The DOI matches its Crossref record; 175 of the 178 references it cites were found in a registry or an index.
Astrovirus Infections in Humans and Animals—Molecular Biology, Genetic Diversity, and Interspecies Transmissions
Open accessAbstract
Astroviruses are small, non-enveloped, positive sense, single-stranded RNA viruses first identified in 1975 in children suffering from diarrhea and then described in a wide variety of animals. To date, the list of animal species susceptible to astrovirus infection has expanded to 22 animal species or families, including domestic, synantropic and wild animals, avian, and mammalian species in the terrestrial and aquatic environments. Astrovirus infections are considered among the most common cause of gastroenteritis in children, second only to rotavirus infections, but in animals their association with enteric diseases is not well documented, with the exception of turkey and mink astrovirus infection. Genetic variability has been described in almost all astrovirus species sufficiently examined infecting mammals and birds; however, antigenic variability has been demonstrated for human astroviruses but is far less investigated in animal viruses. Interestingly, there is an increasing evidence of recombination events occurring in astroviruses, which contributes to increase the genetic variability of this group of viruses. A wide variety of species infected, the evident virus genetic diversity and the occurrence of recombination events indicate or imply either cross-species transmission and subsequent virus adaptation to new hosts or the co-infection of the same host with different astroviruses. This can also favor the emergence of novel astroviruses infecting animals or with a zoonotic potential. After more than 30 years from their first description in humans, there are many exciting streams of research to be explored and intriguing questions that remain to be answered about the relatively under-studied Astroviridae family. In the present work, we will review the existing knowledge concerning astrovirus infections in humans and animals, with particular focus on the molecular biology, interspecies transmission and zoonotic potential of this group of viruses.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Astroviruses have a broad host range (Donato and Vijaykrishna 2017) and are frequently detected in the faeces of mammals, birds, and humans with gastroenteritis (Finkbeiner et al. 2009; De Benedictis et al. 2011).”
From Red fox viromes in urban and rural landscapes (2020) · cites this paper as De Benedictis et al. 2011
Experimental — accuracy not yet measured
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
The alphaviruses: gene expression, replication, and evolution.
Strauss, J. H., & Strauss, E. G. (1994) · Microbiological Reviews · doi:10.1128/mmbr.58.3.491-562.1994 · Cited by 2,221
Virus Taxonomy: VIIIth Report of the International Committee on Taxonomy of Viruses.
Fauquet, C., Mayo, M. A., Maniloff, J., Desselberger, U., & Ball, L. A. (2005) · Cited by 798
28 nm PARTICLES IN FÆCES IN INFANTILE GASTROENTERITIS
Madeley, C. R., & Cosgrove, B. (1975) · The Lancet · doi:10.1016/s0140-6736(75)90858-2 · Cited by 385 · cited 1×
“Astroviruses are small, non-enveloped RNA viruses first identified in 1975 by electron microscopy (EM) in children suffering from diarrhea (Appleton and Higgins, 1975; Madeley and Cosgrove, 1975b; Matsui and Greenberg, 1996).”
BackgroundTyping of human astroviruses from clinical isolates by enzyme immunoassay and nucleotide sequencing
Noel, J. S., Lee, T. W., Kurtz, J. B., Glass, R. I., & Monroe, S. S. (1995) · Journal of Clinical Microbiology · doi:10.1128/jcm.33.4.797-801.1995 · Cited by 379 · cited 1×
“In several cases these genotypes were detected and initially differentiated using a set of conserved primers to the ORF1b termed Mon269 (50 CAACTCAGGAAACAGGGTGT) and Mon270 (50 TCAGATGCATTGTCATTGGT) (Noel et al., 1995).”
BackgroundMetagenomic Analysis of Human Diarrhea: Viral Detection and Discovery
Finkbeiner, S. R., Allred, A. F., Tarr, P. I., Klein, E. J., Kirkwood, C. D., & Wang, D. (2008) · PLoS Pathogens · doi:10.1371/journal.ppat.1000011 · Cited by 361 · cited 3×
“They termed the virus MLB1 (AstV-MLB1) and went onto characterize the genome, demonstrating that AstV-MLB1 was highly divergent from any of the known astroviruses (Finkbeiner et al., 2008b).”
BackgroundMethodAstrovirus Encephalitis in Boy with X-linked Agammaglobulinemia
Quan, P.-L., Wagner, T. A., Briese, T., Torgerson, T., Hornig, M., Tashmukhamedova, A., Firth, C., Palacios, G., Baisre-De-Leon, A., Paddock, C., et al. (2010) · Emerging Infectious Diseases · doi:10.3201/eid1606.091536 · Cited by 332 · cited 10×
“HastV-PS is also genetically related to AstV-VA1 (Finkbeiner et al., 2009b) and to a lesser extent to MiAstVs and OAstVs, thus falling within the proposed genocluster GII of Mamastroviruses (Bosch et al., 2010b; Quan et al., 2010) .”
BackgroundInfluentialVIRUSES AND GASTROENTERITIS IN INFANTS
Appleton, H., & Higgins, P. G. (1975) · The Lancet · doi:10.1016/s0140-6736(75)92581-7 · Cited by 307 · cited 1×
“Astroviruses are small, non-enveloped RNA viruses first identified in 1975 by electron microscopy (EM) in children suffering from diarrhea (Appleton and Higgins, 1975; Madeley and Cosgrove, 1975b; Matsui and Greenberg, 1996).”
BackgroundNovel Astroviruses in Insectivorous Bats
Chu, D. K. W., Poon, L. L. M., Guan, Y., & Peiris, M. J. S. (2008) · Journal of Virology · doi:10.1128/jvi.00857-08 · Cited by 292 · cited 15×
“Astroviruses do not easily grow in laboratory host systems and for this reason serological classification is difficult and is generally speculated based on percentage of nucleotide and amino acid similarity of the ORF2 encoding for the capsid protein (Chu et al., 2008; Koci et al., 2000; Reuter et al., 2011).”
BackgroundMethodResultInfluentialAhlquist, P. (2006) · Nature Reviews Microbiology · doi:10.1038/nrmicro1389 · Cited by 285 · cited 2×
“The transmembrane domains may localize nsp1a/2 to the endoplasmic reticulum (ER) membrane to facilitate replication (Guix et al., 2004) similar to other positivestrand RNA viruses (Ahlquist, 2006; Geigenmuller et al., 2002; Guix et al., 2004, 2005; Kiang and Matsui, 2002; Speroni et al., 2009).”
BackgroundIsolation of Small Viruses Resembling Astroviruses and Caliciviruses from Acute Enteritis Of Calves
Woode, G. N., & Bridger, J. C. (1978) · Journal of Medical Microbiology · doi:10.1099/00222615-11-4-441 · Cited by 262 · cited 3×
“The first isolate of bovine astrovirus was reported in England in 1978 (Woode and Bridger, 1978).”
Background
Flagged first, then by citations
3 of the 178 references couldn’t be matched to a known paper.
Research works printed but not linked: 2
- Henriksen, 1987, En oversigt over syndromet “Fedtede hvalpe” hos mink (A review of “sticky kit” syndrome in mink), Dansk. VetTidskr, 70, 580
- Svennekjaer, 1954, Minksyngdomme og aktuelle problemer i minkavlen (Mink diseases and current problems in mink farming), Dansk. Pelsdyravl., 12, 384
Cited by
Sorted by citations
Hellmér, M., Paxéus, N., Magnius, L., Enache, L., Arnholm, B., Johansson, A., Bergström, T., & Norder, H. (2014) · Applied and Environmental Microbiology · doi:10.1128/aem.01981-14 · Cited by 442
Bosch, A., Pintó, R., & Guix, S. (2014) · Clinical Microbiology Reviews · doi:10.1128/cmr.00013-14 · Cited by 311
“In addition to the intrinsic variability caused by the error-prone RdRp (176), the occurrence of recombination events between nonstructural and structural coding regions, sometimes from viruses infecting different host species, adds more diversity and complexity to the AstV molecular typing (18, 146, 163, 175, 181).”
BackgroundInfluentialAstrovirus Biology and Pathogenesis.
Cortez, V., Meliopoulos, V. A., Karlsson, E., Hargest, V., Johnson, C. N., & Schultz-Cherry, S. (2017) · Annual Review of Virology · doi:10.1146/annurev-virology-101416-041742 · Cited by 194
Self-citationFaecal virome of cats in an animal shelter
Zhang, W., Li, L., Deng, X., Kapusinszky, B., Pesavento, P. A., & Delwart, E. (2014) · Journal of General Virology · doi:10.1099/vir.0.069674-0 · Cited by 215
“Astroviruses can cause diarrhoeal and occasionally extra-intestinal disease in various species (De Benedictis et al., 2011).”
BackgroundEpidemiology of Classic and Novel Human Astrovirus: Gastroenteritis and Beyond
Vu, D., Bosch, A., Pintó, R., & Guix, S. (2017) · Viruses · doi:10.3390/v9020033 · Cited by 184
“Astrovirus demonstrate a high genetic diversity leading to the potential infection of a large spectrum of mammals and birds [22].”
BackgroundThe Broad Host Range and Genetic Diversity of Mammalian and Avian Astroviruses
Donato, C., & Vijaykrishna, D. (2017) · Viruses · doi:10.3390/v9050102 · Cited by 196
“without causing disease [12] (Figures 1 and 2).”
BackgroundMethodInfluentialPathogens transmitted in animal feces in low- and middle-income countries
Delahoy, M. J., Wodnik, B. K., McAliley, L., Penakalapati, G., Swarthout, J. M., Freeman, M. C., & Lévy, K. (2018) · International Journal of Hygiene and Environmental Health · doi:10.1016/j.ijheh.2018.03.005 · Cited by 192
Viral indicators for tracking domestic wastewater contamination in the aquatic environment
Farkas, K., Walker, D. I., Adriaenssens, E., McDonald, J. E., Hillary, L. S., Malham, S., & Jones, D. L. (2020) · Water Research · doi:10.1016/j.watres.2020.115926 · Cited by 158
Divergent Astrovirus Associated with Neurologic Disease in Cattle
Li, L.-L., Diab, S., McGraw, S., Barr, B., Traslavina, R., Higgins, R., Talbot, T., Blanchard, P., Rimoldi, G., Fahsbender, E., et al. (2013) · Emerging Infectious Diseases · doi:10.3201/eid1909.130682 · Cited by 166
“Since the first description of human astrovirus (HAstV) in children with diarrhea in 1975 (1), a wide variety of astroviruses have been reported in multiple animals including humans, cattle, pigs, sheep, minks, dogs, cats, mice, sea lions, whales, chickens, and turkeys (2).”
BackgroundAstrovirus evolution and emergence
Wohlgemuth, N., Honce, R., & Schultz-Cherry, S. (2019) · Infection, Genetics and Evolution · doi:10.1016/j.meegid.2019.01.009 · Cited by 119
“Among the species permissive to astrovirus infection, are humans, domestic animals like dogs, cats, pigs, chickens, and cows and wild animals like deer, mice, rats, cheetahs, sea lions, dolphins, bats and pikas (De Benedictis et al., 2011) .”
BackgroundInfluentialSelf-citationFrémond, M., Pérot, P., Muth, E., Cros, G., Dumarest, M., Mahlaoui, N., Seilhean, D., Desguerre, I., Hébert, C., Corre-Catelin, N., et al. (2015) · Journal of the Pediatric Infectious Diseases Society · doi:10.1093/jpids/piv040 · Cited by 129
“One of the genuses, Mamastrovirus, comprises viruses infecting mammals including a clade corresponding to human astroviruses 1–8 (HAstVs 1–8) (Figure 2B) [8].”
BackgroundIsolation and characterization of an astrovirus causing fatal visceral gout in domestic goslings
Zhang, Q., Cao, Y., Wang, J., Fu, G., Sun, M., Zhang, L., Li, M. Y., Cui, G., Huang, Y., Hu, X., et al. (2018) · Emerging Microbes & Infections · doi:10.1038/s41426-018-0074-5 · Cited by 127
Neurotropic Astrovirus in Cattle with Nonsuppurative Encephalitis in Europe
Bouzalas, I., Wüthrich, D., Walland, J., Drögemüller, C., Zurbriggen, A., Vandevelde, M., Oevermann, A., Bruggmann, R., & Seuberlich, T. (2014) · Journal of Clinical Microbiology · doi:10.1128/jcm.01195-14 · Cited by 110
Xiao, C.-T., Gimenez-Lirola, L., Gerber, P., Jiang, Y.-H., Halbur, P., & Opriessnig, T. (2013) · Journal of General Virology · doi:10.1099/vir.0.048744-0 · Cited by 119
“…1a, whilst the entire ORF1 encodes both a protease and an RNAdependent RNA polymerase, with a ribosomal frame shift at the ORF1a/1b junction (De Benedictis et al., 2011; Jiang The GenBank/EMBL/DDBJ accession numbers for the complete genomes of the PAstVs obtained in this study are JX556690…”
BackgroundInfluentialBodewes, R., van der Giessen, J., Haagmans, B. L., Osterhaus, A. D. M. E., & Smits, S. L. (2013) · Journal of Virology · doi:10.1128/jvi.00568-13 · Cited by 117
“Three major ORFs were identified (ORF1a, ORF1b, and ORF2) with a similar genome organization to other astroviruses, including a ribosomal frameshift sequence (37, 42) (Fig.”
BackgroundUlloa, J. C., & Gutiérrez, M. F. (2010) · Canadian Journal of Microbiology · doi:10.1139/w10-042 · Cited by 102
Theuns, S., Vanmechelen, B., Bernaert, Q., Deboutte, W., Vandenhole, M., Beller, L., Matthijnssens, J., Maes, P., & Nauwynck, H. (2018) · Scientific Reports · doi:10.1038/s41598-018-28180-9 · Cited by 101
A novel astrovirus associated with encephalitis and ganglionitis in domestic sheep
Pfaff, F., Schlottau, K., Scholes, S., Courtenay, A., Hoffmann, B., Höper, D., & Beer, M. (2017) · Transboundary and Emerging Diseases · doi:10.1111/tbed.12623 · Cited by 87
Novel human astroviruses: Novel human diseases?
Vu, D., Cordey, S., Brito, F., & Kaiser, L. (2016) · Journal of Clinical Virology · doi:10.1016/j.jcv.2016.07.004 · Cited by 95
Global public health implications of human exposure to viral contaminated water
Lanrewaju, A. A., Enitan, A. M., Sabiu, S., Edokpayi, J. N., & Swalaha, F. M. (2022) · Frontiers in Microbiology · doi:10.3389/fmicb.2022.981896 · Cited by 100
Prevalence of classic, MLB-clade and VA-clade Astroviruses in Kenya and The Gambia
Meyer, C. T., Bauer, I. K., Antonio, M., Adeyemi, M., Saha, D., Oundo, J., Ochieng, J. B., Omore, R., Stine, O., Wang, D., et al. (2015) · Virology Journal · doi:10.1186/s12985-015-0299-z · Cited by 93
“Zoonotic infection has been postulated to occur in astroviruses due to the frequent occurrence of recombination events and wide range of species infected [43] and is another possibility.”
Karlsson, E., Small, C. T., Freiden, P., Feeroz, M., Matsen, F., San, S., Hasan, M., Wang, D., Jones-Engel, L., & Schultz-Cherry, S. (2015) · PLoS Pathogens · doi:10.1371/journal.ppat.1005225 · Cited by 80
“In contrast to bat AstVs, NHP AstVs are distributed throughout the Astroviridae family Based on the high prevalence rate and genetic diversity of AstV detected in bats compared to other species, bats have been proposed as a pimary natural reservoir for AstVs and possibly as host of the most recent conmon ancestor of t…”
BackgroundInfluentialSelf-citationAn emerging novel goose astrovirus associated with gosling gout disease, China
Zhang, X., Ren, D., Li, T., Zhou, H., Liu, X., Wang, X., Lü, H., Gao, W., Wang, Y., Zou, X., et al. (2018) · Emerging Microbes & Infections · doi:10.1038/s41426-018-0153-7 · Cited by 88
“MAstVs mainly infect mammals including human, ovine, bovine, porcine, feline, canine, mink, bat, deer, mouse, sea lion, dolphin etc., whereas AAstVs generally infect aviansuch as turkey, chicken, duck, pigeon, and goose 1, 2 .”
BackgroundDevaney, R., Trudgett, J., Trudgett, A., Meharg, C., & Smyth, V. J. (2016) · Avian Pathology · doi:10.1080/03079457.2016.1193123 · Cited by 86
“…signs such as diarrhoea, enteritis, interstitial nephritis and has been linked with visceral gout and RSS (Yamaguchi et al., 1979; McNulty et al., 1984; Herrmann et al., 1991; Greenberg & Matsui, 1992; Moser & Schultz-Cherry, 2005; Spackman et al., 2010; Benedictis et al., 2011; Lee et al., 2013).”
BackgroundNagai, M., Omatsu, T., Aoki, H., OTOMARU, K., Uto, T., Koizumi, M., Minami-Fukuda, F., TAKAI, H., MURAKAMI, T., Masuda, T., et al. (2015) · Archives of Virology · doi:10.1007/s00705-015-2543-7 · Cited by 85
Porcine Astrovirus Type 3 in Central Nervous System of Swine with Polioencephalomyelitis
Arruda, B. L., Arruda, P., Hensch, M., Chen, Q., Zheng, Y., Yang, C., Gatto, I. R. H., Ferreyra, F. M., Gauger, P. C., Schwartz, K., et al. (2017) · Emerging infectious diseases · doi:10.3201/eid2312.170703 · Cited by 84
“A have been identified in a variety of mammals and birds; infection is often asymptomatic (1).”
Epidemiology of gastroenteritis viruses in Japan: Prevalence, seasonality, and outbreak
Thongprachum, A., Khamrin, P., Maneekarn, N., Hayakawa, S., & Ushijima, H. (2015) · Journal of Medical Virology · doi:10.1002/jmv.24387 · Cited by 81
“The human astroviruses have been extensively investigated, identified, and are now considered to be one of the most common viral agents that cause gastroenteritis in young children worldwide [De Benedictis et al., 2011; Bosch et al., 2014].”
BackgroundDetection of a Novel Bovine Astrovirus in a Cow with Encephalitis
Schlottau, K., Schulze, C., Bilk, S., Hanke, D., Höper, D. W., Beer, M., & Hoffmann, B. (2016) · Transboundary and Emerging Diseases · doi:10.1111/tbed.12493 · Cited by 80
Adaptive Immunity Restricts Replication of Novel Murine Astroviruses
Yokoyama, C. C., Loh, J., Zhao, G.-Y., Stappenbeck, T., Wang, D., Huang, H. V., Virgin, H., & Thackray, L. B. (2012) · Journal of Virology · doi:10.1128/jvi.02018-12 · Cited by 80
“Astroviruses are nonenveloped, positive-sense, polyadenylated RNA viruses often associated with gastrointestinal (GI) disease (11, 44).”
BackgroundInfluentialEcological Drivers of Virus Evolution: Astrovirus as a Case Study
Mendenhall, I. H., Smith, G. J. D., & Vijaykrishna, D. (2015) · Journal of Virology · doi:10.1128/jvi.02971-14 · Cited by 77
“Astroviruses have been identified in numerous livestock species, including chickens, turkeys, guinea fowl, ducks, rabbits, sheep, pigs, and cows, and in commercial production of mice, minks, and dogs (3), which are often globally distributed (6).”
BackgroundInfluentialDufková, L., Ščigalková, I., Moutelíková, R., Malenovská, H., & Prodělalová, J. (2012) · Archives of Virology · doi:10.1007/s00705-012-1528-z · Cited by 77
“Using RT-PCR methods, porcine SaVs and AstVs have been detected in fecal samples from diarrheic or asymptomatic pigs, either alone or in combination with other enteric pathogens [6, 25].”
MethodA Novel Group of Avian Astroviruses in Wild Aquatic Birds
Chu, D. K. W., Leung, C. Y. H., Perera, H. K. K., Ng, E. M., Gilbert, M., Joyner, P. H., Grioni, A., Ades, G., Guan, Y., Peiris, M. J. S., et al. (2012) · Journal of Virology · doi:10.1128/jvi.02105-12 · Cited by 72
“The disease severity ranges from subclinical infection in apparently healthy adult birds (8, 14, 15) to heavy losses of ducklings in farms (11).”
BackgroundIntra- and Cross-Species Transmission of Astroviruses
Roach, S. N., & Langlois, R. (2021) · Viruses · doi:10.3390/v13061127 · Cited by 64
“Among those species susceptible to AstV infection are humans, domestic animals such as pigs and turkeys, and wild animals including multiple rodent and bat species [4].”
BackgroundZhao, M., Yue, C., Yang, Z., Li, Y.-L., Zhang, D., Ju, Z., Yang, S., Shen, Q., Su, X., Qi, D., et al. (2022) · The Science of The Total Environment · doi:10.1016/j.scitotenv.2022.153317 · Cited by 71
Prévost, B., Lucas, F. S., Ambert‐Balay, K., Pothier, P., Moulin, L., & Wurtzer, S. (2015) · Applied and Environmental Microbiology · doi:10.1128/aem.02076-15 · Cited by 65
Fischer, K., Zeus, V. M., Kwasnitschka, L., Kerth, G., Haase, M., Groschup, M. H., & Balkema‐Buschmann, A. (2015) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2015.11.010 · Cited by 62
“It therefore cannot be completely ruled out that the AstV nomenclature is in some cases misleading, since the newly identified virus sequences are often simply nominated according to the species of first detection of virus related nucleic acid (Monroe et al., 2005; De Benedictis et al., 2011) .”
BackgroundPérot, P., Lecuit, M., & Eloit, M. (2017) · Viruses · doi:10.3390/v9010010 · Cited by 43
“, chicken diarrhea, duck hepatitis, turkey enteritis, and avian nephritis), and diagnosis can be made in severely affected flocks by reverse transcription polymerase chain reaction (RT-PCR), using necropsy samples in specialized laboratories [15].”
BackgroundMethodPadmanabhan, A., & Hause, B. M. (2016) · Archives of Virology · doi:10.1007/s00705-016-2937-1 · Cited by 62
“ORF2 is present at the 3’end and encodes the capsid protein [1, 2, 4].”
BackgroundInfluentialFirst report of a novel goose astrovirus outbreak in Cherry Valley ducklings in China
Chen, H., Zhang, B., Yan, M., Diao, Y., & Tang, Y. (2019) · Transboundary and Emerging Diseases · doi:10.1111/tbed.13418 · Cited by 62
A hidden gene in astroviruses encodes a viroporin
Lulla, V., & Firth, A. E. (2020) · Nature Communications · doi:10.1038/s41467-020-17906-x · Cited by 64
Monini, M., Bartolo, I. D., Ianiro, G., Angeloni, G., Magistrali, C. F., Ostanello, F., & Ruggeri, F. M. (2015) · Archives of Virology · doi:10.1007/s00705-015-2538-4 · Cited by 60
“Porcine AstV (PoAstV) was originally described in pigs with diarrhea [6], but it is also shed by healthy pigs [7] and has a broad geographical distribution [8].”
BackgroundAstrovirus infections induce age-dependent dysbiosis in gut microbiomes of bats
Wasimuddin, Brändel, S. D., Tschapka, M., Page, R. A., Rasche, A., Corman, V. M., Drosten, C., & Sommer, S. (2018) · The ISME Journal · doi:10.1038/s41396-018-0239-1 · Cited by 60
Goose Astrovirus in China: A Comprehensive Review
Zhu, Q., & Sun, D. (2022) · Viruses · doi:10.3390/v14081759 · Cited by 58
Machnowska, P., Ellerbroek, L., & Johne, R. (2013) · Veterinary Microbiology · doi:10.1016/j.vetmic.2013.10.018 · Cited by 60
“They are known to cause gastroenteritis in humans, specially in children, and diarrhoea predominantly in oung animals (De Benedictis et al., 2011).”
BackgroundDetection of Antibodies against Turkey Astrovirus in Humans
Meliopoulos, V., Kayali, G., Burnham, A. J., Oshansky, C. M., Thomas, P. G., Gray, G. C., Beck, M. A., & Schultz‐Cherry, S. (2014) · PLoS ONE · doi:10.1371/journal.pone.0096934 · Cited by 58
“Although astrovirus infections are thought to be species specific [7], the wide variety of species infected, the genetic diversity of the family, and the occurrence of recombination suggests that cross-species transmission of astroviruses could occur.”
BackgroundSelf-citationRecent Progress in the Characterization of Avian Enteric Viruses
Day, J. M., & Zsak, L. (2013) · Avian Diseases · doi:10.1637/10390-092712-review.1 · Cited by 58
“The avian astroviruses are very commonly found in the poultry gut—often in combination with other enteric viruses—and have some association with the recognized enteric disease syndromes (11,28,45,76,78,87,88).”
BackgroundIsolation and characterization of a duck-origin goose astrovirus in China
Wei, F., Yang, J., Wang, Y., Chen, H., Diao, Y., & Tang, Y. (2020) · Emerging Microbes & Infections · doi:10.1080/22221751.2020.1765704 · Cited by 57
Molecular detection of enteric viruses from diarrheic calves in Egypt
Mohamed, F. F., Mansour, S. M. G., El-Araby, I. E., Mor, S. K., & Goyal, S. M. (2016) · Archives of Virology · doi:10.1007/s00705-016-3088-0 · Cited by 57
“The family Astroviridae consists of two genera, Mamastrovirus and Avastrovirus, whose members infect mammals and birds, respectively [13].”
BackgroundKerr, P. J., & Donnelly, T. M. (2013) · Veterinary Clinics of North America Exotic Animal Practice · doi:10.1016/j.cvex.2013.02.002 · Cited by 56
“Astrovirus infections are regarded as the second most common cause of viral diarrhea in children after rotavirus infection, but in animals, their association with enteric diseases is not well documented, with the exception of turkey and mink astrovirus infection.(161) The multifactorial enteritis complex of juvenile r…”
BackgroundAstrovirus as a possible cause of congenital tremor type AII in piglets?
Blomström, A., Ley, C., & Jacobson, M. (2014) · Acta Veterinaria Scandinavica · doi:10.1186/s13028-014-0082-y · Cited by 56
Šalamúnová, S., Jacková, A., Mandelík, R., Novotný, J., Vlasáková, M., & Vilcek, S. (2018) · BMC Veterinary Research · doi:10.1186/s12917-018-1640-8 · Cited by 45
Li, J.-Y., Hu, W.-Q., Liu, T., Zhang, H., Opriessnig, T., & Xiao, C. (2020) · Poultry Science · doi:10.1016/j.psj.2020.11.003 · Cited by 54
Goh, S. G., Saeidi, N., Gu, X., Vergara, G. G. R. V., Liang, L., Fang, H., Kitajima, M., Kushmaro, A., & Gin, K. Y. (2018) · Water Research · doi:10.1016/j.watres.2018.11.058 · Cited by 54
Pathogenic Characteristics of a Porcine Astrovirus Strain Isolated in China
Fang, Q., Wang, C., Liu, H., Wu, Q., Liang, S., Cen, M., Dong, Q., Wei, Y., Chen, Y., Ouyang, K., et al. (2019) · Viruses · doi:10.3390/v11121156 · Cited by 54
“Porcine astrovirus (PAstV) is single-stranded positive sense, non-enveloped RNA virus with a diameter of about 28–30 nm [1].”
BackgroundViral gastroenteritis in children in Colorado 2006–2009
Osborne, C. M., Montano, A., Robinson, C., Schultz-Cherry, S., & Dominguez, S. (2015) · Journal of Medical Virology · doi:10.1002/jmv.24022 · Cited by 47
“The astrovirus protocol used in this study was not designed to detect these novel strains and likely underestimates the true burden of astrovirus disease in these study patients [Phan et al., 2007; De Benedictis et al., 2011] .”
BackgroundMethodInfluentialSelf-citationEmerging and Re-Emerging Foodborne Pathogens
Smith, J. L., & Fratamico, P. M. (2018) · Foodborne Pathogens and Disease · doi:10.1089/fpd.2018.2493 · Cited by 56
Evidence of vertical transmission of novel astrovirus virus in goose
Wei, F., Yang, J., He, D., Diao, Y., & Tang, Y. (2020) · Veterinary Microbiology · doi:10.1016/j.vetmic.2020.108657 · Cited by 53
Pathogenicity of novel goose-origin astrovirus causing gout in goslings
Yin, D., Tian, J., Yang, J., Tang, Y., & Diao, Y. (2021) · BMC Veterinary Research · doi:10.1186/s12917-020-02739-z · Cited by 52
Yuan, X., Meng, K., Zhang, Y., Yu, Z., Ai, W., & Wang, Y. (2018) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2018.10.014 · Cited by 51
Japhet, M. O., Famurewa, O., Adesina, O. A., Opaleye, O., Wang, B., Höhne, M., Bock, C., Marques, A. M., & Niendorf, S. (2019) · Journal of Clinical Virology · doi:10.1016/j.jcv.2018.12.004 · Cited by 48
Characterizing and Evaluating the Zoonotic Potential of Novel Viruses Discovered in Vampire Bats
Bergner, L. M., Mollentze, N., Orton, R. J., Tello, C., Broos, A., Biek, R., & Streicker, D. G. (2021) · Viruses · doi:10.3390/v13020252 · Cited by 50
“Astroviruses (AstVs, family Astroviridae) are positive sense single stranded RNA viruses which cause gastroenteritis in humans, as well as in diverse mammals and birds [100].”
BackgroundPhylogenetic analysis of porcine astrovirus in domestic pigs and wild boars in South Korea
Lee, M., Jeoung, H.-Y., Park, H., Lim, J.-A., Song, J., & An, D.-J. (2012) · Virus Genes · doi:10.1007/s11262-012-0816-8 · Cited by 49
Marvin, S. A., Huerta, C. T., Sharp, B., Freiden, P. J., Cline, T. D., & Schultz‐Cherry, S. (2015) · Journal of Virology · doi:10.1128/jvi.02367-15 · Cited by 49
Self-citationSelimovic-Hamza, S., Boujon, C. L., Hilbe, M., Oevermann, A., & Seuberlich, T. (2017) · Viruses · doi:10.3390/v9010012 · Cited by 49
“as a cause of diarrhea and gastroenteritis in children [3].”
BackgroundBat Astroviruses: Towards Understanding the Transmission Dynamics of a Neglected Virus Family
Fischer, K., dos Reis, V. P., & Balkema-Buschmann, A. (2017) · Viruses · doi:10.3390/v9020034 · Cited by 42
“In a study where fecal samples from pigs and humans from several Colombian regions were collected, the authors assumed that recombination between the porcine and the human astroviruses within the variable region of ORF2 had occurred [59].”
BackgroundInfluentialRed fox viromes in urban and rural landscapes
Campbell, S. J., Ashley, W., Gil-Fernandez, M., Newsome, T. M., Di Giallonardo, F., Ortiz-Baez, A. S., Mahar, J. E., Towerton, A. L., Gillings, M., Holmes, E. C., et al. (2020) · Virus Evolution · doi:10.1093/ve/veaa065 · Cited by 47
Jacobsen, S., Höhne, M., Marques, A. M., Beslmüller, K., Bock, C., & Niendorf, S. (2018) · Journal of Infection · doi:10.1016/j.jinf.2018.02.006 · Cited by 45
“…are classified into 2 genera, Mamastrovirus (MAstV) and Avastrovirus (AAstV), infecting several mammals (e.g. bovine astrovirus, ovine astrovirus, feline astrovirus, mink astrovirus) and birds (e.g. duck astrovirus and turkey astrovirus), respectively (reviewed in De Benedictis et al (2011)7).”
BackgroundCrystal Structure of the Avian Astrovirus Capsid Spike
DuBois, R. M., Freiden, P. J., Marvin, S. A., Reddivari, M., Heath, R. J., White, S. W., & Schultz‐Cherry, S. (2013) · Journal of Virology · doi:10.1128/jvi.03139-12 · Cited by 46
“Infection with human astrovirus serotype 1 (HAstV-1) is most commonly detected, although eight canonical serotypes of HAstV (HAstV-1 to -8) and several noncanonical human genogroups have been isolated with various frequencies (4, 5).”
BackgroundSelf-citationViruses Associated With Foodborne Infections
O’Shea, H., Blacklaws, B., Collins, P. J., McKillen, J., & Fitzgerald, R. M. (2019) · Elsevier eBooks · doi:10.1016/b978-0-12-809633-8.90273-5 · Cited by 46
“While the symptoms are mild, HAstVs do contribute to a large proportion of outbreaks of diarrhea, 0.5%-15% of all cases, and often occur as coinfections with other viruses such as noroviruses and rotavirus (de Benedictis et al., 2011) .”
InfluentialMetagenomic characterisation of additional and novel avian viruses from Australian wild ducks
Vibin, J., Chamings, A., Klaassen, M., & Alexandersen, S. (2020) · Scientific Reports · doi:10.1038/s41598-020-79413-9 · Cited by 49
The Immune Response to Astrovirus Infection
Marvin, S. A. (2016) · Viruses · doi:10.3390/v9010001 · Cited by 45
“Astroviruses (AstV) are small, nonenveloped, RNA viruses that are a major cause of gastroenteritis in infants, immunocompromised people, and the elderly, and they also cause disease in mammals and birds [1] [2] [3] [4] [5] [6] [7] [8] [9] .”
BackgroundKumthip, K., Khamrin, P., Saikruang, W., Kongkaew, A., Vachirachewin, R., Ushijima, H., & Maneekarn, N. (2018) · Archives of Virology · doi:10.1007/s00705-018-3806-x · Cited by 45
“However, the prevalence of PAstV in Thailand reported in this study is more or less the same as those conducted in other countries in Asia such as China (17.5%, 21/120) [8] and South Korea (19.4%, 25/129) [14].”
InfluentialThe Expanding Field of Mammalian Astroviruses: Opportunities and Challenges in Clinical Virology.
Boujon, C. L., Koch, M., & Seuberlich, T. (2017) · Advances in Virus Research · doi:10.1016/bs.aivir.2017.07.002 · Cited by 37
High evolutionary rate of human astrovirus.
Babkin, I., Tikunov, A., Zhirakovskaia, E., Netesov, S., & Tikunova, N. (2012) · Infection, Genetics and Evolution · doi:10.1016/j.meegid.2012.01.019 · Cited by 37
Cortey, M., Díaz, I., Vidal, A., Martin-Valls, G. E., Franzo, G., de Nova, P. J. G., Darwich, L., Puente, H., Carvajal, A., Martı́n, M., et al. (2019) · BMC Veterinary Research · doi:10.1186/s12917-019-2204-2 · Cited by 43
“For instance, no differences in Astrovirus prevalence between diarrheic and non-diarrheic piglets were reported [32, 33] , nor for Enterovirus prevalence between healthy and diarrheic pigs [30] .”
BackgroundPorcine astrovirus viremia and high genetic variability in pigs on large holdings in Croatia.
Brnić, D., Prpić, J., Keros, T., Roić, B., Starešina, V., & Jemeršić, L. (2013) · Infection, Genetics and Evolution · doi:10.1016/j.meegid.2012.12.027 · Cited by 42
New astrovirus in human feces from Burkina Faso
Phan, T., Nordgren, J., Ouermi, D., Simporé, J., Nitiéma, L., Deng, X.-T., & Delwart, E. (2014) · Journal of Clinical Virology · doi:10.1016/j.jcv.2014.03.024 · Cited by 42
Sachsenröder, J., Twardziok, S. O., Scheuch, M., & Johne, R. (2014) · PLoS ONE · doi:10.1371/journal.pone.0088888 · Cited by 42
“Whereas rotaviruses are well-known pathogens of piglets, which may lead to diarrhoea [12, 13, 14] , the clinical importance of the other viruses is a subject of controversy [10, [15] [16] [17] [18] [19] [20] [21] [22] .”
BackgroundOral Administration of Astrovirus Capsid Protein Is Sufficient To Induce Acute Diarrhea In Vivo
Meliopoulos, V., Marvin, S. A., Freiden, P. J., Moser, L. A., Nighot, P. K., Ali, R. A., Blikslager, A. T., Reddivari, M., Heath, R. J., Koci, M. D., et al. (2016) · mBio · doi:10.1128/mbio.01494-16 · Cited by 42
“Astroviruses have been isolated from the young of a variety of species, including humans, and are typically associated with an acute self-limiting diarrhea (5, 6).”
BackgroundSelf-citationBogdanoff, W. A., Campos, J. K., Pérez, E. I., Yin, L., Alexander, D. L., & DuBois, R. M. (2016) · Journal of Virology · doi:10.1128/jvi.01859-16 · Cited by 41
“Members of the Mamastrovirus genus cause infections in humans and a wide range of mammals (3).”
BackgroundCaddy, S., & Goodfellow, I. (2015) · Veterinary Microbiology · doi:10.1016/j.vetmic.2015.03.011 · Cited by 39
“This mirrors the variation previously identified ithin human astrovirus isolates (De Benedictis et al., 11).”
Genetic characterization of a novel astrovirus in Pekin ducks
Liao, Q., Liu, N., Wang, X., Wang, F., & Zhang, D. (2015) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2015.02.025 · Cited by 38
Ito, M., Kuroda, M., Masuda, T., Akagami, M., Haga, K., Tsuchiaka, S., Kishimoto, M., Naoi, Y., Sano, K., Omatsu, T., et al. (2017) · Infection Genetics and Evolution · doi:10.1016/j.meegid.2017.02.008 · Cited by 38
Full-genome based molecular characterization of encephalitis-associated bovine astroviruses.
Bouzalas, I., Wüthrich, D., Selimovic-Hamza, S., Drögemüller, C., Bruggmann, R., & Seuberlich, T. (2016) · Infection, Genetics and Evolution · doi:10.1016/j.meegid.2016.06.052 · Cited by 31
“The viral genomes are poly-adenylated, comprising of short 5′ and 3′ untranslated regions (UTRs) and show three partially overlapping open-reading frames (ORF1a, ORF1b, and ORF2) (De Benedictis et al., 2011).”
BackgroundEpidemiological investigation of infectious diseases in geese on mainland China during 2018–2021
He, D., Wang, F., Zhao, L., Jiang, X., Zhang, S., Wei, F., Wu, B., Wang, Y., Diao, Y., & Tang, Y. (2022) · Transboundary and Emerging Diseases · doi:10.1111/tbed.14699 · Cited by 36
Khamrin, P., Thongprachum, A., Okitsu, S., Hayakawa, S., Maneekarn, N., & Ushijima, H. (2016) · Journal of Medical Virology · doi:10.1002/jmv.24337 · Cited by 37
“…human astrovirus or classic human astrovirus was discovered in 1975, epidemiological studies on the classic human astrovirus have been extensively performed and the virus is considered to be a common viral agent that causes gastroenteritis in young children worldwide [De Benedictis et al., 2011].”
BackgroundBattisti, C. D., Salviato, A., Jonassen, C. M., Toffan, A., Capua, I., & Cattoli, G. (2012) · Archives of Virology · doi:10.1007/s00705-012-1311-1 · Cited by 36
“Consequently, it can be suggested that the nucleotide sequence of the virus can change along with the process of adaptation to the new host [41].”
Self-citationHuman and Animal Viruses in Food (Including Taxonomy of Enteric Viruses)
Greening, G. E., & Cannon, J. L. (2016) · Springer eBooks · doi:10.1007/978-3-319-30723-7_2 · Cited by 36
Mihalov-Kovács, E., Martella, V., Lanave, G., Bodnar, L., Fehér, E., Marton, S., Kemenesi, G., Jakab, F., & Bànyai, K. (2016) · Virus Research · doi:10.1016/j.virusres.2016.12.005 · Cited by 36
“However, taking advantage of broad-range PCR primers for AstVs and metagenomic protocols, several novel AstVs have been identified in a number of mammalian and avian species (Chu et al., 2008; Finkbeiner et al., 2008; Bosch et al., 2010; De Benedictis et al., 2011) .”
BackgroundInfluentialXiao, C., Luo, Z., Lv, S.-L., Opriessnig, T., Li, R., & Yu, X. (2016) · Archives of Virology · doi:10.1007/s00705-016-3185-0 · Cited by 36
Polioencephalomyelitis in Domestic Swine Associated With Porcine Astrovirus Type 3
Ferreyra, F. M., Bradner, L. K., Burrough, E. R., Cooper, V. L., Derscheid, R. J., Gauger, P. C., Harmon, K. M., Madson, D., Piñeyro, P. E., Schwartz, K., et al. (2019) · Veterinary Pathology · doi:10.1177/0300985819875741 · Cited by 35
“* Porcine AstVs (PoAstVs) are distributed worldwide.(15) Five PoAstV lineages (PoAstV1–PoAstV5) have been identified, possibly reflecting different origins, interspecies transmission, and recombination events, some presumably with human strains.”
BackgroundDetection and Characterization of Avastrovirus Associated with Diarrhea Isolated from Minks in China
Sun, N., Yang, Y., Wang, G., Shao, X., Zhang, S., Wang, F.-X., Tan, B., Tian, F., Cheng, S., & Wen, Y. (2014) · Food and Environmental Virology · doi:10.1007/s12560-014-9155-3 · Cited by 35
A novel astrovirus species in the gut of yaks with diarrhoea in the Qinghai–Tibetan Plateau, 2013
Chen, X., Zhang, B., Yue, H., Wang, Y., Fang, Z., Zhang, Q., & Tang, C. (2015) · Journal of General Virology · doi:10.1099/jgv.0.000303 · Cited by 35
“Enteric bovine AstV infections were commonly asymptomatic and investigations on the association with gastroenteritis disease had been inconclusive (Candido et al., 2015; De Benedictis et al., 2011).”
BackgroundA novel astrovirus from dromedaries in the Middle East.
Woo, P. C. Y., Lau, S., Teng, J. L. L., Tsang, A. K. L., Joseph, S., Xie, J., Jose, S., Fan, R. Y. Y., Wernery, U., & Yuen, K. Y. (2015) · Journal of General Virology · doi:10.1099/jgv.0.000233 · Cited by 29
“They arewidely distributed in humans and various animals and are most commonly associated with acute gastroenteritis with major public health interests (Appleton & Higgins, 1975; De Benedictis et al., 2011; Medici et al., 2014; Moser et al., 2007).”
BackgroundHigh prevalence and genetic heterogeneity of porcine astroviruses in domestic pigs
Brnić, D., Jemeršić, L., Keros, T., & Prpić, J. (2014) · The Veterinary Journal · doi:10.1016/j.tvjl.2014.08.015 · Cited by 34
“The detection of these latter two lineages, which may have zoonotic capabilities (De Benedictis et al., 2011), on backyard holdings where pigs live in close * Corresponding author.”
BackgroundInfluentialEnvironmental assessment reveals the presence of MLB‐1 human astrovirus in Uruguay
Lizasoain, A., Tort, L., García, M., Gómez, M. M., Leite, J. P. G., Miagostovich, M., Cristina, J., Colina, R., & Victoria, M. (2015) · Journal of Applied Microbiology · doi:10.1111/jam.12856 · Cited by 27
“The genome possess a 50 and 30 untranslated regions and is organized in three open reading frames (ORF) called ORF1a, ORF1b and ORF2 which codify for the serine protease, RNA-dependent RNA polymerase and capsid protein, respectively (De Benedictis et al. 2011; M endez and Arias 2013).”
BackgroundPativada, M., Nataraju, S. M., Ganesh, B., Rajendran, K., Ramamurthy, T., Ganguly, S., Bhattacharya, M., Ghosh, M., Kobayashi, N., & Krishnan, T. (2012) · Infection, Genetics and Evolution · doi:10.1016/j.meegid.2012.07.018 · Cited by 38
Alcalá, A. C., Pérez, K., Blanco, R., González, R., Ludert, J. E., Liprandi, F., & Vizzi, E. (2018) · Gut Pathogens · doi:10.1186/s13099-018-0232-2 · Cited by 33
Detection of a mammalian-like astrovirus in bird, European roller (Coracias garrulus).
Pankovics, P., Boros, Á., Kiss, T., Delwart, E., & Reuter, G. (2015) · Infection, Genetics and Evolution · doi:10.1016/j.meegid.2015.06.020 · Cited by 30
Alfred, N., Liu, H., Mu Lan, L. I., Hong, S., Hai Bo, T. A. N. G., Zu Zhang, W. E. I., Chen, Y., Fa Kai, L. I., Zhong, Y., & HUANG, W. J. (2015) · Journal of Veterinary Medical Science · doi:10.1292/jvms.14-0252 · Cited by 32
“The current International Committee on Taxonomy of Viruses (ICTV) system divides the Astroviridae family into two genera, Mamastrovirus and Avastrovirus, which infect mammals and birds, respectively [5, 21].”
Background
Metadata
- Authors
- De Benedictis, P., Schultz-Cherry, S., Burnham, A., & Cattoli, G.
- Affiliations
- St. Jude Children's Research Hospital (US)
- Istituto Zooprofilattico Sperimentale delle Venezie (IT)
- Corresponding author
- Cattoli, Giovanni
- Venue
- Infection, Genetics and Evolution
- Publisher
- Elsevier BV
- Published
- 2011-10
- Volume
- 11
- Issue
- 7
- Pages
- 1529-1544
- ISSN
- 1567-1348 (ISSN-L)
- PMC
- PMC7185765
- OpenAlex
- W1980783855
- Cited by
- 479
- References
- 178
- Citations by year
- 2026: 27 · 2025: 35 · 2024: 35 · 2023: 38 · 2022: 33 · 2021: 50 · 2020: 41 · 2019: 32 · 2018: 37 · 2017: 31 · 2016: 33 · 2015: 32 · 2014: 19 · 2013: 19 · 2012: 15
- FWCI
- 2.11
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Locations
- Infection Genetics and Evolution (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Topics
- Health Sciences › Medicine › Infectious Diseases › Viral gastroenteritis research and epidemiology
- Life Sciences › Agricultural and Biological Sciences › Animal Science and Zoology › Animal Virus Infections Studies
- Health Sciences › Medicine › Public Health, Environmental and Occupational Health › Zoonotic diseases and public health
- Keywords
- astrovirus, Astroviridae, human astrovirus, gastroenteritis, genetic diversity, viral recombination, interspecies transmission, zoonotic potential, antigenic variation, molecular biology
- MeSH terms
- Animals, Base Sequence, DNA, Viral, Humans, Phylogeny, Species Specificity, Genetic Variation, Zoonoses, Astroviridae, Astroviridae Infections
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
