] GACGGAAACAGCACGGTAAA…”
Natural variation of hypervirulent Klebsiella pathogenicity loci among Taiwan bloodstream isolates
Schofield, M. C., Cronin, R. M., Usi, N. D., Nozick, S., Hauser, A. R., Chiu, C., & Kochan, T. J. (2026) · mSphere · doi:10.1128/msphere.00457-26
“The requirement for aerobactin may instead be specific for certain lineages, such as those related to hvKP1 (e.g., ST86, KL2) (67).”
Metadata
- Authors
- Russo, T. A., Olson, R., MacDonald, U., Beanan, J., & Davidson, B. A.
- Affiliations
- VA Western New York Healthcare System (US)
- Venue
- Infection and Immunity
- Publisher
- American Society for Microbiology
- Published
- 2015-08
- Volume
- 83
- Issue
- 8
- Pages
- 3325-3333
- ISSN
- 0019-9567 (ISSN-L)
- 1098-5522
- PMC
- PMC4496593
- OpenAlex
- W2283434174
- Semantic Scholar
- e716de1372bc2153e94e76130028b8b30a86c6b0
- Cited by
- 305
- References
- 49
- Citations by year
- 2026: 32 · 2025: 32 · 2024: 34 · 2023: 33 · 2022: 56 · 2021: 28 · 2020: 25 · 2019: 16 · 2018: 24 · 2017: 11 · 2016: 13 · 2015: 1
- FWCI
- 12.66
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Locations
- Infection and Immunity (publishedVersion)
- Europe PMC (PubMed Central) (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Funders
- U.S. Department of Veterans Affairs
- National Institutes of Health (W81XWH)
- National Institute of Allergy and Infectious Diseases (R21AI088318)
- Telemedicine and Advanced Technology Research Center
- Topics
- Life Sciences › Immunology and Microbiology › Microbiology › Escherichia coli research studies
- Life Sciences › Immunology and Microbiology › Microbiology › Enterobacteriaceae and Cronobacter Research
- Health Sciences › Medicine › Microbiology (medical) › Antibiotic Resistance in Bacteria
- Keywords
- aerobactin, yersiniabactin, salmochelin, enterobactin, siderophores, hypervirulent Klebsiella pneumoniae, hypermucoviscous Klebsiella pneumoniae, virulence factors, iron acquisition, iucA, IRP2, entB, iroB, systemic infection, pulmonary infection, ascitic fluid, human serum, human urine
- MeSH terms
- Animals, Enterobactin, Glucosides, Humans, Hydroxamic Acids, Klebsiella Infections, Klebsiella pneumoniae, Male, Phenols, Thiazoles, Virulence, Siderophores, Microbial Viability, Mice, Young Adult
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
