Cited by 159Antifungal resistance and susceptibilityYeasts and Rust Fungi StudiesBacterial Identification and Susceptibility Testing

The DOI matches its Crossref record; 30 of the 30 references it cites were found in a registry or an index.

Rapid Identification of Candida Species with Species-Specific DNA Probes

Open access

Elie, Cheryl M., Lott, Timothy J., Reiss, Errol, Morrison, Christine J.·1998·Journal of Clinical Microbiology

DOI 10.1128/jcm.36.11.3260-3265.1998PMC PMC105312

Open this paper in CoChat — free account Open PDF

Abstract

Rapid identification of Candida species has become more important because of an increase in infections caused by species other than Candida albicans , including species innately resistant to azole antifungal drugs. We previously developed a PCR assay with an enzyme immunoassay (EIA) format to detect amplicons from the five most common Candida species by using universal fungal primers and species-specific probes directed to the ITS2 region of the gene for rRNA. We designed probes to detect seven additional Candida species ( C. guilliermondii , C. kefyr , C. lambica , C. lusitaniae , C. pelliculosa , C. rugosa , and C. zeylanoides ) included in the API 20C sugar assimilation panel, five probes for species not identified by API 20C ( C. haemulonii , C. norvegica , C. norvegensis , C. utilis , and C. viswanathii ), and a probe for the newly described species C. dubliniensis , creating a panel of 18 Candida species probes. The PCR-EIA correctly identified multiple strains of each species tested, including five identified as C. albicans by the currently available API 20C database but determined to be C. dubliniensis by genotypic and nonroutine phenotypic characteristics. Species identification time was reduced from a mean of 3.5 days by conventional identification methods to 7 h by the PCR-EIA. This method is simple, rapid, and feasible for identifying Candida species in clinical laboratories that utilize molecular identification techniques and provides a novel method to differentiate the new species, C. dubliniensis , from C. albicans .

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1128/jcm.36.11.3260-3265.1998

Cites

30 of 30 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics
White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990) · PCR Protocols · doi:10.1016/b978-0-12-372180-8.50042-1 · Cited by 36,648
Manual of Clinical Microbiology.
(1980) · Annals of Internal Medicine · doi:10.7326/0003-4819-93-6-939_2 · Cited by 14,435
Avoiding false positives with PCR
Kwok, S., & Higuchi, R. (1989) · Nature · doi:10.1038/339237a0 · Cited by 3,407
Epidemiology of nosocomial fungal infections
Fridkin, S. K., & Jarvis, W. R. (1996) · Clinical Microbiology Reviews · doi:10.1128/cmr.9.4.499 · Cited by 782
Candida dubliniensis sp. nov.: phenotypic and molecular characterization of a novel species associated with oral candidosis in HIV-infected individuals
Sullivan, D. J., Haynes, K. A., Bennett, D. E., Coleman, D. C., & Westerneng, T. J. (1995) · Microbiology · doi:10.1099/13500872-141-7-1507 · Cited by 763
Epidemiology of Nosocomial Fungal Infections, with Emphasis on Candida Species
Jarvis, W. R. (1995) · Clinical Infectious Diseases · doi:10.1093/clinids/20.6.1526 · Cited by 636
Importance of Candida Species Other than C. albicans as Pathogens in Oncology Patients
Wingard, J. R. (1995) · Clinical Infectious Diseases · doi:10.1093/clinids/20.1.115 · Cited by 542
Nosocomial Candidemia: Risk Factors and Attributable Mortality
Wenzel, R. P. (1995) · Clinical Infectious Diseases · doi:10.1093/clinids/20.6.1531 · Cited by 502
Candida dubliniensis : Characteristics and Identification
Sullivan, D. J., & Coleman, D. C. (1998) · Journal of Clinical Microbiology · doi:10.1128/jcm.36.2.329-334.1998 · Cited by 383
Antifungal susceptibility testing of isolates from a randomized, multicenter trial of fluconazole versus amphotericin B as treatment of nonneutropenic patients with candidemia. NIAID Mycoses Study Group and the Candidemia Study Group
Rex, J. H., Pfaller, M. A., Barry, A. L., Nelson, P. W., & Webb, C. D. (1995) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.39.1.40 · Cited by 300

Show all 30 references

Research works printed but not linked: 1

Westerman J. M. Elie C. M. Morrison C. J. Improved identification of Candida species using biotinylated species-specific DNA probes abstr. J107 Abstracts of the 38th Interscience Conference on Antimicrobial Agents and Chemotherapy. 1998 481 American Society for Microbiology Washington D.C

Sorted by citations

Incidence of Bloodstream Infections Due to Candida Species and In Vitro Susceptibilities of Isolates Collected from 1998 to 2000 in a Population-Based Active Surveillance Program
Hajjeh, R. A., Sofair, A. N., Harrison, L. H., Lyon, G. M., Arthington-Skaggs, B. A., Mirza, S. A., Phelan, M., Morgan, J., Lee-Yang, W., Ciblak, M. A., et al. (2004) · Journal of Clinical Microbiology · doi:10.1128/jcm.42.4.1519-1527.2004 · Cited by 649
“based PCR-enzyme immunoassay method (7, 10).”
Combination antifungal therapy
Johnson, M. D., MacDougall, C., Ostrosky-Zeichner, L., Perfect, J. R., & Rex, J. H. (2004) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.48.3.693-715.2004 · Cited by 541
“Newer technologies can provide nontraditional methods for the estimation of fungal burden levels in human tissues or serum (29, 32, 45, 64, 65, 70, 72, 76, 83, 84, 86, 108, 109, 110, 112, 131, 132, 134, 177, 211, 220, 221), but these assays have generally been developed with the objective of diagnosing disease rather…”
Background
Recurrent vulvovaginal candidiasis
Sobel, J. D. (2016) · American Journal of Obstetrics and Gynecology · doi:10.1016/j.ajog.2015.06.067 · Cited by 502
Rapid Identification of Fungi by Using the ITS2 Genetic Region and an Automated Fluorescent Capillary Electrophoresis System
Turenne, C. Y., Sanche, S. E., Hoban, D. J., Karlowsky, J. A., & Kabani, A. M. (1999) · Journal of Clinical Microbiology · doi:10.1128/jcm.37.6.1846-1851.1999 · Cited by 435
“Amplification techniques, with subsequent probing of the amplicons with species-specific probes or in a PCR-enzyme immunoassay format, have been utilized to overcome the problems of sensitivity, specificity, and delay encountered with conventional methodology (4, 5, 7, 10, 22, 24, 29).”
Method
Utilization of the internal transcribed spacer regions as molecular targets to detect and identify human fungal pathogens
Iwen, P. C., Hinrichs, S. H., & Rupp, M. E. (2002) · Medical Mycology · doi:10.1080/mmy.40.1.87.109 · Cited by 380
Identification of Medically Important Yeast Species by Sequence Analysis of the Internal Transcribed Spacer Regions
Leaw, S. N., Chang, H. C., Sun, H. S., Barton, R., Bouchara, J.-P., & Chang, T. C. (2006) · Journal of Clinical Microbiology · doi:10.1128/jcm.44.3.693-699.2006 · Cited by 308
“phism (15, 28, 45), DNA probe hybridization (7, 10, 25, 29, 48),”
Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR
Luo, G., & Mitchell, T. G. (2002) · Journal of Clinical Microbiology · doi:10.1128/jcm.40.8.2860-2865.2002 · Cited by 297
“Primers CGL1-CGL2, CTR1-CTR2, and CPA1-CPA2 were combined in one multiplex PCR to identify Candida glabrata, Candida tropicalis, and Candida parapsilosis, respectively (multiplex G-T-P); primers AFUM1-AFUM2, CALB1-CALB2, and CN5-CN4 were combined in another multiplex PCR to identify A. fumigatus, Candida albicans, and…”
BackgroundInfluential
Performance and Cost Analysis of Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry for Routine Identification of Yeast
Dhiman, N., Hall, L., Wohlfiel, S. L., Buckwalter, S. P., & Wengenack, N. L. (2011) · Journal of Clinical Microbiology · doi:10.1128/jcm.02381-10 · Cited by 294
“albidus, and Trichosporon asahii) are rare and often require molecular methods for identification at the species level (3, 6, 8, 26, 32).”
Background
Current Status of Nonculture Methods for Diagnosis of Invasive Fungal Infections
Yeo, S. F., & Wong, B. (2002) · Clinical Microbiology Reviews · doi:10.1128/cmr.15.3.465-484.2002 · Cited by 277
“tion products in an EIA that provides either a colorimetric or fluorescence readout—was developed (57, 63, 68, 95, 126).”
Identification of Medically Important Yeasts Using PCR-Based Detection of DNA Sequence Polymorphisms in the Internal Transcribed Spacer 2 Region of the rRNA Genes
Chen, Y. C., Eisner, J. D., Kattar, M. M., Rassoulian-Barrett, S. L., LaFe, K., Yarfitz, S. L., Limaye, A. P., & Cookson, B. T. (2000) · Journal of Clinical Microbiology · doi:10.1128/jcm.38.6.2302-2310.2000 · Cited by 273
A One-Enzyme PCR-RFLP Assay for Identification of Six Medically Important Candida Species
Mirhendi, H., Makimura, K., Khoramizadeh, M., & Yamaguchi, H. (2006) · Nippon Ishinkin Gakkai Zasshi · doi:10.3314/jjmm.47.225 · Cited by 246
Comparison of the epidemiology, drug resistance mechanisms, and virulence of and
Sullivan, D. J., Moran, G. P., Pinjon, E., Mosaid, A. A., Stokes, C. R., Vaughan, C. W., & Coleman, D. C. (2003) · FEMS Yeast Research · doi:10.1016/s1567-1356(03)00240-x · Cited by 234
Laboratory diagnosis of invasive candidiasis.
Ellepola, A. N. B., & Morrison, C. J. (2005) · PubMed · Cited by 209
Self-citation
Rapid identification of fungi by sequencing the ITS1 and ITS2 regions using an automated capillary electrophoresis system
Pryce, T. M., Palladino, S., Kay, I. D., & Coombs, G. W. (2003) · Medical Mycology · doi:10.1080/13693780310001600435 · Cited by 207
Yeast identification – past, present, and future methods
Pincus, D., Orenga, S., & Chatellier, S. (2007) · Medical Mycology · doi:10.1080/13693780601059936 · Cited by 196
Development of a DNA Microarray for Detection and Identification of Fungal Pathogens Involved in Invasive Mycoses
Leinberger, D. M., Schumacher, U., Autenrieth, I. B., & Bachmann, T. T. (2005) · Journal of Clinical Microbiology · doi:10.1128/jcm.43.10.4943-4953.2005 · Cited by 155
“This PCR-EIA (11) discriminates the different fungal species by applying the variability of internal transcribed spacer (ITS) region 2 (ITS2).”
Method
Phylogenetic analysis and rapid identification of Candida dubliniensis based on analysis of ACT1 intron and exon sequences
Donnelly, S. M., Sullivan, D. J., Shanley, D. B., & Coleman, D. C. (1999) · Microbiology · doi:10.1099/13500872-145-8-1871 · Cited by 153
“Another study by Elie et al. (1998) reported the development of a C. dubliniensis probe, specific for the internal transcribed spacer region (ITS2) of the ribosomal gene cluster.”
Rapid Identification of Dimorphic and Yeast-Like Fungal Pathogens Using Specific DNA Probes
Lindsley, M. D., Hurst, S. F., Iqbal, N. J., & Morrison, C. J. (2001) · Journal of Clinical Microbiology · doi:10.1128/jcm.39.10.3505-3511.2001 · Cited by 148
“The present study employed a modification of a PCR-enzyme immunoassay (PCR-EIA) method (10, 11) for amplification and differentiation of the major fungal pathogens that possess a yeast-like morphology in vivo.”
MethodInfluentialSelf-citation
A review of nucleic acid-based diagnostic tests for systemic mycoses with an emphasis on polymerase chain reaction-based assays
Chen, S. C. ‐., Halliday, C. L., & Meyer, W. (2002) · Medical Mycology · doi:10.1080/mmy.40.4.333.357 · Cited by 135
A molecular phylogeny of Pythium insidiosum
Schurko, A. M., Mendoza, L., Lévesque, C. A., Désaulniers, N. L., de Cock, A. W. A. M., & Klassen, G. R. (2003) · Mycological Research · doi:10.1017/s0953756203007718 · Cited by 126
Rapid Identification of Yeasts in Positive Blood Cultures by a Multiplex PCR Method
Chang, H. C., Leaw, S. N., Huang, A., Wu, T. L., & Chang, T. C. (2001) · Journal of Clinical Microbiology · doi:10.1128/jcm.39.10.3466-3471.2001 · Cited by 122
Candida dubliniensis, a new fungal pathogen
Fernández, J. G., Morales, P., González, M. A., & Quindós, G. (2002) · Journal of Basic Microbiology · doi:10.1002/1521-4028(200206)42:3 · Cited by 118
Recovery of Candida dubliniensis from Non-Human Immunodeficiency Virus-Infected Patients in Israel
Polacheck, I., Strahilevitz, J., Sullivan, D. J., Donnelly, S. M., Salkin, I. F., & Coleman, D. C. (2000) · Journal of Clinical Microbiology · doi:10.1128/jcm.38.1.170-174.2000 · Cited by 114
Non-culture based diagnostic tests for mycotic infections
Reiss, E., Obayashi, T., Orle, K. A., Yoshida, M., & Zancopé‐Oliveira, R. M. (2000) · Medical Mycology · doi:10.1080/mmy.38.s1.147.159 · Cited by 108
Self-citation
Candida dubliniensisFungemia: the First Four Cases in North America
Brandt, M. E., Harrison, L. H., Pass, M. A., Sofair, A. N., Huie, S., Li, R.-K., Morrison, C. J., Warnock, D. W., & Hajjeh, R. A. (2000) · Emerging infectious diseases · doi:10.3201/eid0601.000108 · Cited by 107
“The identification was confirmed by reactivity of DNA with a polymerase chain reaction (PCR)-enzyme immunoassay (EIA) probe specific for this species (10) and by PCR amplification of a region containing the novel C.”
Self-citation
Rapid Acquisition of Stable Azole Resistance by Candida glabrata Isolates Obtained before the Clinical Introduction of Fluconazole
Borst, A., Raimer, M. T., Warnock, D. W., Morrison, C. J., & Arthington, B. A. (2005) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.49.2.783-787.2005 · Cited by 107
“PCR-enzyme immunoassay as described previously (7).”
Self-citation
Advances in Food Mycology
Hocking, A. D., Thrane, U., Samson, R. A., & Pitt, J. I. (2006) · Advances in experimental medicine and biology · doi:10.1007/0-387-28391-9 · Cited by 101
Development of a PCR-Based Line Probe Assay for Identification of Fungal Pathogens
Martin, C. M., Roberts, D., van der Weide, M., Rossau, R., Jannes, G., Smith, T., & Maher, M. (2000) · Journal of Clinical Microbiology · doi:10.1128/jcm.38.10.3735-3742.2000 · Cited by 98
“Recently several authors have described PCR assays targeting different regions of the fungal genome for detection of Candida (9, 38) and Aspergillus (10, 18, 27, 32) species.”
Background
Rapid identification of candida species by TaqMan PCR
Guiver, M., Levi, K., & Oppenheim, B. A. (2001) · Journal of Clinical Pathology · doi:10.1136/jcp.54.5.362 · Cited by 97
Species identification of medically important fungi by use of real-time LightCycler PCR
Hsu, M.-C., Chen, K.-W., Lo, H., Chen, Y., Liao, M.-H., Lin, Y., & Li, S. (2003) · Journal of Medical Microbiology · doi:10.1099/jmm.0.05302-0 · Cited by 96
“CALB1 TTTATCAACTTGTCACACCAGA � 273 L47111 CALB2 ATCCCGCCTTACCACTACCG L28817 Candida glabrata CGL1 TTATCACACGACTCGACACT � 423 AB032177 CGL2 CCCACATACTGATATGGCCTACAA AF167993 Candida guilliermondii CGU1 GCATCGATGAAGAACGCAGC � 315 AX592669 CGU2 GTTTGGTTGTTGTAAGGCCGGG Elie et al. (1998) Candida krusei CKRU1 GCATCGATGAAGAA…”
Influential
Differentiation of Candida albicans and Candida dubliniensis by Fluorescent In Situ Hybridization with Peptide Nucleic Acid Probes
Oliveira, K., Haase, G., Kurtzman, C. P., Hyldig‐Nielsen, J. J., & Stender, H. (2001) · Journal of Clinical Microbiology · doi:10.1128/jcm.39.11.4138-4141.2001 · Cited by 93
“These methods include fatty acid methyl ester analysis (14), PCR methods (2, 8, 12), DNA fingerprinting (5), -D-glucosidase activity (19), growth at 42 and 45°C (16, 23, 25), and chlamydospore formation (10, 24, 25).”
Method
Antifungal drug resistance: do molecular methods provide a way forward?
Perlin, D. S. (2009) · Current Opinion in Infectious Diseases · doi:10.1097/qco.0b013e3283321ce5 · Cited by 89
“The detection of ribosomal genes, 18S or 28S [38,39], or intervening noncoding regions, ITS1 and ITS2 [ 40 ], facilitate accurate detection of genera and species.”
Method
Tobacco Agar, a New Medium for Differentiating Candida dubliniensis from Candida albicans
Khan, Z. U., Ahmad, S., Mokaddas, E. M., & Chandy, R. G. (2004) · Journal of Clinical Microbiology · doi:10.1128/jcm.42.10.4796-4798.2004 · Cited by 83
“dubliniensis, but these tests are labor-intensive and may not be readily available (2, 5, 6).”
Background
Identification of Four Distinct Genotypes of Candida dubliniensis and Detection of Microevolution In Vitro and In Vivo
Gee, S. F., Joly, S., Soll, D. R., Meis, J. F. G. M., Verweij, P. E., Polacheck, I., Sullivan, D. J., & Coleman, D. C. (2002) · Journal of Clinical Microbiology · doi:10.1128/jcm.40.2.556-574.2002 · Cited by 83
“Phenotype-based tests such as the analysis of carbohydrate assimilation profiles using commercial yeast identification systems (38), growth temperature (39), differentially colored primary colonies on CHROMagar Candida medium (8, 34), chlamydospore production and colony morphology on birdseed agar (1, 53), and molecul…”
Method
Rapid Identification of up to Three Candida Species in a Single Reaction Tube by a 5′ Exonuclease Assay Using Fluorescent DNA Probes
Shin, J. H., Nolte, F. S., Holloway, B. P., & Morrison, C. J. (1999) · Journal of Clinical Microbiology · doi:10.1128/jcm.37.1.165-170.1999 · Cited by 82
“cerevisiae has been shown to be species specific in preliminary tests (8).”
BackgroundSelf-citation
Rapid Identification of Candida dubliniensis Using a Species-Specific Molecular Beacon
Park, S., Wong, M., Marras, S. A. E., Cross, E. W., Kiehn, T. E., Chaturvedi, V. P., Tyagi, S., & Perlin, D. S. (2000) · Journal of Clinical Microbiology · doi:10.1128/jcm.38.8.2829-2836.2000 · Cited by 79
“dubliniensis were designed on the basis of published probe sequences (11) that were independently confirmed by DNA sequence analysis at the New York University DNA sequencing facility.”
BackgroundMethodInfluential
Candida dubliniensis: An update.
Sullivan, D. J., Moran, G. P., Donnelly, S. M., Gee, S. F., Pinjon, E., McCartan, B. E., Shanley, D. B., & Coleman, D. C. (1999) · PubMed · Cited by 79
PCR‐based identification of pathogenic Candida species using primer mixes specific to Candida DNA topoisomerase II genes
Kanbe, T., Horii, T., Arishima, T., Ozeki, M., & Kikuchi, A. (2002) · Yeast · doi:10.1002/yea.892 · Cited by 78
“Transcribed spacer (ITS) I or the ITS II region of fungal rRNA genes have often been targeted in many molecular biology-based identifications of fungi (Chen et al., 2000; Elie et al., 1998; Kurtzman et al., 1997; Turenne et al., 1999).”
BackgroundMethodInfluential
Rapid Differentiation of Aspergillus Species from Other Medically Important Opportunistic Molds and Yeasts by PCR-Enzyme Immunoassay
de Aguirre, L., Hurst, S. F., Choi, J. S., Shin, J. H., Hinrikson, H. P., & Morrison, C. J. (2004) · Journal of Clinical Microbiology · doi:10.1128/jcm.42.8.3495-3504.2004 · Cited by 74
“of the 28S rDNA region for each fungal species, as previously described (16, 68); and (ii) the fungus-specific, universal primer pair ITS1 and ITS4 (Table 3) was”
BackgroundMethodInfluentialSelf-citation
Current Status and Future Perspectives on Molecular and Serological Methods in Diagnostic Mycology
Lau, A. F., Chen, W., Sleiman, S., & Sorrell, T. C. (2009) · Future Microbiology · doi:10.2217/fmb.09.70 · Cited by 74
“)* Culture [82,148,212,213,455–457]”
Multiplex PCR identification of eight clinically relevantCandidaspecies
Carvalho, A., Costa‐de‐Oliveira, S., Martins, M. D. L., Pina‐Vaz, C., Rodrigues, A. G., Ludovico, P., & Rodrigues, F. J. S. (2007) · Medical Mycology · doi:10.1080/13693780701501787 · Cited by 70
Sequencing as a tool in yeast molecular taxonomy
Valente, P., Ramos, J. P., & Leoncini, O. (1999) · Canadian Journal of Microbiology · doi:10.1139/cjm-45-11-949 · Cited by 68
Yeasts and filamentous fungi in bottled mineral water and tap water from municipal supplies
Yamaguchi, M. U., Rampazzo, ‪. D. C. P., Yamada‐Ogatta, S. F., Nakamura, C. V., Ueda‐Nakamura, T., & Filho, B. P. D. (2007) · Brazilian Archives of Biology and Technology · doi:10.1590/s1516-89132007000100001 · Cited by 69
“There are now at least 17 species of Candida that have been shown to cause diseases in human (Elie et al., 1998) and the list of yeast that can cause diseases are rising.”
Background
Identification of clinically relevant yeasts by PCR/RFLP
Trost, A., Graf, B., Eucker, J., Sezer, O., Possinger, K., Göbel, U. B., & Adam, T. (2003) · Journal of Microbiological Methods · doi:10.1016/j.mimet.2003.10.007 · Cited by 69
Identification of Candida spp. by Randomly Amplified Polymorphic DNA Analysis and Differentiation between Candida albicans and Candida dubliniensis by Direct PCR Methods
Bautista-Muñoz, C. D. C., Boldo‐León, X. M., Villa‐Tanaca, L., & Hernández-Rodríguez, C. (2003) · Journal of Clinical Microbiology · doi:10.1128/jcm.41.1.414-420.2003 · Cited by 68
“Several PCR methods for the differentiation of some Candida species have been reported (2, 9, 10, 14, 15, 27, 28).”
BackgroundMethodInfluential
Clinical aspects related to endodontic yeast infections
Waltimo, T. M. T., Haapasalo, M., Zehnder, M., & Meyer, J. (2004) · Endodontic Topics · doi:10.1111/j.1601-1546.2004.00086.x · Cited by 66
Use of Amplified Fragment Length Polymorphism Analysis To Identify Medically Important Candida spp., Including C . dubliniensis
Borst, A., Theelen, B., Reinders, E., Boekhout, T., Fluit, A. C., & Savelkoul, P. H. M. (2003) · Journal of Clinical Microbiology · doi:10.1128/jcm.41.4.1357-1362.2003 · Cited by 66
“dubliniensisspecific PCR assays as well as generic PCR assays in combination with species-specific probes have been developed (6, 7, 16, 19, 25).”
Rapid Identification of Commonly EncounteredCandidaSpecies Directly from Blood Culture Bottles
Selvarangan, R., Bui, U. T. T., Limaye, A. P., & Cookson, B. T. (2003) · Journal of Clinical Microbiology · doi:10.1128/jcm.41.12.5660-5664.2003 · Cited by 66
“They include amplification of a target gene(s) followed by a postamplification analysis step to identify the amplicons based on electrophoretic migration or by hybridization with specific nucleotide probes (6, 7, 10, 13, 22).”
Method
Use of a Suspension Array for Rapid Identification of the Varieties and Genotypes of the Cryptococcus neoformans Species Complex
Diaz, M. R., & Fell, J. W. (2005) · Journal of Clinical Microbiology · doi:10.1128/jcm.43.8.3662-3672.2005 · Cited by 66
“A sensitivity of 1 ng was reported for the identification of Candida species by the use of PCR-EIA (22).”
Method
Transient Fungemia Caused by an Amphotericin B-Resistant Isolate of Candida haemulonii
Rodero, L., Cuenca‐Estrella, M., Córdoba, S. B., Cahn, P. E., Davel, G., Kaufman, S. C., Guelfand, L. I., & Rodrı́guez-Tudela, J. L. (2002) · Journal of Clinical Microbiology · doi:10.1128/jcm.40.6.2266-2269.2002 · Cited by 65
“haemulonii has been recognized as one of the most frequently occurring human pathogenic Candida species by experts designing DNAbased systems for the rapid identification of yeast species (3, 12).”
Background
Advances in molecular detection of Aspergillus: an update
Abdin, M. Z., Ahmad, M. M., & Javed, S. (2010) · Archives of Microbiology · doi:10.1007/s00203-010-0563-y · Cited by 63
“Elie et al. (1998), however, had found the detection limit 10 times less than Hinrikson et al.”
BackgroundMethodInfluential
Infections due to Candida haemulonii: species identification, antifungal susceptibility and outcomes
Ruan, S., Kuo, Y.-W., Huang, C., Hsiue, E. H.-C., & Hsueh, P. (2009) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2009.08.009 · Cited by 59
Vaginitis
Mills, B. B. (2017) · Obstetrics and Gynecology Clinics of North America · doi:10.1016/j.ogc.2017.02.010 · Cited by 59
Candida lusitaniae: Biology, Pathogenicity, Virulence Factors, Diagnosis, and Treatment
Mendoza-Reyes, D. F., Gómez-Gaviria, M., & Mora-Montes, H. M. (2022) · Infection and Drug Resistance · doi:10.2147/idr.s383785 · Cited by 61
“lusitaniae.(119) For this, universal fungal”
Background
Rapid identification and differentiation of fungal DNA in dermatological specimens by LightCycler PCR
Gutzmer, R., Mommert, S., Küttler, U., Werfel, T., & Kapp, A. (2004) · Journal of Medical Microbiology · doi:10.1099/jmm.0.45779-0 · Cited by 54
“The ITS regions and adjacent rDNA were also successfully usedinpreviousstudies todetectanddifferentiateyeasts tothe species level with a variety of PCR methods (Ahmad et al., 2002; Chen et al., 2000; Elie et al., 1998; Lindsley et al., 2001; Selvarangan et al., 2002; Shin et al., 1997).”
Background
The Pan-AC assay: a single-reaction real-time PCR test for quantitative detection of a broad range of Aspergillus and Candida species
Bašková, L., Landlinger, C., Preuner, S., & Lion, T. (2007) · Journal of Medical Microbiology · doi:10.1099/jmm.0.47212-0 · Cited by 54
“The use of agents with a narrower spectrum of antifungal activity, such as fluconazole or amphotericin B, would require the identification of the fungal species present, which can be performed by a number of molecular techniques, including, for example, the analysis of the variable ITS2 region or species-specific hybr…”
Background
Isolation and molecular identification of Candida dubliniensis from non-human immunodeficiency virus-infected patients in Kuwait
Ahmad, S., Khan, Z., Mokaddas, E. M., & Khan, Z. U. (2004) · Journal of Medical Microbiology · doi:10.1099/jmm.0.05315-0 · Cited by 54
“dubliniensis since the DNA sequence of the ITS2 of the rDNA is regarded as species-specific for various Candida species (Elie et al., 1998; Gee et al., 2002; Fujita et al., 1995).”
BackgroundResultInfluential
Rapid and unequivocal differentiation of Candida dubliniensis from other Candida species using species‐specific DNA probes: comparison with phenotypic identification methods
Ellepola, A. N. B., Hurst, S. F., Elie, C. M., & Morrison, C. J. (2003) · Oral Microbiology and Immunology · doi:10.1046/j.0902-0055.2003.00103.x · Cited by 53
Self-citation
Reverse Line Blot Hybridization Assay for Identification of Medically Important Fungi from Culture and Clinical Specimens
Zeng, X., Kong, F., Halliday, C. L., Chen, S. C.-J., Lau, A. F., Playford, E. G., & Sorrell, T. C. (2007) · Journal of Clinical Microbiology · doi:10.1128/jcm.00687-07 · Cited by 53
“In particular, the internal transcribed spacer (ITS) regions, ITS1 and ITS2, of the fungal ribosomal DNA gene complex, have shown promise as targets for species identification in a variety of formats, including DNA sequencing and DNA probe hybridization (9, 13, 22).”
Background
Candida dubliniensis at a University Hospital in Saudi Arabia
Fotedar, R., & Al‐Hedaithy, S. S. A. (2003) · Journal of Clinical Microbiology · doi:10.1128/jcm.41.5.1907-1911.2003 · Cited by 52
“In addition, the use of molecular techniques has significantly revolutionized investigations of various aspects of this yeast pathogen (8).”
Background
Fungal infections in patients with cystic fibrosis
Nagano, Y., Millar, B. C., Johnson, E. M., Goldsmith, C. E., Elborn, J. S., Rendall, J. C., & Moore, J. E. (2007) · Reviews in Medical Microbiology · doi:10.1097/mrm.0b013e3282e1c70a · Cited by 50
DNA Pyrosequencing–Based Identification of Pathogenic Candida Species by Using the Internal Transcribed Spacer 2 Region
Boyanton, B. L., Luna, R. A., Fasciano, L. R., Menne, K. G., & Versalovic, J. A. (2008) · Archives of Pathology & Laboratory Medicine · doi:10.5858/2008-132-667-dpiopc · Cited by 49
Candida identification: a journey from conventional to molecular methods in medical mycology
Alam, M. Z., Alam, Q., Jiman-Fatani, A. A., Kamal, M. A., Abuzenadah, A. M., Chaudhary, A., Akram, M., & Haque, A. (2013) · World Journal of Microbiology and Biotechnology · doi:10.1007/s11274-013-1574-z · Cited by 48
Resolution of Discrepant Results for Candida Species Identification by Using DNA Probes
Coignard, C., Hurst, S. F., Benjamin, L. E., Brandt, M. E., Warnock, D. W., & Morrison, C. J. (2004) · Journal of Clinical Microbiology · doi:10.1128/jcm.42.2.858-861.2004 · Cited by 41
“Discrepancies in species identification between the CDC’s phenotypic methods and the PCR-EIA were resolved by rDNA sequencing on a Perkin-Elmer ABI Prism 310 automated capillary DNA sequencer as previously described (7).”
MethodResultInfluentialSelf-citation
Reverse Cross Blot Hybridization Assay for Rapid Detection of PCR-Amplified DNA from Candida Species, Cryptococcus neoformans , and Saccharomyces cerevisiae in Clinical Samples
Posteraro, B., Sanguinetti, M., Masucci, L., Romano, L., Morace, G., & Fadda, G. (2000) · Journal of Clinical Microbiology · doi:10.1128/jcm.38.4.1609-1614.2000 · Cited by 41
“guilliermondii (5) 2 2 2 1 2 2 2 2 2 2”
BackgroundInfluential
DNA probes for the rapid identification of medically importantCandidaspecies using a multianalyte profiling system
Das, S., Brown, T. M., Kellar, K. L., Holloway, B. P., & Morrison, C. J. (2005) · FEMS Immunology & Medical Microbiology · doi:10.1111/j.1574-695x.2005.00031.x · Cited by 40
Self-citation
Rapid differentiation of Candida albicans from other Candida species using its unique germ tube formation at 39° C
Kim, D., Shin, W., Lee, K. H., Kim, K., Park, J. Y., & Koh, C.-M. (2002) · Yeast · doi:10.1002/yea.891 · Cited by 39
“Recently, molecular methods including PCR have also been studied (Elie et al., 1998; Mannarelli and Kurtzman, 1998; Shin et al., 1997; Weissman et al., 1995).”
BackgroundMethod
Identification of fungal species by fragment length analysis of the internally transcribed spacer 2 region
Landlinger, C., Bašková, L., Preuner, S., Willinger, B., Buchta, V., & Lion, T. (2008) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-008-0683-3 · Cited by 39
Development of a Species-Specific Probe forPythium insidiosumand the Diagnosis of Pythiosis
Schurko, A. M., Mendoza, L., de Cock, A. W. A. M., Bedard, J. E. J., & Klassen, G. R. (2004) · Journal of Clinical Microbiology · doi:10.1128/jcm.42.6.2411-2418.2004 · Cited by 39
“Species-specific probes have been described for several Candida species (8, 9, 15), Trichophyton rubrum (14), and a variety of other fungal pathogens (13, 29, 44, 45).”
Background
Genotypic subgrouping of clinical isolates of Candida albicans and Candida dubliniensis by 25S intron analysis
Millar, B. C., Moore, J. E., Xu, J., Walker, M. J., Hedderwick, S. A., & McMullan, R. (2002) · Letters in Applied Microbiology · doi:10.1046/j.1472-765x.2002.01135.x · Cited by 39
“Consequently several genotypic diagnostic assays have been developed to aid in the identification of this novel species (Elie et al. 1998).”
Background
Molecular and phenotypic identification of the yeast pathogen Candida dubliniensis
Kurzai, O., Korting, H.-C., Harmsen, D., Bautsch, W., Molitor, M., Frosch, M., & Mühlschlegel, F. A. (2000) · Journal of Molecular Medicine · doi:10.1007/s001090000142 · Cited by 38
“different isolates of a single species [25, 29].”
Fungal infections of the eye--laboratory diagnosis and treatment.
Nayak, N. (2008) · PubMed · Cited by 37
Detection and identification of Candida species associated with Candida vaginitis by real-time PCR and pyrosequencing
Trama, J. P., Mordechai, E., & Adelson, M. E. (2005) · Molecular and Cellular Probes · doi:10.1016/j.mcp.2004.10.004 · Cited by 37
Development and Evaluation of a Rapid Latex Agglutination Test Using a Monoclonal Antibody To Identify Candida dubliniensis Colonies
Marot-Leblond, A., Beucher, B., David, S., Nail-Billaud, S., & Robert, R. (2006) · Journal of Clinical Microbiology · doi:10.1128/jcm.44.1.138-142.2006 · Cited by 37
“At present, the most accurate means of differentiating between isolates of these two species is based on molecular biology-based techniques (5, 8, 10, 12, 13, 14, 15, 16, 17, 21, 30).”
Background
Laboratory diagnosis of invasive mycoses
O’Shaughnessy, E. M., Shea, Y. M., & Witebsky, F. G. (2003) · Infectious Disease Clinics of North America · doi:10.1016/s0891-5520(02)00069-7 · Cited by 37
Rapid simultaneous detection and identification of six species Candida using polymerase chain reaction and reverse line hybridization assay
Xiang, H., Xiong, L., Liu, X., & Tu, Z. (2007) · Journal of Microbiological Methods · doi:10.1016/j.mimet.2007.01.011 · Cited by 36
Evidence for a Pseudo-Outbreak of Candida guilliermondii Fungemia in a University Hospital in Brazil
Medeiros, E. A., Lott, T. J., Colombo, A. L., Godoy, P., Coutinho, A. P., Braga, M. S., Nucci, M., & Brandt, M. E. (2007) · Journal of Clinical Microbiology · doi:10.1128/jcm.01878-06 · Cited by 35
“clade (3) or through direct DNA sequencing of ribosomal DNA.”
BackgroundSelf-citation
Simultaneous Detection and Identification of Candida , Aspergillus , and Cryptococcus Species by Reverse Line Blot Hybridization
Playford, E. G., Kong, F., Sun, Y. C., Wang, H., Halliday, C. L., & Sorrell, T. C. (2006) · Journal of Clinical Microbiology · doi:10.1128/jcm.44.3.876-880.2006 · Cited by 35
“guilliermondii probe and Candida zeylanoides DNA product noted previously (5).”
BackgroundMethodInfluential
Disseminated Mucormycosis Caused by Absidia corymbifera Leading to Cerebral Vasculitis
Eucker, J., Sezer, O., Lehmann, R., Weber, J. R., Graf, B., Denkert, C., Brück, W., Schweigert, M., & Possinger, K. (2000) · Infection · doi:10.1007/s150100070047 · Cited by 34
Molecular fingerprinting methods for the discrimination between C. albicans and C. dubliniensis
Neppelenbroek, K. H., Bombarda, N. H. C., Spolidório, D. M. P., Spolidório, L. C., Seó, R., & Pavarina, A. C. (2006) · Oral Diseases · doi:10.1111/j.1601-0825.2005.01189.x · Cited by 34
Rapid differentiation between fluconazole-sensitive and -resistant species of Candida directly from positive blood-culture bottles by real-time PCR
Metwally, L. A., Hogg, G., Coyle, P. V., Hay, R. J., Hedderwick, S. A., McCloskey, B., O’Neill, H. J., Ong, G., Thompson, G., Webb, C. H., et al. (2007) · Journal of Medical Microbiology · doi:10.1099/jmm.0.47149-0 · Cited by 33
Molecular epidemiology of Candida albicans strains isolated from the oropharynx of HIV-positive patients at successive clinic visits
Lasker, B. A., Elie, C. M., Lott, T. J., Espinel-Ingroff, A. V., Gallagher, L., Kuykendall, R. J., Kellum, M. E., Pruitt, W. R., Warnock, D. W., Rimland, D., et al. (2001) · Medical Mycology · doi:10.1080/mmy.39.4.341.352 · Cited by 33
Self-citation
The role of micro-organisms (Staphylococcus aureus and Candida albicans) in the pathogenesis of breast pain and infection in lactating women: study protocol
Amir, L. H., Cullinane, M., Garland, S. M., Tabrizi, S. N., Donath, S. M., Bennett, C. M., Cooklin, A., Fisher, J., & Payne, M. S. (2011) · BMC Pregnancy and Childbirth · doi:10.1186/1471-2393-11-54 · Cited by 32
“To increase sensitivity for the detection of Candida spp from the nipple, a flocked swab is resuspended in 1× Phosphate Buffered Saline (PBS) and DNA extracted from this is subsequently used in a polymerase chain reaction (PCR) which has been used previously to successfully identify Candida spp [41,42].”
Method
Identification of rare Candida species and other yeasts by polymerase chain reaction and slot blot hybridization
Loeffler, J., Hebart, H. F., Magga, S., Schmidt, D., Klingspor, L., Tollemar, J. G., Schumacher, U., & Einsele, H. (2000) · Diagnostic Microbiology and Infectious Disease · doi:10.1016/s0732-8893(00)00201-7 · Cited by 31
Rapid and simple differentiation of C. dubliniensis from C. albicans
Graf, B., Trost, A., Eucker, J., Göbel, U. B., & Adam, T. (2004) · Diagnostic Microbiology and Infectious Disease · doi:10.1016/j.diagmicrobio.2003.09.016 · Cited by 31
“Other methods to distinguish the 2 Candida species are either long to perform, difficult to reproduce, expensive or require equipment not normally available in diagnostic laboratories (Elie et al., 1998; Pinjon et al., 1998; Posteraro et al., 2000; Tintelnot et al., 2000; Mahmoudabadi et al., 2002; McIlhatton et al.,…”
Method
Comparison of API20C with molecular identification of Candida spp isolated from bloodstream infections
Xu, J., Millar, B. C., Moore, J. E., McClurg, R., Walker, M. J., Evans, J., Hedderwick, S., & McMullan, R. (2002) · Journal of Clinical Pathology · doi:10.1136/jcp.55.10.774 · Cited by 31
Vulvovaginal candidiasis in a Flemish patient population
Vos, M. M. D., Cuenca‐Estrella, M., Boekhout, T., Theelen, B., Matthijs, N., Bauters, T. G. M., Nailis, H., Dhont, M. A., Rodríguez-Tudela, J. L., & Nelis, H. J. C. F. (2005) · Clinical Microbiology and Infection · doi:10.1111/j.1469-0691.2005.01281.x · Cited by 30
“[13].”
Utility of a Luminex-based assay for multiplexed, rapid species identification of Candida isolates from an ongoing candidemia surveillance
Deak, E., Etienne, K. A., Lockhart, S. R., Gade, L., Chiller, T., & Balajee, S. A. (2010) · Canadian Journal of Microbiology · doi:10.1139/w10-003 · Cited by 29
Evaluation of a Rapid Immunochromatographic Assay for Identification of Candida albicans and Candida dubliniensis
Marot-Leblond, A., Grimaud, L., David, S., Sullivan, D. J., Coleman, D. C., Pontón, J., & Robert, R. (2004) · Journal of Clinical Microbiology · doi:10.1128/jcm.42.11.4956-4960.2004 · Cited by 26
“albicans requires the use of molecular biology-based techniques, such as DNA fingerprinting analysis with repetitive sequence-containing DNA probes, randomly amplified polymorphic DNA analysis, PCR analysis, or pulsed-field gel electrophoresis (5, 8, 11, 12, 15, 16, 21, 22, 35).”
Method
Molecular Epidemiology and In Vitro Antifungal Susceptibility of Candida Isolates from Women with Vulvovaginal Candidiasis in Northern Cities of Khuzestan Province, Iran
Hasanvand, S., Qomi, H. A., Kord, M., & Didehdar, M. (2017) · Jundishapur Journal of Microbiology · doi:10.5812/jjm.12804 · Cited by 27
“However, traditional methods are sometimes time-consuming and inefficient to identify the involved species (15, 16).”
Background
Rapid Differentiation of Phenotypically Similar Yeast Species by Single-Strand Conformation Polymorphism Analysis of Ribosomal DNA
Wang, Q., Li, J., Wang, S., & Bai, F. (2008) · Applied and Environmental Microbiology · doi:10.1128/aem.02223-07 · Cited by 24
“These methods include DNA probe hybridization (11, 15), multiplex PCR (42) and real-time PCR assays (25, 55), PCR-enzyme immunoassays (41), restriction fragment length polymorphism (RFLP) analysis of 5.”
Method
rDNA-RFLP identification ofCandidaspecies in immunocompromised and seriously diseased patients
Pinto, P. M., de Resende, M. A., Koga‐Ito, C. Y., Ferreira, J. A. G., & Tendler, M. (2004) · Canadian Journal of Microbiology · doi:10.1139/w04-025 · Cited by 24
Evaluation of molecular methods for the analysis of yeasts in foods and beverages
Beh, A., Fleet, G. H., Prakitchaiwattana, C., & Heard, G. M. (2006) · Advances in experimental medicine and biology · doi:10.1007/0-387-28391-9_4 · Cited by 23
Rapid PCR-based test for identifyingCandida albicansby using primers derived from the pH-regulatedKER1gene
GalÃ¡n, A., Veses, V., Murgui, A., Casanova, M., & MartÃnez, J. P. (2006) · FEMS Yeast Research · doi:10.1111/j.1567-1364.2006.00114.x · Cited by 22
A comparison between CHROMagar, PCR-RFLP and PCR-FSP for identification of Candida species
Jafari, Z., Motamedi, M., Jalalizand, N., Shokoohi, G., Charsizadeh, A., & Mirhendi, H. (2017) · Current Medical Mycology · doi:10.29252/cmm.3.3.10 · Cited by 22
“Among the various molecular techniques, the best known methods include specific primers in polymerase chain reaction (PCR) and multiplex PCR [13], specific probes for each species [14], PCR-restriction fragments length polymorphism (PCR-RFLP) [15], sequencing of specific regions of genome [16], real-time PCR [17], and…”
Method
Prevalence of Candida dubliniensis among germ tube‐positive yeasts recovered from the respiratory specimens in HIV‐negative patients
Fotedar, R., & Al‐Hedaithy, S. S. A. (2004) · Mycoses · doi:10.1111/j.1439-0507.2004.00973.x · Cited by 21
The Role of PCR in the Diagnosis of Candida Vulvovaginitis—a New Gold Standard?
Sobel, J. D., & Akins, R. A. (2015) · Current Infectious Disease Reports · doi:10.1007/s11908-015-0488-3 · Cited by 19
Candida and Candidiasis
Pérez-García, L. A., Macías-Pérez, J. R., León‐Buitimea, A., Alvarado‐Sánchez, B., Ramírez-Quijas, M. D., Navarro-Arias, M. J., & Rodríguez-Reyes, S. C. (2017) · Springer eBooks · doi:10.1007/978-3-319-64113-3_3 · Cited by 17
A new ultrasonic high-throughput instrument for rapid DNA release from microorganisms
Hohnadel, M., Felden, L., Fijuljanin, D., Jouette, S., & Chollet, R. (2014) · Journal of Microbiological Methods · doi:10.1016/j.mimet.2014.02.004 · Cited by 16
Multiplex-PCR-based differentiation and characterization of Candida-isolates derived from tortoises (Testudinidae)
Milde, K., Kostka, V., Kaleta, E. F., Willems, H., & Jäger, C. (2000) · Veterinary Microbiology · doi:10.1016/s0378-1135(00)00248-0 · Cited by 16

Authors: Elie, C. M., Lott, T. J., Reiss, E., & Morrison, C. J.
Affiliations: Centers for Disease Control and Prevention (US)
Venue: Journal of Clinical Microbiology
Publisher: American Society for Microbiology
Published: 1998-11
Volume: 36
Issue: 11
Pages: 3260-3265
ISSN: 0095-1137 (ISSN-L)
1098-660X
DOI: 10.1128/jcm.36.11.3260-3265.1998
PMC: PMC105312
OpenAlex: W2152603420
Cited by: 159
References: 30
Citations by year: 2025: 2 · 2024: 1 · 2022: 2 · 2021: 2 · 2020: 1 · 2018: 1 · 2017: 6 · 2015: 4 · 2014: 6 · 2013: 2 · 2012: 2
FWCI: 6.03
Type: journal article
Language: en
Open access: bronze
doi.org
Licence: journals.asm.org/non-commercial-tdm-license (tdm)
Locations: Journal of Clinical Microbiology (publishedVersion)
PubMed Central (publishedVersion)
Europe PMC (PubMed Central) (publishedVersion)
PubMed (publishedVersion)
Funders: U.S. Department of Energy
Georgia State University
Centers for Disease Control and Prevention
Oak Ridge Institute for Science and Education
Topics: Health Sciences › Medicine › Infectious Diseases › Antifungal resistance and susceptibility
Life Sciences › Immunology and Microbiology › Microbiology › Yeasts and Rust Fungi Studies
Health Sciences › Medicine › Microbiology (medical) › Bacterial Identification and Susceptibility Testing
Keywords: Candida species identification, species-specific DNA probes, Candida dubliniensis, Candida albicans, non-albicans Candida, azole resistance
MeSH terms: Base Sequence, Candida, Candida albicans, Candidiasis, Digoxigenin, Evaluation Studies as Topic, Genotype, Humans, Immunoenzyme Techniques, Mycology, Phenotype, Sensitivity and Specificity, Species Specificity, DNA Probes, Polymerase Chain Reaction

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Rapid Identification of Candida Species with Species-Specific DNA Probes

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks