A 110-kDa Nuclear Shuttle Protein, Nucleolin, Specifically Binds to Adeno-Associated Virus Type 2 (AAV-2) Capsid
Open accessAbstract
A 110-kDa protein was copurified with adeno-associated virus type 2 (AAV-2) virions after CsCl density gradient isopycnic centrifugation. Amino acid sequence of peptides derived from this protein after tryptic digestion, monoclonal antibody production, and Western blot analysis showed that the copurified protein was the major nucleolar phosphoprotein, human nucleolin. Virus overlay assays demonstrated that AAV-2 capsid specifically bound to the human nucleolin, and immunoprecipitation studies confirmed the in vitro binding of nucleolin and intact AAV-2 capsids but not denatured viral proteins. Double-immunofluorescence staining of infected cells showed that AAV capsid and nucleolin were colocalized in both cytoplasm and nucleus. In addition, when cytoplasmic and nuclear fractions were extracted from AAV-infected KB cells at different time points postinfection, immunoprecipitation data and Western blotting showed that AAV capsid formation and nucleolin interact specifically and share their subcellular localization in infected cells. With the known functions of nucleolin in the synthesis of rRNA and ribosome assembly, binding to single-stranded DNA, and acting as a shuttle between cytoplasm and nucleolus, our data showing that AAV-2 capsid binds specifically to nucleolin both in vitro and in vivo suggest a key role of nucleolin in AAV-2 replication, particularly in capsid assembly.
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
Nucleolin and nucleophosmin associate with both VPs and assembled capsids in the nucleoli.
“Additionally, two nuclear proteins, nucleolin and nucleophosmin [43,44], have been shown to associate with both VPs and assembled capsids in the nucleoli.”
From Understanding Capsid Assembly and Genome Packaging for Adeno-Associated Viruses (2017) · cites this paper as [44]
The Discussion (page unavailable) describes nucleolin binding to VP1 and VP2 and proposes that it may direct them to the nucleolus. The results section reports nucleolin coimmunoprecipitating with assembled capsids and colocalizing with them in the nucleus, while the Discussion says capsid assembly occurs in the nucleolus. The paper does not demonstrate that both associations occur specifically in the nucleoli; it addresses nucleolin, not the separately cited nucleophosmin. (LLM, conf=0.82)
Experimental — accuracy not yet measured
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Cites
Cloning of infectious adeno-associated virus genomes in bacterial plasmids
Laughlin, C. A., Tratschin, J.-D., Coon, H., & Carter, B. J. (1983) · Gene · doi:10.1016/0378-1119(83)90217-2 · Cited by 266 · see citing works
Wistuba, A., Weger, S., Kern, A., & Kleinschmidt, J. A. (1995) · Journal of Virology · doi:10.1128/jvi.69.9.5311-5319.1995 · Cited by 147 · see citing works
Characterization of adenovirus-associated virus-induced polypeptides in KB cells
Buller, R. M., & Rose, J. A. (1978) · Journal of Virology · doi:10.1128/jvi.25.1.331-338.1978 · Cited by 111 · see citing works
Flagged first, then by citations
Research works printed but not linked: 2
- Hanakahi, L. A., Dempsey, L. A., Li, M. J., and Maizels, N. (1997). Nucleolin is one component of the B cell-specific transcription factor and switch region binding protein, LR1. Proc. Natl. Acad. Sci. USA 94, 3605-3610.
- Lapeyre, B., Bourbon, H., and Amalric, F. (1987). Nucleolin, the major nucleolar protein of growing eukaryotic cells: An unusual protein structure revealed by the nucleotide sequence. Proc. Natl. Acad. Sci. USA 84, 1472-1476.
Cited by
Sorted by citations
A viral assembly factor promotes AAV2 capsid formation in the nucleolus
Sonntag, F., Schmidt, K., & Kleinschmidt, J. A. (2010) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1001673107 · Cited by 392 · see citing works
“Promising candidates include nucleophosmin and nucleolin, which were found to be associated with capsids (17, 18).”
BackgroundOpie, S. R., Warrington, Agbandje-McKenna, M., Zolotukhin, S., & Muzyczka, N. (2003) · Journal of Virology · doi:10.1128/jvi.77.12.6995-7006.2003 · Cited by 364 · see citing works
“In particular, nucleolin, a 110-kDa nuclear shuttle protein, binds specifically to the AAV2 capsid both in vitro and in vivo and is found colocalized with the capsid in the cytoplasm and nucleus of infected cells (36).”
BackgroundRespiratory syncytial virus entry and how to block it
Battles, M. B., & McLellan, J. S. (2019) · Nature Reviews Microbiology · doi:10.1038/s41579-019-0149-x · Cited by 399 · see citing works
Intracellular transport of recombinant adeno-associated virus vectors
Nonnenmacher, M., & Weber, T. (2012) · Gene Therapy · doi:10.1038/gt.2012.6 · Cited by 258 · see citing works
Intracellular trafficking of adeno-associated viral vectors
Ding, W., Zhang, L., Yan, Z., & Engelhardt, J. F. (2005) · Gene Therapy · doi:10.1038/sj.gt.3302527 · Cited by 251 · see citing works
Recombinant Adeno-associated Virus Transduction and Integration
Schultz, B. R., & Chamberlain, J. S. (2008) · Molecular Therapy · doi:10.1038/mt.2008.103 · Cited by 216 · see citing works
AAV Capsid Structure and Cell Interactions
Agbandje-McKenna, M., & Kleinschmidt, J. (2012) · Methods in Molecular Biology · doi:10.1007/978-1-61779-370-7_3 · Cited by 215 · see citing works
Sonntag, F., Köther, K., Schmidt, K., Weghofer, M., Raupp, C., Nieto, K., Kuck, A., Gerlach, B., Böttcher, B., Müller, O. J., et al. (2011) · Journal of Virology · doi:10.1128/jvi.05359-11 · Cited by 184 · see citing works
“Moreover, nucleolar proteins have been shown to associate with AAV2 capsids (2, 21).”
BackgroundEnhancement of Adeno-Associated Virus Infection by Mobilizing Capsids into and Out of the Nucleolus
Johnson, J. S., & Samulski, R. J. (2008) · Journal of Virology · doi:10.1128/jvi.02309-08 · Cited by 158 · see citing works
“(8, 46, 64), but the roles of the nucleolus or nucleolar proteins”
BackgroundInfluentialPharmacology of Recombinant Adeno-associated Virus Production
Penaud-Budloo, M., François, A., Clément, N., & Ayuso, E. (2018) · Molecular Therapy - Methods & Clinical Development · doi:10.1016/j.omtm.2018.01.002 · Cited by 177 · see citing works
Xu, R., Janson, C., Mastakov, M., Lawlor, P., Young, D., Mouravlev, A., Fitzsimons, H., Choi, K.-L., Ma, H., Dragunow, M., et al. (2001) · Gene Therapy · doi:10.1038/sj.gt.3301529 · Cited by 174 · see citing works
Grieger, J. C., Snowdy, S., & Samulski, R. J. (2006) · Journal of Virology · doi:10.1128/jvi.02723-05 · Cited by 172 · see citing works
“It is noteworthy to mention that two studies have suggested that AAV virion assembly occurs in nucleoli utilizing indirect immunofluorescence for nucleolin (44) and an unspecified nucleolar protein (59).”
BackgroundPillay, S., Zou, W., Cheng, F., Puschnik, A. S., Meyer, N., Ganaie, S. S., Deng, X., Wosen, J. E., Davulcu, O., Yan, Z., et al. (2017) · Journal of Virology · doi:10.1128/jvi.00391-17 · Cited by 190 · see citing works
“WT AAV2 was propagated and purified by CsCl ultracentrifugation, performed as previously reported (48).”
MethodSelf-citationStrobel, B., Miller, F., Rist, W., & Lamla, T. (2015) · Human Gene Therapy Methods · doi:10.1089/hgtb.2015.051 · Cited by 148 · see citing works
Adenovirus Protein V Induces Redistribution of Nucleolin and B23 from Nucleolus to Cytoplasm
Matthews, D. A. (2001) · Journal of Virology · doi:10.1128/jvi.75.2.1031-1038.2001 · Cited by 137 · see citing works
“Why does adenovirus disrupt the nucleoli at all? Several theories may be inferred from this and other research (27, 38).”
BackgroundThe nucleolus: a central response hub for the stressors that drive cancer progression
Weeks, S. E., Metge, B. J., & Samant, R. S. (2019) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-019-03231-0 · Cited by 112 · see citing works
Earley, L. F., Powers, J. M., Adachi, K., Baumgart, J. T., Meyer, N. L., Xie, Q., Chapman, M. S., & Nakai, H. (2017) · Journal of Virology · doi:10.1128/jvi.01980-16 · Cited by 108 · see citing works
“Several studies have found a close association between nucleolar proteins and AAV2 capsids (27, 28), and it was found that AAV2 capsids are trafficked to the nucleolus following infection (29).”
BackgroundRecombinant Adeno-Associated Virus Utilizes Host Cell Nuclear Import Machinery To Enter the Nucleus
Nicolson, S. C., & Samulski, R. (2014) · Journal of Virology · doi:10.1128/jvi.02660-13 · Cited by 107 · see citing works
Viruses and the nucleolus: The fatal attraction
Salvetti, A., & Greco, A. (2013) · Biochimica et Biophysica Acta · doi:10.1016/j.bbadis.2013.12.010 · Cited by 103 · see citing works
Intracellular trafficking of adeno-associated virus (AAV) vectors: challenges and future directions
Riyad, J. M., & Weber, T. (2021) · Gene Therapy · doi:10.1038/s41434-021-00243-z · Cited by 116 · see citing works
Cell Surface Nucleolin Facilitates Enterovirus 71 Binding and Infection
Su, P.-Y., Wang, Y.-F., Huang, S.-W., Lo, Y.-C., Wang, Y.-H., Wu, S.-R., Shieh, D., Chen, S.-H., Wang, J.-R., Lai, M., et al. (2015) · Journal of Virology · doi:10.1128/jvi.03498-14 · Cited by 100 · see citing works
“Furthermore, NCL also participates in the pathogenic mechanism and mediates the replication of several viruses and/or serves as a cell surface receptor for Escherichia coli O157 (56), Helicobacter pylori (57), RSV (28), adeno-associated virus type-2 (AAV-2) (58), coxsackie B virus (59), and HIV (29).”
BackgroundThe Interaction of Heparin Sulfate and Adeno-Associated Virus 2
Qiu, J., Handa, A., Kirby, M., & Brown, K. E. (2000) · Virology · doi:10.1006/viro.2000.0205 · Cited by 79 · see citing works
Self-citationIdentification of Cellular Proteins That Interact with the Adeno-Associated Virus Rep Protein
Nash, K., Chen, W.-J., Salganik, M., & Muzyczka, N. (2008) · Journal of Virology · doi:10.1128/jvi.01939-08 · Cited by 86 · see citing works
“In all, some 26 proteins, some existing as multiprotein complexes, that interact with one or more Rep proteins, have been identified (6, 7, 12, 13, 20, 26, 28, 29, 35, 41, 42, 71, 76, 78, 82, 85, 94, 106, 115, 116, 125).”
Involvement of the nucleolus in replication of human viruses
Greco, A. (2009) · Reviews in Medical Virology · doi:10.1002/rmv.614 · Cited by 84 · see citing works
“Both viral proteins bind to nucleolin and B23 [50,51].”
BackgroundUnderstanding Capsid Assembly and Genome Packaging for Adeno-Associated Viruses
Bennett, A., Mietzsch, M., & Agbandje-McKenna, M. (2017) · Future Virology · doi:10.2217/fvl-2017-0011 · Cited by 82 · see citing works
Nuclear translocation of urokinase-type plasminogen activator.
Stepanova, V., Lebedeva, T., Kuo, A., Yarovoi, S., Tkachuk, S., Zaitsev, S., Bdeir, K. H., Dumler, I., Marks, M., Parfyonova, Y., et al. (2008) · Blood · doi:10.1182/blood-2007-07-104455 · Cited by 77 · see citing works
Cellular transduction mechanisms of adeno-associated viral vectors
Berry, G. E., & Asokan, A. (2016) · Current Opinion in Virology · doi:10.1016/j.coviro.2016.08.001 · Cited by 78 · see citing works
Bevington, J. M., Needham, P. G., Verrill, K. C., Collaco, R. F., Basrur, V., & Trempe, J. P. (2007) · Virology · doi:10.1016/j.virol.2006.07.050 · Cited by 65 · see citing works
“N IH -PA Author M anuscript N IH -PA Author M anuscript N IH -PA Author M anuscript AAV2 capsid by immunoprecipitation and immunofluorescence techniques (Qiu and Brown, 1999).”
BackgroundMethodLópez-Gordo, E., Chamberlain, K., Riyad, J. M., Kohlbrenner, E., & Weber, T. (2024) · Viruses · doi:10.3390/v16030442 · Cited by 61 · see citing works
“For example, knocking down two nucleolar proteins (nucleophosmin and nucleolin) enhanced transduction, demonstrating that they are critical factors for trafficking into and out of the nucleolus, respectively [168,169].”
BackgroundBacharach, E., Gonsky, J., Ålin, K., Orlova, M., & Goff, S. (2000) · Journal of Virology · doi:10.1128/jvi.74.23.11027-11039.2000 · Cited by 50 · see citing works
“Interestingly, nucleolin has been shown to associate with the capsid protein of adeno-associated virus type 2 and has been proposed to have a role in virion assembly in this system (54).”
BackgroundIntegrin αVβ5 Is Not Involved in Adeno-Associated Virus Type 2 (AAV2) Infection
Qiu, J.-M., & Brown, K. (1999) · Virology · doi:10.1006/viro.1999.0010 · Cited by 48 · see citing works
Self-citationHan, Z., Conley, S. M., & Naash, M. I. (2011) · Investigative Ophthalmology & Visual Science · doi:10.1167/iovs.10-6916 · Cited by 40 · see citing works
“Meanwhile, nucleolin has also been shown to associate with AAV2 virions from the cytoplasm to the nucleus.(71) The intracellular trafficking mechanism for CK30-NPs is incompletely understood.”
BackgroundIdentification of nucleolus localization signal of betanodavirus GGNNV protein α
Guo, Y.-X., Dallmann, K., & Kwang, J. (2003) · Virology · doi:10.1016/s0042-6822(02)00081-8 · Cited by 40
“B23 may serve as a shuttle for the import of protein from the cytoplasm to the nucleolus coupled to the export of viral mRNA (Qiu and Brown, 1999).”
BackgroundAydemir, F., Salganik, M., Resztak, J., Singh, J., Bennett, A., Agbandje-McKenna, M., & Muzyczka, N. (2016) · Journal of Virology · doi:10.1128/jvi.00493-16 · Cited by 39 · see citing works
Maehara, K., Hasegawa, T., & Isobe, K. (2000) · Journal of Cellular Biochemistry · doi:10.1002/(sici)1097-4644(20000601)77:3 · Cited by 52 · see citing works
Proteomics Analysis of Co-Purifying Cellular Proteins Associated with rAAV Vectors
Dong, B., Duan, X., Chow, H.-Y., Chen, L., Lu, H.-C., Wu, W.-M., Hauck, B., Wright, F., Kapranov, P., & Xiao, W. (2014) · PLoS ONE · doi:10.1371/journal.pone.0086453 · Cited by 36 · see citing works
“Interestingly, a combination of GeLC-MS and 2DE identified thirteen cellular proteins (Table 1 and 2), including nucleolin [17,18] and nucleophosm [17,19] which have been reported to bind to the capsid during AAV packaging or infection process.”
BackgroundSutter, S. O., Lkharrazi, A., Schraner, E. M., Michaelsen, K., Meier, A. F., Marx, J., Vogt, B., Büning, H., & Fraefel, C. (2022) · PLoS Pathogens · doi:10.1371/journal.ppat.1010187 · Cited by 29 · see citing works
“After nuclear entry, AAV2 capsids were shown to accumulate in nucleoli [14], possibly mediated by nucleoli-associated proteins [15,16].”
BackgroundMurray, S., Nilsson, C., Hare, J., Emmett, M., Korostelev, A., Ongley, H. M., Marshall, A., & Chapman, M. (2006) · Journal of Virology · doi:10.1128/jvi.02417-05 · Cited by 32 · see citing works
“Newly synthesized capsid proteins must be transported to the nucleolus for assembly of the DNA-containing virions (41), and specific binding of a nucleolus-targeting protein to VP2, and of nucleolin to AAV-2 virions has been reported (22, 41).”
BackgroundScarrott, J. M., Johari, Y. B., Pohle, T. H., Liu, P., Mayer, A., & James, D. C. (2022) · Biotechnology Journal · doi:10.1002/biot.202200450 · Cited by 29 · see citing works
Song, J.-W., Quan, R., Wang, D., & Liu, J. (2022) · Microbiology spectrum · doi:10.1128/spectrum.00304-22 · Cited by 24
“HA-NCL-F HA-NCL-R HA-NCL (546-699)-F HA-NCL (1-545)-R NCL-GFP-F NCL-GFP-R Fibrillarin-GFP-F Fibrillarin-GFP-R TGGCCATGGAGGCCCGAATTCGGATGGCTCCTCCTCCAAAGGAGGTG GATCCCCGCGGCCGCGGTACCTTATTCAAACTTCGTCTTCTTTCC TGGCCATGGAGGCCCGAATTCGGGGACCCAGGGGATCGCCTAATG GATCCCCGCGGCCGCGGTACCTTATTGTAACTCCAGCCTGATTGT GAGGTTTAAACTACGGGATCCAA…”
BackgroundThe function of DNA binding protein nucleophosmin in AAV replication
Satkunanathan, S., Thorpe, R., & Zhao, Y. (2017) · Virology · doi:10.1016/j.virol.2017.07.007 · Cited by 24 · see citing works
Satkunanathan, S., Wheeler, J. X., Thorpe, R., & Zhao, Y. (2014) · Human Gene Therapy · doi:10.1089/hum.2014.041 · Cited by 23 · see citing works
“NCL and NPM1 are nucleolus proteins with many functions, which bind to AAV2 capsids and shuttle the AAV proteins between the cytoplasm and nucleus (Qiu and Brown, 1999; Bevington et al., 2007; Johnson and Samulski, 2009), demonstrating an important role of cellular proteins in AAV capsid assembly…”
Zhuang, X. A., Gallo, G., Sharma, P., Ha, J., Magri, A., Borrmann, H., Harris, J. M., Tsukuda, S., Bentley, E. G., Kirby, A., et al. (2023) · iScience · doi:10.1016/j.isci.2023.108763 · Cited by 17 · see citing works
“75 As NCL has been reported to interact with other viruses including parainfluenza type 3, 76 enterovirus 71, 77 Crimean–Congo haemorrhagic fever virus 78 and adeno-associated virus type 2, 79 our observation showing the HIF/miR494 regulation of NCL may be widely applicable to many viruses.”
BackgroundChandran, J. S., Sharp, P., Karyka, E., Aves-Cruzeiro, J. M. D. C., Coldicott, I., Castelli, L., Hautbergue, G., Collins, M., & Azzouz, M. (2017) · Scientific Reports · doi:10.1038/s41598-017-15255-2 · Cited by 17 · see citing works
The Expression and Function of the Small Nonstructural Proteins of Adeno-Associated Viruses (AAVs)
Küz, Ç. A., McFarlin, S., & Qiu, J. (2024) · Viruses · doi:10.3390/v16081215 · Cited by 15 · see citing works
“The capsid is assembled in the nucleoli followed by the VP1u and VP2u NLS-mediated input of the cytoplasmic trimerized structural proteins [85–87].”
BackgroundSelf-citationWang, Y.-H., Chen, Y.-H., Lu, J., & Tsai, H.-J. (2005) · DNA and Cell Biology · doi:10.1089/dna.2005.24.651 · Cited by 16
“In some cases, nucleolin binds to viral proteins to modulate virus replication (Lee et al ., 1998; Qiu and Brown, 1999).”
Herpesvirus-based infectious titering of recombinant adeno-associated viral vectors
Mohiuddin, I. T., Loiler, S., Zolotukhin, I., Byrne, B. J., Flotte, T. R., & Snyder, R. O. (2004) · Molecular Therapy · doi:10.1016/j.ymthe.2004.08.030 · Cited by 15 · see citing works
Salazar, R., Brandt, R., & Krantz, S. (2001) · Glycoconjugate Journal · doi:10.1023/a:1021151417556 · Cited by 15
Nucleolin is a calcium‐binding protein
Gilchrist, J. S. C., Abrenica, B., DiMario, P., Czubryt, M., & Pierce, G. (2002) · Journal of Cellular Biochemistry · doi:10.1002/jcb.10121 · Cited by 15
Leibiger, T., Min, L., & Lee, K. H. (2024) · Molecular Therapy: Methods & Clinical Development · doi:10.1016/j.omtm.2024.101383 · Cited by 14 · see citing works
The RSV fusion receptor: not what everyone expected it to be.
Mastrangelo, P., & Hegele, R. (2012) · Microbes and infection · doi:10.1016/j.micinf.2012.07.015 · Cited by 14
Fluorescence Microscopy in Adeno-Associated Virus Research
Golm, S. K., Hübner, W., & Müller, K. M. (2023) · Viruses · doi:10.3390/v15051174 · Cited by 12 · see citing works
“For example, the colocalization of AAV2 with nucleolin confirmed the interaction [82].”
BackgroundJapanese encephalitis virus NS5 protein interacts with nucleolin to enhance the virus replication
Deb, A., Nagpal, S., Yadav, R., Thakur, H., Nair, D., Krishnan, V., & Vrati, S. (2024) · Journal of Virology · doi:10.1128/jvi.00858-24 · Cited by 10
“For example, it binds to the capsid protein of the DEN virus and Adeno-associated virus-2 (AAV-2) and has a role in virus egress (78, 79).”
Garcia, R. C., Banfi, E., & Pittis, M. G. (2000) · Infection and Immunity · doi:10.1128/iai.68.6.3121-3128.2000 · Cited by 10 · see citing works
“Interestingly, nucleolin has also been found associated with the cell membrane of HepG2 (11, 28), HEp-2 (11), Jurkat (20), HeLa S3 (26), and K562 (26) cells, as well as lymphocytes and macrophages (27), in agreement with our detection of membrane- associated nucleolin.”
ResultShen, W., Lai, Y. K. Y., Lai, C., & Rakoczy, P. E. (2003) · Vision Research · doi:10.1016/j.visres.2003.09.032 · Cited by 6 · see citing works
Intracellular localization of adeno‐associated viral proteins expressed in insect cells
Gallo-Ramírez, L. E., Ramírez, O. T., & Palomares, L. A. (2011) · Biotechnology progress (Print) · doi:10.1002/btpr.565 · Cited by 7 · see citing works
Sun, X.-L., Zhao, J., Jin, S.-B., Palka, K., Visa, N., Aissouni, Y., Daneholt, B., & Alzhanova-Ericsson, A. T. (2002) · European Journal of Cell Biology · doi:10.1078/0171-9335-00231 · Cited by 5
Viruses with a Double-Stranded DNA Genome
Modrow, S., Dietrich, F., Truyen, U., & Schätzl, H. (2013) · Springer eBooks · doi:10.1007/978-3-642-20718-1_19 · Cited by 3 · see citing works
The Cold Case Files of rAAV Capsid Influence on Transduction: New Leads
Powell, S. (2025) · Viruses · doi:10.3390/v17111476 · Cited by 2 · see citing works
“At one assessed time point, HDAC4 reduction also increased rAAV9 capsids detected in the nucleus and colocalization with nucleolin [49], which has been shown to bind wtAAV2 capsids during replication [60].”
Steinkellner, H., Madritsch, S., Kluge, M., Seipel, T., Sarne, V., Huber, A., Schosserer, M., Oberle, R., Neuhaus, W., Beribisky, A. V., et al. (2024) · Genes · doi:10.3390/genes15121514 · Cited by 2 · see citing works
Rajapaksha, I. G., Angus, P., & Herath, C. B. (2019) · IntechOpen eBooks · doi:10.5772/intechopen.80317 · Cited by 5 · see citing works
“Interestingly, there is further evidence that nucleolin, a protein that shuttles between cytoplasm and nucleus, specifically binds to AAV capsid, which suggests that nucleolin may act as a nuclear receptor for AAV particles as well [41].”
BackgroundParvovirus Vectors for the Gene Therapy of Cancer
Wong, K. K., & Chatterjee, S. (2002) · Elsevier eBooks · doi:10.1016/b978-012437551-2/50004-5
Intracellular trafficking and nuclear compartmentalization of AAV gene delivery
Hutchinson, T. E., Singh, R. E., Oliver, J. Y., Davis, A., Potter, M., Hsi, J., Mietzsch, M., Bennett, A. D., & McKenna, R. (2026) · Molecular Therapy Advances · doi:10.1016/j.omta.2026.201770
“67 70 Single-cell analysis using immunofluorescence and in situ hybridization reveals the colocalization of AAV2 capsid and genome in the nucleoli during viral infection.”
Canine parvovirus infection affects host cell nucleolar organization and ribosome biogenesis
Huttunen, M., Hakanen, S., Aho, V., Leclerc, S., Soenmez, A., Kapishnikov, S., Zannotti, A., Ruokolainen, V., Salokas, K., Varjosalo, M., et al. (2026) · Communications Biology · doi:10.1038/s42003-025-09385-x
“Interestingly, NCLhasearlierbeenshowntoformcomplexeswiththeviralsingle-strandedgenomesofMVMinvitro 96 andtobindAAV-2capsidsassembled in the nucleoli in vivo 6,7,97 .”
Amberg, B., Köchl, F., Kumpesa, N., Prasad, M. K., Bochner, F., Hernandez-Obiols, M., Otteneder, M. B., Stalder, L., Shaffo, F. C., Nowrouzi, A., et al. (2026) · Gene Therapy · doi:10.1038/s41434-026-00600-w · Cited by 1 · see citing works
“We hypothesize that this may facilitate a potential feedback mechanism wherein transgene expression indirectly in fl uences host circadian regulation via Dbp .”
Earley, L. F., Kawano, Y., Adachi, K., Sun, X.-X., Dai, M.-S., & Nakai, H. (2014) · Journal of Virology · doi:10.1128/jvi.03125-14
Gene-Based Medicine for Ocular Diseases
Conley, S. M., & Naash, M. (2012) · doi:10.1201/b12950-22
AAV vectors for the nucleolus.
Russell, D. (2012) · Molecular Therapy · doi:10.1038/mt.2012.193
Viren mit einzelsträngigem DNA-Genom
Modrow, S., Falke, D., Truyen, U., & Schätzl, H. (2021) · Molekulare Virologie · doi:10.1007/978-3-8274-2241-5_20
Immune System Obstacles to In vivo Gene Transfer with Adeno-Associated Virus Vectors
Büning, H., & Mingozzi, F. (2015) · Elsevier eBooks · doi:10.1016/b978-0-12-800563-7.00004-x · Cited by 1 · see citing works
Life and Death Signaling Pathways in CVB3-Induced Myocarditis
Yanagawa, B., Esfandiarei, M., Carthy, C. M., Cheung, P., Luo, H., Granville, D. J., Yang, D., Choy, J. C., Lui, A., Dabiri, D., et al. (2003) · Humana Press eBooks · doi:10.1007/978-1-59259-319-4_7
- Authors
- Qiu, J., & Brown, K. E.
- Affiliations
- National Institutes of Health (US)
- Corresponding author
- Qiu, Jianming
- Venue
- Virology
- Publisher
- Elsevier BV
- Published
- 1999-05
- Volume
- 257
- Issue
- 2
- Pages
- 373-382
- ISSN
- 0042-6822 (ISSN-L)
- OpenAlex
- W2087100112
- Cited by
- 86
- References
- 44
- Citations by year
- 2026: 3 · 2025: 1 · 2024: 7 · 2023: 2 · 2022: 3 · 2021: 1 · 2019: 5 · 2018: 2 · 2017: 4 · 2016: 4 · 2015: 4 · 2014: 4 · 2013: 3 · 2012: 3
- FWCI
- 1.94
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- Locations
- Virology (publishedVersion)
- PubMed (publishedVersion)
- Funders
- University of Pittsburgh
- National Institutes of Health
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Virus-based gene therapy research
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › RNA Interference and Gene Delivery
- Health Sciences › Medicine › Epidemiology › Virology and Viral Diseases
- Keywords
- nucleolin, adeno-associated virus type 2, capsid assembly, nucleolar phosphoprotein, nucleolus, viral replication, subcellular localization
- MeSH terms
- Nucleolin, Dependovirus, Animals, Capsid, Cell Line, Transformed, Cell Nucleus, Cytoplasm, HeLa Cells, Humans, Mice, Inbred BALB C, Nuclear Proteins, Phosphoproteins, Tumor Cells, Cultured, RNA-Binding Proteins, K562 Cells, Mice
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
