Astrovirus Infections in Humans and Animals—Molecular Biology, Genetic Diversity, and Interspecies Transmissions

“Astroviruses are small, non-enveloped RNA viruses first identified in 1975 by electron microscopy (EM) in children suffering from diarrhea (Appleton and Higgins, 1975; Madeley and Cosgrove, 1975b; Matsui and Greenberg, 1996).”

“In several cases these genotypes were detected and initially differentiated using a set of conserved primers to the ORF1b termed Mon269 (50 CAACTCAGGAAACAGGGTGT) and Mon270 (50 TCAGATGCATTGTCATTGGT) (Noel et al., 1995).”

“They termed the virus MLB1 (AstV-MLB1) and went onto characterize the genome, demonstrating that AstV-MLB1 was highly divergent from any of the known astroviruses (Finkbeiner et al., 2008b).”

“HastV-PS is also genetically related to AstV-VA1 (Finkbeiner et al., 2009b) and to a lesser extent to MiAstVs and OAstVs, thus falling within the proposed genocluster GII of Mamastroviruses (Bosch et al., 2010b; Quan et al., 2010) .”

“Astroviruses are small, non-enveloped RNA viruses first identified in 1975 by electron microscopy (EM) in children suffering from diarrhea (Appleton and Higgins, 1975; Madeley and Cosgrove, 1975b; Matsui and Greenberg, 1996).”

“Astroviruses do not easily grow in laboratory host systems and for this reason serological classification is difficult and is generally speculated based on percentage of nucleotide and amino acid similarity of the ORF2 encoding for the capsid protein (Chu et al., 2008; Koci et al., 2000; Reuter et al., 2011).”

“The transmembrane domains may localize nsp1a/2 to the endoplasmic reticulum (ER) membrane to facilitate replication (Guix et al., 2004) similar to other positivestrand RNA viruses (Ahlquist, 2006; Geigenmuller et al., 2002; Guix et al., 2004, 2005; Kiang and Matsui, 2002; Speroni et al., 2009).”

“The first isolate of bovine astrovirus was reported in England in 1978 (Woode and Bridger, 1978).”

“…geneti- cally close to rat astroviruses discovered in Hong Kong (Chu et al., 2010; Finkbeiner et al., 2008b, 2009a, c), and HAstVs genetically related to MiAstVs and OAstVs, thus called human, mink-, and ovinelike, HMOAstVs A, B, and C and AstV-VA1 (Finkbeiner et al., 2009b; Kapoor et al., 2009).”

“, 2002) and more recently a novel AstV has been discovered in brain tissue of mink developing the so-called shaking mink syndrome (SMS) (Blomstrom et al., 2010).”

“All six BatAstVs found in the German colony fell within the putative genocluster GII and clustered with other previously discovered AstVs from Myotis chinensis and Myotis ricketti in mainland China (aminaocid similarity ranging from 65–86”

“…geneti- cally close to rat astroviruses discovered in Hong Kong (Chu et al., 2010; Finkbeiner et al., 2008b, 2009a, c), and HAstVs genetically related to MiAstVs and OAstVs, thus called human, mink-, and ovinelike, HMOAstVs A, B, and C and AstV-VA1 (Finkbeiner et al., 2009b; Kapoor et al., 2009).”

“HAstV-6 and 7 are rarely detected (De Grazia et al., 2011; Gabbay et al., 2007; Guix et al., 2002; Liu et al., 2008; Mendez-Toss et al., 2004; Mustafa et al., 2000; Palombo and Bishop, 1996).”

“Upon infection, clinical symptoms normally last between 2 to 4 days and consist of watery diarrhea and less commonly vomiting, headache, fever, abdominal pain and anorexia (Glass et al., 1996 (Glass et al., , 2001 LeBaron et al., 1990; Mitchell et al., 1999) .”

“, 2002), although, HAstV can be detected in the spring and summer seasons as well (Herrmann et al., 1991; Noel and Cubitt, 1994).”

“Although it should be pointed out that the presence of these projections is pH dependent and may only be present in less than 10% of the population (Caul and Appleton, 1982; Koci and Schultz-Cherry, 2002).”

“…geneti- cally close to rat astroviruses discovered in Hong Kong (Chu et al., 2010; Finkbeiner et al., 2008b, 2009a, c), and HAstVs genetically related to MiAstVs and OAstVs, thus called human, mink-, and ovinelike, HMOAstVs A, B, and C and AstV-VA1 (Finkbeiner et al., 2009b; Kapoor et al., 2009).”

“Astroviruses are small, non-enveloped RNA viruses first identified in 1975 by electron microscopy (EM) in children suffering from diarrhea (Appleton and Higgins, 1975; Madeley and Cosgrove, 1975b; Matsui and Greenberg, 1996).”

“The sgRNA is about 2.4 kb and encodes the capsid precursor polypeptide of 87–90 kDa (Monroe et al., 1993).”

“* Firstly identified as enterovirus-like, was finally classified as a new member of the family Astroviridae in 2000 (Imada et al., 2000).”

“…suffering from gastroenteritis, namely AstV-MLB1 and MLB-2 which are geneti- cally close to rat astroviruses discovered in Hong Kong (Chu et al., 2010; Finkbeiner et al., 2008b, 2009a, c), and HAstVs genetically related to MiAstVs and OAstVs, thus called human, mink-, and ovinelike, HMOAstVs…”

“…HAstV-1 has been divided into a least six lineages, HAstV-1a–1f (Gabbay et al., 2007); HAstV-2 into at least three lineages, HAstV-2a–2c (De Grazia et al., 2011; Gabbay et al., 2007); HAstV3 into two lineages (Belliot et al., 1997a,b; Liu et al., 2008); and HAstV-4 into two lineages, 4a and 4b.”

“Upon infection, clinical symptoms normally last between 2 to 4 days and consist of watery diarrhea and less commonly vomiting, headache, fever, abdominal pain and anorexia (Glass et al., 1996 (Glass et al., , 2001 LeBaron et al., 1990; Mitchell et al., 1999) .”

“Upon infection, clinical symptoms normally last between 2 to 4 days and consist of watery diarrhea and less commonly vomiting, headache, fever, abdominal pain and anorexia (Glass et al., 1996, 2001; LeBaron et al., 1990; Mitchell et al., 1999).”

“In fact, in some instances the typical star-like appearance is not easily recognizable in EM preparations and astroviruses could be misidentified as enteroviruses or provisionally named astrovirus-like particles or small round viruses (SRVs) (Guy et al., 2004; Koci and Schultz-Cherry, 2002).”

“The second reading frame, ORF1b, which encodes the viral RNAdependent RNA polymerase (RdRp) (Matsui and Greenberg, 1996), overlaps ORF1a by 70 nucleotides and is translated by a frame-shift into the 1 frame and is a common mechanism, though not unique, among plus-stranded animal RNA viruses (Lewis and Matsui, 1996).”

“Five genetically distinct AstVs have recently been found in the fecal samples of three marine mammal species: a California sea lion (CslAstV-1, CslAstV-2, CslAstV-3), a Steller’s sea lion (SslAstV) and a bottlenose dolphin (BdAstV) (Rivera et al., 2010).”

“The difficulty of astrovirus to grow in common laboratory hosts systems prevented early characterization, but in 1981 Lee and Kurtz demonstrated productive virus growth and passaging with the addition of trypsin in human kidney epithelial (HEK) cells (Lee and Kurtz, 1981).”

“Serological evidence of CAstV has been demonstrated in broiler flocks in the UK, the Netherlands, Spain, Australia, and the USA (Baxendale and Mebatsion, 2004) and more recently in broiler parent flocks in the UK that spread to European breeder flocks (Todd et al., 2009b), which suggests a worldwide distribution.”

“Studies by Moser et al. (2007) demonstrated that astroviruses increase epithelial barrier permeability by disrupting cellular tight junction complexes (Moser et al., 2007).”

“…2003), and found to harbor, as most of known AstVs, a RNA motif in the 30 end of the genome common to distinct and genetically different virus families (i.e. Coronaviruses and Picornaviruses) and supposed to be representative of a recombination event between these viruses (Jonassen et al., 1998).”

“Astroviruses do not easily grow in laboratory host systems and for this reason serological classification is difficult and is generally speculated based on percentage of nucleotide and amino acid similarity of the ORF2 encoding for the capsid protein (Chu et al., 2008; Koci et al., 2000; Reuter et al., 2011).”

“The astrovirus-associated disease in ducklings was first described in 1984 and was based on morphology of the virions by EM (Gough et al., 1984).”

“It was not until 1990 that this technique was applied to a more representative cell line; the human colon carcinoma cell line Caco2, which has become standard (Willcocks et al., 1990).”

“Subsequently, a bovine enteric virus antigenically related to the UK strain of BoAstV was isolated in Florida from a calf with diarrhea (Woode et al., 1984) .”

“The complete genome sequence for Human Astrovirus 1 was determined in 1994 and the first infectious cDNA clone was developed in 1997 (Geigenmuller et al., 1997; Willcocks et al., 1994) .”

“HAstV-6 and 7 are rarely detected (De Grazia et al., 2011; Gabbay et al., 2007; Guix et al., 2002; Liu et al., 2008; Mendez-Toss et al., 2004; Mustafa et al., 2000; Palombo and Bishop, 1996).”

“HAstV-6 and 7 are rarely detected (De Grazia et al., 2011; Gabbay et al., 2007; Guix et al., 2002; Liu et al., 2008; Mendez-Toss et al., 2004; Mustafa et al., 2000; Palombo and Bishop, 1996).”

“Astrovirus infection in lambs probably represents the first report confirming the occurrence of astrovirus infections in animals and was described in 1977 shortly after the description of astroviruses in humans (Snodgrass and Gray, 1977).”

“…an 70–80 kDa protein, which is further extracellularly cleaved by trypsin increasing infectivity up to 105 fold, condensing the virion to approximately 28 nm, and transforming the 70–80 kDa capsid protein into at least three smaller peptides of approximately 34, 29, and 26 kDa (Bass and Qiu, 2000).”

“It was originally concluded that in natural conditions, BoAstV does not seem to be directly associated with a severe diarrheic disease in calves (Bridger et al., 1984; Tse et al., 2011; Woode and Bridger, 1978; Woode et al., 1984) and few controversial data are available on the prevalence of this…”

“HAstVs predominately affect children under the age of 2, elderly people and immunocompromised individuals and are thought to be involved in up to 20% of the cases of sporadic non-bacterial diarrheas and 0.5-15% of diarrheal outbreaks (Kirkwood et al., 2005; Moser and Schultz-Cherry, 2005) .”

“Field observations indicate that TAstV-2 is currently more prevalent in turkeys than TAstV-1 (Cattoli et al., 2007; Pantin-Jackwood et al., 2006b) and its occurrence is often associated with other enteric viruses (Jindal et al., 2010a,b; Reynolds et al., 1987).”

“C (PoAstVs), GI.”

“(2009) sequenced the complete genome of a duck astrovirus associated with fatal hepatitis in Chinese ducklings (Fu et al., 2009).”

“It requires a highly conserved heptameric sequence (A6C) and a downstream hairpin structure (Lewis and Matsui, 1995, 1996, 1997; Marczinke et al., 1994) (see Fig.”

“Several studies suggest that 33–65% of symptomatic HAstV infection may be associated to other enteric microbes like rotavirus and norovirus (Colomba et al., 2006; Roman et al., 2003).”

“5–15% of diarrheal outbreaks (Kirkwood et al., 2005; Moser and Schultz-Cherry, 2005).”

“Generally speaking TAstVs are widely spread and considered as the most prevalent virus infection in 1– 5 week-old poults suffering from diarrhea (Jindal et al., 2010a,b; Reynolds and Saif, 1986; Reynolds et al., 1987; Saif et al., 1985).”

“Genetic and antigenic characterization of two turkey isolates related to TAstV-2 (TAstV1987-TAstVT2001 also identified as TAstV-3) suggests that they could be virtually classified as two different serotypes (Pantin-Jackwood et al., 2011; Tang and Saif, 2004; Tang et al., 2005), similarly to strain MN/01 (Strain et al.”

“Similar to the study from Walter et al.”

“Turkey (Meleagris meleagris) 1980 McNulty et al. (1980) Poult enteritis complex (PEC),”

“Intracellular proteolytic processing by cellular proteases including caspases (Banos-Lara Mdel and Mendez, 2010; Mendez et al., 2002, 2004) yields an 70–80 kDa protein, which is further extracellularly cleaved by trypsin increasing infectivity up to 105 fold, condensing the virion to approximately…”

“Intracellular proteolytic processing by cellular proteases including caspases (Banos-Lara Mdel and Mendez, 2010; Mendez et al., 2002 yields an $70-80 kDa protein, which is further extracellularly cleaved by trypsin increasing infectivity up to 10 5 fold, condensing the virion to approximately 28 nm, and transforming t…”

“…et al., 2008), PoAstVs (Luo et al., 2011), BoAstVs (Tse et al., 2011), BatAstVs (Chu et al., 2008; Drexler et al., 2011; Zhu et al., 2009), RatAstVs (Chu et al., 2010), TAstVs (Cattoli et al., 2007; Pantin-Jackwood et al., 2006b; Strain et al., 2008) and CAstV (Pantin-Jackwood et al., 2011; Todd…”

“Similarly, a possible recombination event between PoAstV and HAstV3 was described in another recent publication (Ulloa and Gutierrez, 2010).”

“Generally speaking TAstVs are widely spread and considered as the most prevalent virus infection in 1– 5 week-old poults suffering from diarrhea (Jindal et al., 2010a,b; Reynolds and Saif, 1986; Reynolds et al., 1987; Saif et al., 1985).”

“…geneti- cally close to rat astroviruses discovered in Hong Kong (Chu et al., 2010; Finkbeiner et al., 2008b, 2009a, c), and HAstVs genetically related to MiAstVs and OAstVs, thus called human, mink-, and ovinelike, HMOAstVs A, B, and C and AstV-VA1 (Finkbeiner et al., 2009b; Kapoor et al., 2009).”

“PoAstV prevalence is considered variable from 0% to 83% and 100% based on serological and virological surveillance, respectively (Luo et al., 2011; Shimizu et al., 1990).”

“Several studies suggest that 33–65% of symptomatic HAstV infection may be associated to other enteric microbes like rotavirus and norovirus (Colomba et al., 2006; Roman et al., 2003).”

“All six BatAstVs found in the German colony fell within the putative genocluster GII and clustered with other previously discovered AstVs from Myotis chinensis and Myotis ricketti in mainland China (aminaocid similarity ranging from 65–86”

“However, there is evidence that HAstV infections can be asymptomatic in children and adults (Mendez-Toss et al., 2004).”

“The prevalence of TAstV varies from 40 to 80% in symptomatic poults (Cattoli et al., 2007; Domanska-Blicharz et al., 2011; Jindal et al., 2010a; Reynolds et al., 1987) to less than 30% to 50% in healthy flocks (Jindal et al., 2010b; Reynolds et al., 1987) .”

“…De Grazia et al., 2011; Finkbeiner et al., 2009a–c; Gabbay et al., 2007; Kapoor et al., 2009; Liu et al., 2008), PoAstVs (Luo et al., 2011), BoAstVs (Tse et al., 2011), BatAstVs (Chu et al., 2008; Drexler et al., 2011; Zhu et al., 2009), RatAstVs (Chu et al., 2010), TAstVs (Cattoli et al., 2007;…”

“Field observations indicate that TAstV-2 is currently more prevalent in turkeys than TAstV-1 (Cattoli et al., 2007; Pantin-Jackwood et al., 2006b) and its occurrence is often associated with other enteric viruses (Jindal et al., 2010a,b; Reynolds et al., 1987).”

“absorptive epithelial cells of the small intestine and induces mild diarrhea in gnotobiotic lambs (Gray et al., 1980; Snodgrass et al., 1979).”

“Nevertheless, this OAstV genome has been extensively analyzed as a prototype Mamastrovirus (Jonassen et al., 2003), and found to harbor, as most of known AstVs, a RNA motif in the 30 end of the genome common to distinct and genetically different virus families (i.”

“Serological evidence of CAstV has been demonstrated in broiler flocks in the UK, the Netherlands, Spain, Australia, and the USA (Baxendale and Mebatsion, 2004) and more recently in broiler parent flocks in the UK that spread to European breeder flocks (Todd et al., 2009b), which suggests a worldwide distribution.”

“In mink, AstV infection has been considered a significant risk factor for the pre-weaning diarrhea syndrome (Englund et al., 2002) and more recently a novel AstV has been discovered in brain tissue of mink developing the so-called shaking mink syndrome (SMS) (Blomstrom et al., 2010).”

“In fact, genetic variability has been described in almost all mama-and avastrovirus species sufficiently examined (Belliot et al., 1997a,b; Chu et al., 2010; De Grazia et al., 2011; Finkbeiner et al., 2009a-c; Gabbay et al., 2007; Kapoor et al., 2009; Liu et al., 2008) , PoAstVs (Luo et al., 2011) , BoAstVs (Tse et al…”

“It has been shown to be a unique inhibitor of the complement pathway by binding to complement C1 and mannosebinding lectin (MBL) inhibiting the activation of the classical and lectin complement pathways, respectively (Bonaparte et al., 2008; Gronemus et al., 2010; Hair et al., 2010; ) .”

“Upon infection, clinical symptoms normally last between 2 to 4 days and consist of watery diarrhea and less commonly vomiting, headache, fever, abdominal pain and anorexia (Glass et al., 1996, 2001; LeBaron et al., 1990; Mitchell et al., 1999).”

“Several AstVs have recently been detected in new species, namely guinea fowl, insectivorous bats, dogs, cheetahs, marine mammals, and brown rats (Atkins et al., 2009; Cattoli et al., 2005; Chu et al., 2008, 2010; Rivera et al., 2010; Toffan et al., 2009; Zhu et al., 2009).”

“…regions of the astrovirus capside protein exposed to the immune pressure and environmental changes, such as predicted epitopes or sites interacting with host cells, are subject to positive selection and codon changes (Lukashov and Goudsmit, 2002; Strain et al., 2008; van Hemert et al., 2007a).”

“The first clinical description of a disease syndrome (duck hepatitis) presumably associated with astrovirus infection in poultry dates back to 1965 (Asplin, 1965a,b).”

“Livers in the affected animals displays typical multiple and widespread hemorrhagic lesions, indicating necrosis of the hepatocyte cytoplasm with the formation of much cavitations or ballooning degeneration at the histopatological investigation (Fu et al., 2009; Gough et al., 1985).”

“This very interesting work also demonstrated that astroviruses can result in persistent infections, some lasting up to 3 months, and described a quantitative RT-PCR assay to detect the HAstV genomes per gram of feces (Caballero et al., 2003).”

“When transfected with an infectious in vitro transcribed astrovirus genomic RNA, baby hamster kidney (BHK) cells support virus replication but are refractory to infection by the whole virus, suggesting they lack the appropriate cell surface receptor (Geigenmuller et al., 1997).”

“It has been shown to be a unique inhibitor of the complement pathway by binding to complement C1 and mannosebinding lectin (MBL) inhibiting the activation of the classical and lectin complement pathways, respectively (Bonaparte et al., 2008; Gronemus et al., 2010; Hair et al., 2010; ) .”

“Intracellular proteolytic processing by cellular proteases including caspases (Banos-Lara Mdel and Mendez, 2010; Mendez et al., 2002, 2004) yields an 70–80 kDa protein, which is further extracellularly cleaved by trypsin increasing infectivity up to 105 fold, condensing the virion to approximately…”

“, 2002), although, HAstV can be detected in the spring and summer seasons as well (Herrmann et al., 1991; Noel and Cubitt, 1994).”

“Based on these suggestions, HAstV-1 has been divided into a least six lineages, HAstV-1a–1f (Gabbay et al., 2007); HAstV-2 into at least three lineages, HAstV-2a–2c (De Grazia et al.”

“Astroviruses do not easily grow in laboratory host systems and for this reason serological classification is difficult and is generally speculated based on percentage of nucleotide and amino acid similarity of the ORF2 encoding for the capsid protein (Chu et al., 2008; Koci et al., 2000; Reuter et al., 2011).”

“Others proposed that strains showing a sequence diversity of at least 7% could be considered as new lineages (Guix et al., 2002; Medina et al., 2000).”

“Several AstVs have recently been detected in new species, namely guinea fowl, insectivorous bats, dogs, cheetahs, marine mammals, and brown rats (Atkins et al., 2009; Cattoli et al., 2005; Chu et al., 2008, 2010; Rivera et al., 2010; Toffan et al., 2009; Zhu et al., 2009).”

“These are: duck astrovirus 1 (DAstV-1), turkey astrovirus 1 and 2 (TAstV-1 and TAstV-2), and avian nephritis virus (ANV) as AAstVs, bovine astrovirus (BoAstV), feline astrovirus (FeAstV), human astroviruses (HAstVs 1–8), ovine astrovirus (OAstV), mink astrovirus (MiAstV), and porcine astrovirus (PoAstV) as MAstrVs.”

“The translated polypeptide is cleaved by both cellular protease(s) and the viral protease into at least five peptides (Geigenmuller et al., 2002; Guix et al., 2005; Kiang and Matsui, 2002).”

“ANV typically causes histological changes in the kidneys although the viral antigen can be detected in other organs, namely liver, spleen, pancreas, jejunum and rectum (Imada et al., 1979, 1983; Shimizu et al., 1990; Shirai et al., 1989, 1992).”

“Field observations indicate that TAstV-2 is currently more prevalent in turkeys than TAstV-1 (Cattoli et al., 2007; Pantin-Jackwood et al., 2006b) and its occurrence is often associated with other enteric viruses (Jindal et al., 2010a,b; Reynolds et al., 1987).”

“It has been shown to be a unique inhibitor of the complement pathway by binding to complement C1 and mannosebinding lectin (MBL) inhibiting the activation of the classical and lectin complement pathways, respectively (Bonaparte et al., 2008; Gronemus et al., 2010; Hair et al., 2010; ) .”

“An astrovirus-like infection was associated with an outbreak of gastroenteritis in inbred mice by EM (Kjeldsberg and Hem, 1985).”

“The polypeptide contains a variety of conserved motifs, including several putative transmembrane helices, coiled coil domains, an immunoreactive epitope, putative nuclear localization signal (NLS), and serine protease (Guix et al., 2004; Matsui et al., 1993).”

“absorptive epithelial cells of the small intestine and induces mild diarrhea in gnotobiotic lambs (Gray et al., 1980; Snodgrass et al., 1979).”

“The transmembrane domains may localize nsp1a/2 to the endoplasmic reticulum (ER) membrane to facilitate replication (Guix et al., 2004) similar to other positivestrand RNA viruses (Ahlquist, 2006; Geigenmuller et al.”

“Inhibition of ERK1/2 activity resulted in decreased viral replication early in the course of infection (Moser and Schultz-Cherry, 2008).”

“Although genetic characterization was not performed for this virus, antigenic characterization indicated that the new virus was unrelated to OAstV or BoAstV grown in cell cultures (Tzipori et al., 1981).”

“VPg is believed to exist (Al-Mutairy et al., 2005) although this hypothesis has yet to be confirmed (Carter and Willcocks, 1996).”

“Field observations indicate that TAstV-2 is currently more prevalent in turkeys than TAstV-1 (Cattoli et al., 2007; Pantin-Jackwood et al., 2006b) and its occurrence is often associated with other enteric viruses (Jindal et al., 2010a,b; Reynolds et al., 1987).”

“Mink astrovirus (MiAstV). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .”

“They showed that poults exposed to all three viruses administered in combination had the lowest body weight, although the weights were not significantly different from control birds (Spackman et al., 2010).”

“The translated polypeptide is cleaved by both cellular protease(s) and the viral protease into at least five peptides (Geigenmuller et al., 2002; Guix et al., 2005; Kiang and Matsui, 2002).”

“…surveys indicate that ANV is widely distributed worldwide and that serological evidence can be found in turkeys as well (Connor et al., 1987; Decaesstecker et al., 1989; Hewson et al., 2010; Imada et al., 1980; McNulty et al., 1989; Nicholas et al., 1988; Takase et al., 1989; Zhao et al., 2011).”

“TAstV-2 was characterized in association with poult enteritis mortality syndrome (PEMS) (Koci et al., 2000) and PEMS-associated TAstV-2 has been shown to cause enteritis, thymic and bursal atrophy, and increased mortality in experimentally infected poults (Behling-Kelly et al., 2002).”

“PoAstV-1 was partially characterized in 2006 (Indik et al., 2006), sharing only 86% nucleotide similarity with the previously characterized strain and clearly indicating that multiple serotypes could infect pigs (Indik et al., 2006).”

“The prevalence of TAstV varies from 40 to 80% in symptomatic poults (Cattoli et al., 2007; Domanska-Blicharz et al., 2011; Jindal et al., 2010a; Reynolds et al., 1987) to less than 30% to 50% in healthy flocks (Jindal et al., 2010b; Reynolds et al., 1987) .”

“However, infection in dogs was only recently confirmed by genetic characterization (Toffan et al., 2009; Zhu et al., 2011) and a canine astrovirus has also been recently isolated in cell culture (Martella et al., 2011) (Table 2).”

“Astroviruses are small, non-enveloped RNA viruses first identified in 1975 by electron microscopy (EM) in children suffering from diarrhea (Appleton and Higgins, 1975; Madeley and Cosgrove, 1975b; Matsui and Greenberg, 1996).”

“In fact, genetic variability has been described in almost all mama-and avastrovirus species sufficiently examined (Belliot et al., 1997a,b; Chu et al., 2010; De Grazia et al., 2011; Finkbeiner et al., 2009a-c; Gabbay et al., 2007; Kapoor et al., 2009; Liu et al., 2008) , PoAstVs (Luo et al., 2011) , BoAstVs (Tse et al…”

“…free chicks (Shirai et al., 1991) an experimental study on the effect of ANV and several unclassified enterovirus-like viruses (ELVs) in commercial chicks demonstrated that only one ELV analyzed among the broad panel produced clinical signs in inoculated chicks (McNulty et al., 1990).”

“Serological evidence of CAstV has been demonstrated in broiler flocks in the UK, the Netherlands, Spain, Australia, and the USA (Baxendale and Mebatsion, 2004) and more recently in broiler parent flocks in the UK that spread to European breeder flocks (Todd et al., 2009b), which suggests a worldwide distribution.”

“At least two serotypes have been reported to date (Frazier et al., 1990; Imada et al., 1980; Pantin-Jackwood et al., 2011; Shirai et al., 1991).”

“Mamastroviruses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1535 5.1.1.”

“In turkeys, antibody response against TAstV-2 is not sufficiently elicited (Koci et al., 2004) and does not seem to play a crucial role in the evolution of TAstVs-2 sublineages, which in fact do not cluster neither geographically nor historically following immunological pressure (Pantin-Jackwood et…”

“A similar prevalence was found in France where 20.9% (66/316) of the puppies in 42% (14/33) of the breeding kennels surveyed were CaAstV positive by RT-PCR (Grellet et al., submitted).”

“It requires a highly conserved heptameric sequence (A6C) and a downstream hairpin structure (Lewis and Matsui, 1995, 1996, 1997; Marczinke et al., 1994) (see Fig.”

“One peptide, nsp1a/41a, co-localizes with the viral RNA at the ER membrane (Guix et al., 2004); mutations in nsp1a/4 correlate with increased viral titers in vitro and in vivo (Guix et al., 2005) suggesting a role for this protein in viral replication.”

“Passive and active surveys indicate that ANV is widely distributed worldwide and that serological evidence can be found in turkeys as well (Connor et al., 1987; Decaesstecker et al., 1989; Hewson et al., 2010; Imada et al., 1980; McNulty et al., 1989; Nicholas et al., 1988; Takase et al., 1989;…”

“This was supported by inhibition of viral entry with endocytic inhibitors (Donelli et al., 1992).”

“The second reading frame, ORF1b, which encodes the viral RNAdependent RNA polymerase (RdRp) (Matsui and Greenberg, 1996), overlaps ORF1a by 70 nucleotides and is translated by a frame-shift into the 1 frame and is a common mechanism, though not unique, among plus-stranded animal RNA viruses (Lewis and Matsui, 1996).”

“However, infection in dogs was only recently confirmed by genetic characterization (Toffan et al., 2009; Zhu et al., 2011) and a canine astrovirus has also been recently isolated in cell culture (Martella et al., 2011) (Table 2).”

“Serotypes assigned to the species are given consecutive numbers (Lee and Kurtz, 1982; Mendez and Arias, 2007).”

“TAstV-1 was firstly detected in diseased turkey flocks in the '80s (Reynolds and Saif, 1986; Reynolds et al., 1987; Saif et al., 1985 Saif et al., , 1990 .”

“HAstV-6 and 7 are rarely detected (De Grazia et al., 2011; Gabbay et al., 2007; Guix et al., 2002; Liu et al., 2008; Mendez-Toss et al., 2004; Mustafa et al., 2000; Palombo and Bishop, 1996).”

“ANV typically causes histological changes in the kidneys although the viral antigen can be detected in other organs, namely liver, spleen, pancreas, jejunum and rectum (Imada et al., 1979, 1983; Shimizu et al., 1990; Shirai et al., 1989, 1992).”

“At least two serotypes have been reported to date (Frazier et al., 1990; Imada et al., 1980; Pantin-Jackwood et al., 2011; Shirai et al., 1991).”

“The transmembrane domains may localize nsp1a/2 to the endoplasmic reticulum (ER) membrane to facilitate replication (Guix et al., 2004) similar to other positivestrand RNA viruses (Ahlquist, 2006; Geigenmuller et al., 2002; Guix et al., 2004 Guix et al., , 2005 Kiang and Matsui, 2002; Speroni et al., 2009) .”

“Similarly, infection of 1-day-old chicks with three different ELVs and an ANV showed that ELVs are able to induce more severe lesions in the intestine, the kidneys and the pancreas than ANV (Smyth et al., 2007).”

“Astrovirus-like virions were first observed in feces of chickens by EM in the 1990s (McNeilly et al., 1994; McNulty et al., 1990), but until recently little was known about their genetic and antigenic characteristics.”

“, 1979) and experimental infections revealed that it mainly results in a sub-clinical disease, although mild growth depression and mortality have been reported for infections with ANV-1 (the strain G4260) (Imada et al., 1979; Maeda et al., 1979; Yamaguchi et al., 1979).”

“…surveys indicate that ANV is widely distributed worldwide and that serological evidence can be found in turkeys as well (Connor et al., 1987; Decaesstecker et al., 1989; Hewson et al., 2010; Imada et al., 1980; McNulty et al., 1989; Nicholas et al., 1988; Takase et al., 1989; Zhao et al., 2011).”

“This peptide was recently shown to contain a hypervariable region that can be phosphorylated, form oligomers and interact with the viral polymerase supporting its importance to productive viral replication (Fuentes et al., 2011).”

“(2010) have identified a unique astrovirus associated with SMS (Table 2), a neurological disorder of unknown etiology (Blomstrom et al., 2010; Gavier-Widen et al., 2004).”

“Genetic and antigenic characterization of two turkey isolates related to TAstV-2 (TAstV1987-TAstVT2001 also identified as TAstV-3) suggests that they could be virtually classified as two different serotypes (Pantin-Jackwood et al., 2011; Tang and Saif, 2004; Tang et al., 2005) , similarly to strain MN/01 (Strain et al…”

“…active surveys indicate that ANV is widely distributed worldwide and that serological evidence can be found in turkeys as well (Connor et al., 1987; Decaesstecker et al., 1989; Hewson et al., 2010; Imada et al., 1980; McNulty et al., 1989; Nicholas et al., 1988; Takase et al., 1989; Zhao et al.,…”

“In fact, in some instances the typical star-like appearance is not easily recognizable in EM preparations and astroviruses could be misidentified as enteroviruses or provisionally named astrovirus-like particles or small round viruses (SRVs) (Guy et al., 2004; Koci and Schultz-Cherry, 2002).”

“Young chicks are the most susceptible and become resistant to disease after the first month of life (Imada et al., 1981).”

“The exact role of TAstV-2 as the etiological agent of poult enteritis complex and PEMS is difficult to estimate since it can be easily detected in apparently healthy adult turkeys (Jindal et al., 2010b, 2011).”

“05 distance by phylogenetic analysis at the 30 end of ORF2 (Jakab et al., 2003; Walter et al., 2001).”

“Clinical disease in chicks varies from subclinical to outbreaks of runting stunting syndrome (RSS) and chick nephropathy (Frazier et al., 1990; Imada et al., 1980; Shimizu et al., 1990; Shirai et al., 1992; Takase et al., 1989 Takase et al., , 1994 Yamaguchi et al., 1979) .”

“Serological assays confirmed by molecular characterization, suggested the existence of a putative novel serotype of turkey astrovirus, TAstV-3 (Tang and Saif, 2004; Tang et al., 2005); similarly the application of cross-virus neutralization assays indicated the presence of more undefined serotypes…”

“ANV typically causes histological changes in the kidneys although the viral antigen can be detected in other organs, namely liver, spleen, pancreas, jejunum and rectum (Imada et al., 1979, 1983; Shimizu et al., 1990; Shirai et al., 1989, 1992).”

“The existence of different sublineages of TAstV-2 in turkey farms has been confirmed by field studies (Domanska-Blicharz et al., 2011; Jindal et al., 2010a,b, 2011; Pantin-Jackwood et al., 2006a).”

“…surveys indicate that ANV is widely distributed worldwide and that serological evidence can be found in turkeys as well (Connor et al., 1987; Decaesstecker et al., 1989; Hewson et al., 2010; Imada et al., 1980; McNulty et al., 1989; Nicholas et al., 1988; Takase et al., 1989; Zhao et al., 2011).”

“It requires a highly conserved heptameric sequence (A6C) and a downstream hairpin structure (Lewis and Matsui, 1995, 1996, 1997; Marczinke et al., 1994) (see Fig.”

“Mink astrovirus (MiAstV). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .”

“Astrovirus polymerase is a supergroup 1 RdRp (Lewis et al., 1994), a group which utilizes a viral-encoded primer attached to the genome (VPg) to initiate transcription (Jang et al., 2010).”

“…examined (Belliot et al., 1997a,b; Chu et al., 2010; De Grazia et al., 2011; Finkbeiner et al., 2009a–c; Gabbay et al., 2007; Kapoor et al., 2009; Liu et al., 2008), PoAstVs (Luo et al., 2011), BoAstVs (Tse et al., 2011), BatAstVs (Chu et al., 2008; Drexler et al., 2011; Zhu et al., 2009),…”

“Serological evidence of CAstV has been demonstrated in broiler flocks in the UK, the Netherlands, Spain, Australia, and the USA (Baxendale and Mebatsion, 2004) and more recently in broiler parent flocks in the UK that spread to European breeder flocks (Todd et al., 2009b), which suggests a worldwide distribution.”

“Astrovirus-like particles were first detected in pigs in the 1980s by EM (Bridger, 1980; Shirai et al., 1985).”

“Clinical disease in chicks varies from subclinical to outbreaks of runting stunting syndrome (RSS) and chick nephropathy (Frazier et al., 1990; Imada et al., 1980; Shimizu et al., 1990; Shirai et al., 1992; Takase et al., 1989 Takase et al., , 1994 Yamaguchi et al., 1979) .”

“In addition to the intrinsic variability caused by the error-prone RdRp (176), the occurrence of recombination events between nonstructural and structural coding regions, sometimes from viruses infecting different host species, adds more diversity and complexity to the AstV molecular typing (18, 146, 163, 175, 181).”

“Astroviruses can cause diarrhoeal and occasionally extra-intestinal disease in various species (De Benedictis et al., 2011).”

“Astrovirus demonstrate a high genetic diversity leading to the potential infection of a large spectrum of mammals and birds [22].”