The DOI matches its Crossref record; 2 of the 2 references it cites were found in a registry or an index.
SAM pointed domain ETS factor (SPDEF) regulates terminal differentiation and maturation of intestinal goblet cells
Open accessAbstract
Background & Aims: SPDEF (also termed PDEF or PSE), is an ETS family transcription factor that regulates gene expression in the prostate and goblet cell hyperplasia in the lung. Spdef has been reported to be expressed in the intestine. In this paper, we identify an important role for Spdef in regulating intestinal epithelial cell homeostasis and differentiation. Methods: SPDEF expression was inhibited in colon cancer cells to determine its ability to control goblet cell gene activation. The effects of transgenic expression of Spdef on intestinal differentiation and homeostasis were determined. Results: In LS174T colon cancer cells treated with Notch/γ-secretase inhibitor to activate goblet cell gene expression, shRNAs that inhibited SPDEF also repressed expression of goblet cell genes AGR2, MUC2, RETLNB, and SPINK4. Transgenic expression of Spdef caused the expansion of intestinal goblet cells and corresponding reduction in Paneth, enteroendocrine, and absorptive enterocytes. Spdef inhibited proliferation of intestinal crypt cells without induction of apoptosis. Prolonged expression of the Spdef transgene caused a progressive reduction in the number of crypts that expressed Spdef, consistent with its inhibitory effects on cell proliferation. Conclusions: Spdef was sufficient to inhibit proliferation of intestinal progenitors and induce differentiation into goblet cells; SPDEF was required for activation of goblet cell associated genes in vitro. These data support a model in which Spdef promotes terminal differentiation into goblet cells of a common goblet/Paneth progenitor.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
Hollenhorst, P. C., Shah, A. A., Hopkins, C., & Graves, B. J. (2007) · Genes & Development · doi:10.1101/gad.1561707 · Cited by 290
Oettgen, P., Finger, E., Sun, Z., Akbarali, Y., Thamrongsak, U., Boltax, J., Grall, F., Dube, A., Weiss, A., Brown, L., et al. (2000) · Journal of Biological Chemistry · doi:10.1074/jbc.275.2.1216 · Cited by 268 · cited 4×
“Primer sequences were GAPDH, 5′-AATGAAGGGGTCATTGATGG -3′ and 5′-AAGGTGAAGGTCGGAGTCAA ; SPDEF, 5′-GGGGATACGCTGCTCAGAC -3′ and 5′-GCACTGCAGCAGACAGCTC -3′; AGR2, 5′-CGACTCACACAAGGCAGGT -3′ and 5′-TTTTTGGCTCCAGGTTTGAC -3′; SPINK4, 5′-CAGGAAAGCTCCCTTTCTCAA -3′ and 5′-AAGCAGAGCTGGCATTCATT -3′; MUC2, 5′- TGTAGGCATCGCTCTTCTCA…”
Influential
Cited by
Mucin dynamics and enteric pathogens
McGuckin, M. A., Lindén, S. K., Sutton, P., & Florin, T. H. (2011) · Nature Reviews Microbiology · doi:10.1038/nrmicro2538 · Cited by 1,428
The intestinal crypt, a prototype stem cell compartment
Clevers, H. (2013) · Cell · doi:10.1016/j.cell.2013.07.004 · Cited by 1,223
VanDussen, K. L., Carulli, A. J., Keeley, T. M., Patel, S. R., Puthoff, B. J., Magness, S. T., Tran, I. T., Maillard, I., Siebel, C., Kolterud, Å., et al. (2012) · Development · doi:10.1242/dev.070763 · Cited by 578
The ETS family of oncogenic transcription factors in solid tumours
Sizemore, G. M., Pitarresi, J. R., Balakrishnan, S., & Ostrowski, M. C. (2017) · Nature Reviews Cancer · doi:10.1038/nrc.2017.20 · Cited by 367
An intercrypt subpopulation of goblet cells is essential for colonic mucus barrier function
Nyström, E. E. L., Martinez-Abad, B., Arike, L., Birchenough, G. M. H., Nonnecke, E. B., Castillo, P. A., Svensson, F., Bevins, C. L., Hansson, G. C., & Johansson, M. E. V. (2021) · Science · doi:10.1126/science.abb1590 · Cited by 348
Metadata
- Authors
- Noah, T. K., Kazanjian, A., Whitsett, J., & Shroyer, N. F.
- Venue
- Experimental Cell Research
- Publisher
- Elsevier BV
- Published
- 2010-02
- Volume
- 316
- Issue
- 3
- Pages
- 452-465
- ISSN
- 0014-4827 (ISSN-L)
- OpenAlex
- W2031735410
- Cited by
- 202
- References
- 2
- FWCI
- 5.88
- Type
- journal article
- Language
- en
- Open access
- green
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
How to cite
Cite CoChat for the checks on this page, and the paper for its own findings.
- This page
- CoChat. (2026). Citation check: SAM pointed domain ETS factor (SPDEF) regulates terminal differentiation and maturation of intestinal goblet cells. https://app.cochat.ai/papers/10.1016/j.yexcr.2009.09.020
- The paper
- Noah, T. K., Kazanjian, A., Whitsett, J., & Shroyer, N. F. (2010). SAM pointed domain ETS factor (SPDEF) regulates terminal differentiation and maturation of intestinal goblet cells. Experimental Cell Research. https://doi.org/10.1016/j.yexcr.2009.09.020
Data sources
Bibliographic data: Semantic Scholar, OpenAlex, Crossref.
Contains information from the Semantic Scholar Academic Graph Datasets, made available under the ODC Attribution License (ODC-BY 1.0).
Semantic Scholar’s data is described in: Kinney, R., et al. (2023). The Semantic Scholar Open Data Platform. arXiv:2301.10140.
