Variation in DCP1, encoding ACE, is associated with susceptibility to Alzheimer disease
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The ACE locus is a known blood pressure and AD association.
“which is a known blood pressure and AD association”
From Multi-trait association studies discover pleiotropic loci between Alzheimer’s disease and cardiometabolic traits (2021) · cites this paper as [35]
ACE and ADAM10 were previously reported as Alzheimer's disease candidate genes but were not replicated in some subsequent studies.
“ACE and ADAM10 were previously reported as Alzheimer’s disease candidate genes18–22 but were not replicated in some subsequent studies23–25.”
From Genetic meta-analysis of diagnosed Alzheimer’s disease identifies new risk loci and implicates Aβ, tau, immunity and lipid processing (2019) · cites this paper as [20]
Candidate gene studies have associated ACE variants with Alzheimer's disease risk, including a strong association in the Wadi Ara community.
“Candidate gene studies have associated ACE variants with Alzheimer’s disease risk20,22,79, including a strong association in the Wadi Ara, an Israeli Arab community with high risk of Alzheimer’s disease21.”
From Genetic meta-analysis of diagnosed Alzheimer’s disease identifies new risk loci and implicates Aβ, tau, immunity and lipid processing (2019) · cites this paper as [20]
Cites
Folstein, M. F., Folstein, S. E., & McHugh, P. R. (1975) · Journal of Psychiatric Research · doi:10.1016/0022-3956(75)90026-6 · Cited by 88,282 · see citing works
Rigat, B., Hubert, C., Alhenc-Gelas, F., Cambien, F., Corvol, P., & Soubrier, F. (1990) · Journal of Clinical Investigation · doi:10.1172/jci114844 · Cited by 3,767 · see citing works
ON ESTIMATING THE RELATION BETWEEN BLOOD GROUP AND DISEASE
Woolf, B. (1955) · Annals of Human Genetics · doi:10.1111/j.1469-1809.1955.tb01348.x · Cited by 2,739 · see citing works
Rigat, B. A., Hübert, C., Corvol, P. L., & Soubrier, R. (1992) · Nucleic Acids Research · doi:10.1093/nar/20.6.1433-a · Cited by 1,235 · see citing works
Genetic associations with human longevity at the APOE and ACE loci
Schächter, F., Faure-Delanef, L., Guénot, F., Rouger, H., Froguel, P., Lesueur-Ginot, L., & Cohen, D. (1994) · Nature Genetics · doi:10.1038/ng0194-29 · Cited by 1,095 · see citing works
Apolipoprotein E genotyping by one-stage PCR
Wenham, P. R., Price, W. H., & Blundell, G. (1991) · The Lancet · doi:10.1016/0140-6736(91)92823-k · Cited by 1,070 · see citing works
Lindpaintner, K., Pfeffer, M. A., Kreutz, R. H., Stampfer, M. J., Grodstein, F., Lamotte, F., Buring, J. E., & Hennekens, C. H. (1995) · New England Journal of Medicine · doi:10.1056/nejm199503163321103 · Cited by 899 · see citing works
Angiotensin-converting enzyme: new concepts concerning its biological role.
Ehlers, M., & Riordan, J. (1989) · Biochemistry · doi:10.1021/bi00439a001 · Cited by 395 · see citing works
Genetic susceptibility to Alzheimer disease
Pericak‐Vance, M. A., & Haines, J. L. (1995) · Trends in Genetics · doi:10.1016/s0168-9525(00)89161-1 · Cited by 125 · see citing works
Attenuation of scopolamine-induced spatial learning impairments by an angiotensin IV analog
Pederson, E. S., Harding, J. W., & Wright, J. W. (1998) · Regulatory Peptides · doi:10.1016/s0167-0115(98)00028-7 · Cited by 103 · see citing works
Roses, A. D. (1998) · American Journal of Medical Genetics · doi:10.1002/(sici)1096-8628(19980207)81:1 · Cited by 83 · see citing works
Angiotensin-Converting Enzyme Gene Polymorphism and Cardiovascular Disease
Butler, R. J., Morris, A. D., & Struthers, A. D. (1997) · Clinical Science · doi:10.1042/cs0930391 · Cited by 47 · see citing works
K variant of butyrycholinesterase and late-onset Alzheimer's disease
Russ, C., Powell, J. F., Lovestone, S., & Holmes, C. (1998) · The Lancet · doi:10.1016/s0140-6736(05)70292-0 · Cited by 32 · see citing works
Self-citationAssociation between a PS-1 intronic polymorphism and late onset Alzheimerʼs disease
Kehoe, P. G., Williams, J. H., Holmans, P., Liddell, M. B., Lovestone, S., Holmes, C., Powell, J. F., Neal, J., Wilcock, G. K., & Owen, M. J. (1996) · Neuroreport · doi:10.1097/00001756-199609020-00019 · Cited by 28 · see citing works
Self-citation
Flagged first, then by citations
Cited by
Sorted by citations
Alzheimer Disease Genetics Consortium (ADGC), Kunkle, B. W., The European Alzheimer’s Disease Initiative (EADI), Cohorts for Heart and Aging Research in Genomic Epidemiology Consortium (CHARGE), Genetic and Environmental Risk in AD/Defining Genetic, P. A. E. R. F. A. D. C. (., Grenier-Boley, B., Sims, R., Bis, J. C., Damotte, V., Naj, A. C., et al. (2019) · Nature Genetics · doi:10.1038/s41588-019-0358-2 · Cited by 2,946 · see citing works
Self-citationThe Genetics of Alzheimer Disease: Back to the Future
Bertram, L., Lill, C. M., & Tanzi, R. E. (2010) · Neuron · doi:10.1016/j.neuron.2010.10.013 · Cited by 834 · see citing works
The Genetics of Alzheimer's Disease
Bertram, L., & Tanzi, R. E. (2012) · Progress in molecular biology and translational science · doi:10.1016/b978-0-12-385883-2.00008-4 · Cited by 784 · see citing works
The genetics of Alzheimer disease
Tanzi, R. E. (2012) · Cold Spring Harbor Perspectives in Medicine · doi:10.1101/cshperspect.a006296 · Cited by 727 · see citing works
“ACE is also able to degrade Ab in vitro (Hu et al. 2001; Hemming et al. 2005).”
BackgroundThirty years of Alzheimer's disease genetics: the implications of systematic meta-analyses
Bertram, L., & Tanzi, R. E. (2008) · Nature Reviews Neuroscience · doi:10.1038/nrn2494 · Cited by 747 · see citing works
Amyloid cascade hypothesis: Pathogenesis and therapeutic strategies in Alzheimer's disease
Barage, S. H., & Sonawane, K. D. (2015) · Neuropeptides · doi:10.1016/j.npep.2015.06.008 · Cited by 579 · see citing works
“of Angiotensin II has been implicated in AD (Kehoe et al., 1999).”
The role of cerebral ischemia in Alzheimer’s disease
Kalaria, R. N. (2000) · Neurobiology of Aging · doi:10.1016/s0197-4580(00)00125-1 · Cited by 522 · see citing works
The molecular bases of Alzheimer’s disease and other neurodegenerative disorders
Maccioni, R. B., Muñoz, J. P., & Barbeito, L. (2001) · Archives of Medical Research · doi:10.1016/s0188-4409(01)00316-2 · Cited by 474 · see citing works
Miners, J. S., Baig, S., Palmer, J. C., Palmer, L. E., Kehoe, P. G., & Love, S. (2008) · Brain Pathology · doi:10.1111/j.1750-3639.2008.00132.x · Cited by 380 · see citing works
Self-citationHu, J.-G., Igarashi, A., Kamata, M., & Nakagawa, H. (2001) · Journal of Biological Chemistry · doi:10.1074/jbc.m104068200 · Cited by 307 · see citing works
Sayed-Tabatabaei, F., Oostra, B., Isaacs, A., van Duijn, C. V., & Witteman, J. (2006) · Circulation Research · doi:10.1161/01.res.0000223145.74217.e7 · Cited by 306 · see citing works
Hemming, M. L., & Selkoe, D. J. (2005) · Journal of Biological Chemistry · doi:10.1074/jbc.m508460200 · Cited by 333 · see citing works
Causative and susceptibility genes for Alzheimer’s disease: a review
Rocchi, A., Pellegrini, S., Siciliano, G., & Murri, L. (2003) · Brain Research Bulletin · doi:10.1016/s0361-9230(03)00067-4 · Cited by 319 · see citing works
Clearance of cerebral Aβ in Alzheimer’s disease: reassessing the role of microglia and monocytes
Zuroff, L. R., Daley, D. A., Black, K. L., & Koronyo‐Hamaoui, M. (2017) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-017-2463-7 · Cited by 275 · see citing works
Demonstrating the case that AD is a vascular disease: epidemiologic evidence
Launer, L. J. (2002) · Ageing Research Reviews · doi:10.1016/s0047-6374(01)00364-5 · Cited by 227 · see citing works
Savaskan, E., Höck, C., Olivieri, G., Bruttel, S., Rosenberg, C., Hulette, C., & Müller-Spahn, F. (2001) · Neurobiology of Aging · doi:10.1016/s0197-4580(00)00259-1 · Cited by 217 · see citing works
Molecular genetics of Alzheimer's disease: An update
Brouwers, N., Sleegers, K., & Broeckhoven, C. V. (2008) · Annals of Medicine · doi:10.1080/07853890802186905 · Cited by 208 · see citing works
“In candidate-gene-based studies re- searchers have focused on genes encoding function- ally relevant proteins, e.g. proteins that belong to the g-secretase complex (for example PSEN1 (185,225, 245) or NCSTN (225,246)), regulate APP traffick- ing (SORL1 (247,248)), or are involved in fibrillization or clearance of the…”
BackgroundGenotype-Phenotype Relationships for the Renin-Angiotensin-Aldosterone System in a Normal Population
Paillard, F., Chansel, D., Brand, E., Bénétos, A., Thomas, F., Czekałski, S., Ardaillou, R., & Soubrier, F. (1999) · Hypertension · doi:10.1161/01.hyp.34.3.423 · Cited by 206 · see citing works
Kehoe, P. G., Wong, S., AL Mulhim, N., Palmer, L. E., & Miners, J. S. (2016) · Alzheimer's Research & Therapy · doi:10.1186/s13195-016-0217-7 · Cited by 203 · see citing works
“(rs1799752) is a genetic risk factor for sporadic AD [17].”
BackgroundInfluentialSelf-citationLehmann, D. J., Cortina-Borja, M., Warden, D. R., Smith, A. D., Sleegers, K., Prince, J. A., van Duijn, C. M., & Kehoe, P. G. (2005) · American Journal of Epidemiology · doi:10.1093/aje/kwi202 · Cited by 199 · see citing works
“(1) Cardiff, Wales 198 77 NINCDS-ADRDA probable”
BackgroundMethodResultInfluentialSelf-citationRankinen, T., Wolfarth, B., Simoneau, J., Maier-Lenz, D., Rauramaa, R., Rivera, M. A., Boulay, M. R., Chagnon, Y. C., Përusse, L., Keul, J., et al. (2000) · Journal of Applied Physiology · doi:10.1152/jappl.2000.88.5.1571 · Cited by 188 · see citing works
“Moreover, the reports showing that, unlike one would assume, the D allele and DD genotype were more common in centenarians (38) and were associated with a lower risk of Alzheimer’s disease (15) further add to the confusion.”
Are amyloid‐degrading enzymes viable therapeutic targets in Alzheimer’s disease?
Nalivaeva, N., Beckett, C. S., Belyaev, N. D., & Turner, A. J. (2012) · Journal of Neurochemistry · doi:10.1111/j.1471-4159.2011.07510.x · Cited by 178 · see citing works
Zou, K., Yamaguchi, H., Akatsu, H., Sakamoto, T., Ko, M.-H., Mizoguchi, K., Gong, J.-S., Yu, W., Yamamoto, T., Kosaka, K., et al. (2007) · Journal of Neuroscience · doi:10.1523/jneurosci.1549-07.2007 · Cited by 186 · see citing works
“Numerous studies have shown that the I allele of ACE D/I polymorphism is associated with an increased risk of late-onset AD (Hu et al., 1999; Kehoe et al., 1999; Elkins et al., 2004; Lehmann et al., 2005) and that I polymorphism is associated with a decreased serum ACE level (Rigat et al., 1990).”
Backgroundβ ‐Amyloid Degradation and Alzheimer′s Disease
Wang, D.-S., Dickson, D. W., & Malter, J. S. (2006) · BioMed Research International · doi:10.1155/jbb/2006/58406 · Cited by 185 · see citing works
“Patients at higher AD risk had an insertion (I) polymorphism within intron 16 of the ACE gene, which was associated with AD [121].”
BackgroundIs inhibition of the renin–angiotensin system a new treatment option for Alzheimer's disease?
Kehoe, P. G., & Wilcock, G. K. (2007) · The Lancet Neurology · doi:10.1016/s1474-4422(07)70077-7 · Cited by 180 · see citing works
Self-citationTargeting amyloid clearance in Alzheimer's disease as a therapeutic strategy
Nalivaeva, N. N., & Turner, A. J. (2019) · British Journal of Pharmacology · doi:10.1111/bph.14593 · Cited by 172 · see citing works
“reports that a common polymorphism in the ACE gene was associated with sporadic cases of AD (Kehoe et al., 1999).”
BackgroundMiners, J. S., Ashby, E., Helmond, Z. V., Chalmers, K. A., Palmer, L. E., Love, S., & Kehoe, P. G. (2007) · Neuropathology and Applied Neurobiology · doi:10.1111/j.1365-2990.2007.00885.x · Cited by 166 · see citing works
Self-citationAngiotensins in Alzheimer's disease – friend or foe?
Kehoe, P. G., Miners, J. S., & Love, S. (2009) · Trends in Neurosciences · doi:10.1016/j.tins.2009.07.006 · Cited by 166 · see citing works
Self-citationMiners, J. S., Helmond, Z. V., Chalmers, K. A., Wilcock, G. K., Love, S., & Kehoe, P. G. (2006) · Journal of Neuropathology & Experimental Neurology · doi:10.1097/01.jnen.0000240463.87886.9a · Cited by 153 · see citing works
Self-citationChapter 5 Biomarkers Related To Aging In Human Populations
Crimmins, E. M., Vasunilashorn, S. M., Kim, J. K., & Alley, D. E. (2008) · Advances in clinical chemistry · doi:10.1016/s0065-2423(08)00405-8 · Cited by 156 · see citing works
Prince, J. A., Feuk, L., Sawyer, S. L., Gottfries, J., Ricksten, A., Nägga, K., Bogdanović, N., Blennow, K., & Brookes, A. J. (2001) · European Journal of Human Genetics · doi:10.1038/sj.ejhg.5200651 · Cited by 143 · see citing works
“Probe 1 GCATGGACGGCTCAG Probe 2 GCATGGATGGCTCAG DCP1 SNP000006569 Forward CAGATCTGACGAATGTTATGGC (Kehoe et al., 1999): Found in late-onset AD.”
BackgroundSARS-CoV-2 infections and COVID-19 mortalities strongly correlate with ACE1 I/D genotype
Yamamoto, N., Ariumi, Y., Nishida, N., Yamamoto, R., Bauer, G., Gojobori, T., Shimotohno, K., & Mizokami, M. (2020) · Gene · doi:10.1016/j.gene.2020.144944 · Cited by 141 · see citing works
Kehoe, P. G. (2018) · Journal of Alzheimer’s Disease · doi:10.3233/jad-171119 · Cited by 133 · see citing works
“We observed a statistically significant and consistent increase in ACE (I) allele bearing genotypes and increased risk of AD, in three independent case-control cohorts, that was independent of any APOE associated risk [34].”
BackgroundSelf-citationKatzov, H., Chalmers, K. A., Palmgren, J., Andreasen, N., Johansson, B. E. A., Cairns, N. J., Gatz, M., Wilcock, G. K., Love, S., Pedersen, N. L., et al. (2004) · Human Mutation · doi:10.1002/humu.20012 · Cited by 128 · see citing works
“Two genes have been reproducibly shown to influence risk for the sporadic form of AD, these encoding apolipoprotein E (APOE; MIM# 107741) and angiotensin I converting enzyme (ACE; MIM# 106180) [Strittmatter et al., 1993; Kehoe et al., 1999b; Kehoe et al., 2003].”
BackgroundSelf-citationHaplotypes extending across ACE are associated with Alzheimer's disease
Kehoe, P. G. (2003) · Human Molecular Genetics · doi:10.1093/hmg/ddg094 · Cited by 119 · see citing works
Self-citationThe ACE gene and Alzheimer's disease susceptibility
Narain, Y., Yip, A., Murphy, T., Brayne, C., Easton, D., Evans, J. G., Xuereb, J., Cairns, N., Esiri, M., Furlong, R., et al. (2000) · Journal of Medical Genetics · doi:10.1136/jmg.37.9.695 · Cited by 121 · see citing works
Self-citationArdila, A., Lopera, F., Rosselli, M., Moreno, S., Madrigal, L., Arango-Lasprilla, J. C., Arcos, M., Murcia, C., Arango-Viana, J. C., Ossa, J., et al. (2000) · Archives of Clinical Neuropsychology · doi:10.1093/arclin/15.6.515 · Cited by 113 · see citing works
“Differences in the age of onset in the very same family carrying the very same mutation indicates that there are some other nongenetic and/or other genetic factors capable to modify the onset of the disease (Corder et al., 1993; Kehoe et al., 1999; Liao et al., 1998).”
Pharmacogenomics in Alzheimer's Disease
Cacabelos, R. (2008) · Methods in molecular biology · doi:10.1007/978-1-59745-205-2_10 · Cited by 109 · see citing works
A polymorphism in the cystatin C gene is a novel risk factor for late-onset Alzheimer’s disease
Crawford, F., Freeman, M. J., Schinka, J. A., Abdullah, L. I., Gold, M., Hartman, R. D., Krivian, K., Morris, M. D., Richards, D., Duara, R., et al. (2000) · Neurology · doi:10.1212/wnl.55.6.763 · Cited by 109 · see citing works
Kakoki, M. (2006) · Journal of Clinical Investigation · doi:10.1172/jci26958 · Cited by 107 · see citing works
“Introduction Genetically determined higher levels of angiotensin-converting enzyme (ACE), which do not significantly affect blood pressure or angiotensin II and aldosterone levels (1), have been correlated in several studies with an increased risk of a broad and overlapping constellation of diseases, including diabeti…”
BackgroundAlzheimer disease risk and genetic variation in ACE
Elkins, J. S., Douglas, V. C., & Johnston, S. C. (2004) · Neurology · doi:10.1212/01.wnl.0000106823.72493.ff · Cited by 108 · see citing works
“1999 (17) UK 209 198 76 77 C 57 52 P 0.”
Álvarez, R., Álvarez, V., Lahoz, C., Martínez, C., Peña, J., Sanchez, J. M., Guisasola, L., Salas-Puig, J., Morís, G., Vidal, J. A., et al. (1999) · Journal of Neurology Neurosurgery & Psychiatry · doi:10.1136/jnnp.67.6.733 · Cited by 105 · see citing works
“In accordance with a role for the renin-angiotensin system in Alzheimer's disease, the ACE-I allele has been associated with an increased risk of developing late onset Alzheimer's disease.”
BackgroundPihlaja, R., Koistinaho, J., Kauppinen, R., Sandholm, J., Tanila, H., & Koistinaho, M. (2011) · Glia · doi:10.1002/glia.21212 · Cited by 96 · see citing works
“Some previous studies suggest that polymorphism of ACE gene might be involved in the development of AD (Kehoe et al., 1999).”
BackgroundAssociation Between Angiotensin-Converting Enzyme and Alzheimer Disease
Farrer, L. A., Sherbatich, T., Keryanov, S. A., Коровайцева, Г. И., Rogaeva, E. A., Petruk, S., Premkumar, S., Moliaka, Y., Song, Y., Pei, Y., et al. (2000) · Archives of Neurology · doi:10.1001/archneur.57.2.210 · Cited by 96 · see citing works
Mateos, L., Akterin, S., Gil-Bea, F. J., Spulber, S. D., Rahman, A., Björkhem, I., Schultzberg, M., Flores‐Morales, A., & Cedazo-Mı́nguez, Á. (2008) · Brain Pathology · doi:10.1111/j.1750-3639.2008.00174.x · Cited by 92 · see citing works
“In addition, we decided to analyze by RT-PCR the expression of the angiotensin-converting enzyme (Ace), a molecule of reported importance in AD (2, 4, 21), which values were very close to the criteria for significance in the microarray analysis (Fold change 1.”
BackgroundMethodGenetic susceptibility factors for Alzheimer's disease
Richard, F., & Amouyel, P. (2001) · European Journal of Pharmacology · doi:10.1016/s0014-2999(00)00903-1 · Cited by 91 · see citing works
Ellul, J., Archer, N. J., Foy, C. M. L., Poppe, M., Boothby, H., Nicholas, H., Brown, R. G., & Lovestone, S. (2006) · Journal of Neurology Neurosurgery & Psychiatry · doi:10.1136/jnnp.2006.104034 · Cited by 91 · see citing works
Self-citationEffects of centrally acting ACE inhibitors on the rate of cognitive decline in dementia
Gao, Y., Ó’Caoimh, R., Healy, L. O., Kerins, D. M., Eustace, J. A., Guyatt, G. H., Sammon, D., & Molloy, D. W. (2013) · BMJ Open · doi:10.1136/bmjopen-2013-002881 · Cited by 85 · see citing works
Soluble adhesion molecules and angiotensin-converting enzyme in dementia
Nielsen, H. M., Londos, E., Minthon, L., & Janciauskiene, S. M. (2007) · Neurobiology of Disease · doi:10.1016/j.nbd.2006.11.011 · Cited by 80 · see citing works
Perry, R. T., Collins, J. S., Harrell, L. E., Acton, R. T., & Go, R. C. P. (2001) · American Journal of Medical Genetics · doi:10.1002/ajmg.1371 · Cited by 81 · see citing works
Psychiatric genetics: back to the future
Owen, M. J., Cardno, A. G., & O’Donovan, M. C. (2000) · Molecular Psychiatry · doi:10.1038/sj.mp.4000702 · Cited by 81 · see citing works
Self-citationÓ’Caoimh, R., Healy, L. O., Gao, Y., Svendrovski, A., Kerins, D. M., Eustace, J. A., Kehoe, P. G., Guyatt, G. H., & Molloy, D. W. (2014) · Journal of Alzheimer s Disease · doi:10.3233/jad-131694 · Cited by 80 · see citing works
“ACE gene polymorphisms are associated with increased risk of AD [24, 25]: alleles putatively associated with AD are also associated with low levels of plasma ACE [26, 27].”
BackgroundSelf-citationKumar, S., Singh, S., Hinze, D., Josten, M., Sahl, H., Siepmann, M., & Walter, J. (2012) · Journal of Biological Chemistry · doi:10.1074/jbc.m111.279133 · Cited by 76 · see citing works
Zou, K., Maeda, T., Watanabe, A., Liu, J., Liu, S., Oba, R., Satoh, Y.-I., Komano, H., & Michikawa, M. (2009) · Journal of Biological Chemistry · doi:10.1074/jbc.m109.011437 · Cited by 76 · see citing works
Insights into the pathogenesis and pathogenicity of cerebral amyloid angiopathy
Love, S. (2009) · Frontiers in bioscience · doi:10.2741/3567 · Cited by 75 · see citing works
Genetic risk of Alzheimer's disease: advising relatives
Liddell, M. B., Lovestone, S., & Owen, M. J. (2001) · The British Journal of Psychiatry · doi:10.1192/bjp.178.1.7 · Cited by 74 · see citing works
Self-citationHu, J., Miyatake, F., Aizu, Y., Nakagawa, H., Nakamura, S., Tamaoka, A., Takahash, R., Urakami, K., & Shoji, M. (1999) · Neuroscience Letters · doi:10.1016/s0304-3940(99)00827-7 · Cited by 74 · see citing works
Toropygin, I. Y., Kugaevskaya, E. V., Mirgorodskaya, O. A., Elisseeva, Y. E., Kozmin, Y., Popov, I. A., Николаев, Е. Н., Makarov, A. А., & Kozin, S. A. (2007) · Rapid Communications in Mass Spectrometry · doi:10.1002/rcm.3357 · Cited by 72 · see citing works
Koronyo‐Hamaoui, M., Sheyn, J., Hayden, E. Y., Li, S., Fuchs, D.-T. S., Regis, G. C., Lopes, D. H. J., Black, K. L., Bernstein, K. E., Teplow, D. B., et al. (2019) · Brain · doi:10.1093/brain/awz364 · Cited by 70 · see citing works
“Importantly, individuals carrying variants of the ACE gene (D/D alleles) resulting in increased plasma expression of the enzyme were associated with lower risk for Alzheimer’s disease (Kehoe et al., 1999; Lehmann et al., 2005).”
BackgroundThe geographic distribution of the ACE II genotype: a novel finding.
Saab, Y., Gard, P. R., & Overall, A. (2007) · Genetical research · doi:10.1017/s0016672307009019 · Cited by 67 · see citing works
Sun, Y., Zhu, J., Zhou, D., Canchi, S., Wu, C., Cox, N. J., Rissman, R. A., Gamazon, E. R., & Wu, L. (2021) · Genome Medicine · doi:10.1186/s13073-021-00959-y · Cited by 69 · see citing works
“ACE, which encodes angiotensin I converting enzyme, is a known gene for AD [41, 42].”
BackgroundMcCullagh, C. D., Craig, D. W., McIlroy, S. P., & Passmore, A. P. (2001) · Advances in Psychiatric Treatment · doi:10.1192/apt.7.1.24 · Cited by 70 · see citing works
Self-citationACE I/D polymorphism is a risk factor of Alzheimer's disease but not of vascular dementia
Kölsch, H., Jessen, F., Freymann, N., Kreis, M., Hentschel, F., Maier, W., & Heun, R. (2004) · Neuroscience Letters · doi:10.1016/j.neulet.2004.11.062 · Cited by 69 · see citing works
Angiotensin-converting Enzyme, Sleep-disordered Breathing, and Hypertension
Lin, L., Finn, L. A., Zhang, J., Young, T. B., & Mignot, E. J.-M. (2004) · American Journal of Respiratory and Critical Care Medicine · doi:10.1164/rccm.200405-616oc · Cited by 68 · see citing works
The Renin Angiotensin System and Alzheimer's Disease
Amouyel, P., RICHARD, F., Berr, C., David-Fromentin, I., & Helbecque, N. (2000) · Annals of the New York Academy of Sciences · doi:10.1111/j.1749-6632.2000.tb06395.x · Cited by 68 · see citing works
Panza, F. (2003) · Experimental Gerontology · doi:10.1016/s0531-5565(03)00154-2 · Cited by 65 · see citing works
Frederiksen, H., Gaist, D., Bathum, L., Andersen, K., McGue, M. K., Vaupel, J. W., & Christensen, K. (2003) · Annals of Epidemiology · doi:10.1016/s1047-2797(02)00254-5 · Cited by 62 · see citing works
“An increased risk of AD was associated with the I allele in one study (7), but the D allele in another (8).”
BackgroundResultACE gene is associated with Alzheimer's disease and atrophy of hippocampus and amygdala
Sleegers, K., den Heijer, T., van Dijk, E. J., Albert Hofman, D., Bertoli‐Avella, A. M., Koudstaal, P. J., Breteler, M. M. B., & van Duijn, C. M. (2004) · Neurobiology of Aging · doi:10.1016/j.neurobiolaging.2004.09.011 · Cited by 61 · see citing works
Seripa, D., Forno, G. D., Matera, M. G., Gravina, C., Margaglione, M., Palermo, M., Wekstein, D., Antuono, P., Davis, D., Daniele, A., et al. (2003) · Neurobiology of Aging · doi:10.1016/s0197-4580(03)00040-x · Cited by 61 · see citing works
“A few large studies on Caucasian found an association between the I allele and increased susceptibility to AD [1,23,34].”
BackgroundVascular risk and genetics of sporadic late-onset Alzheimer’s disease
Panza, F., D’Introno, A., Colacicco, A. M., Basile, A. M., Capurso, C. A., Kehoe, P. G., Capurso, C. A., & Solfrizzi, V. (2003) · Journal of Neural Transmission · doi:10.1007/s00702-003-0071-1 · Cited by 59 · see citing works
Self-citationWright, J. W., & Harding, J. W. (2008) · Journal of the Renin-Angiotensin-Aldosterone System · doi:10.1177/1470320308099084 · Cited by 59 · see citing works
Genetics and Underlying Pathology of Dementia
Ferencz, B., & Gerritsen, L. (2015) · Neuropsychology Review · doi:10.1007/s11065-014-9276-3 · Cited by 55 · see citing works
Pharmacogenomics of neurodegenerative diseases
Maimone, D., Dominici, R., & Grimaldi, L. M. E. (2001) · European Journal of Pharmacology · doi:10.1016/s0014-2999(00)00939-0 · Cited by 56 · see citing works
Renin Angiotensin System in Cognitive Function and Dementia
Bodiga, V. L., & Bodiga, S. (2013) · Asian Journal of Neuroscience · doi:10.1155/2013/102602 · Cited by 57 · see citing works
“A potential relation between ACE and AD was first suggested by human genetic studies, which reported that an insertion/deletion polymorphismwithin intron 16 of theACE gene is associated with AD [186].”
BackgroundLiu, S., Ando, F., Fujita, Y., Liu, J., Maeda, T., Shen, X., Kikuchi, K., Matsumoto, A., Yokomori, M., Tanabe, C., et al. (2019) · Journal of Biological Chemistry · doi:10.1074/jbc.ra118.006420 · Cited by 55 · see citing works
“Abeta(1-40), and its inhibition enhances brain Abeta deposition.”
BackgroundMethodInfluentialNovel modulators of amyloid‐β precursor protein processing
Tang, B. L., & Liou, Y. C. (2006) · Journal of Neurochemistry · doi:10.1111/j.1471-4159.2006.04215.x · Cited by 57 · see citing works
Gender-specific association of the angiotensin converting enzyme gene with Alzheimer's disease
Crawford, F., Abdullah, L. I., Schinka, J. A., Suo, Z., Gold, M., Duara, R., & Mullan, M. (2000) · Neuroscience Letters · doi:10.1016/s0304-3940(00)00791-6 · Cited by 57 · see citing works
Potential Enzymatic Targets in Alzheimer's: A Comprehensive Review.
Alam, J., & Sharma, L. (2019) · Current Drug Targets · doi:10.2174/1389450119666180820104723 · Cited by 43 · see citing works
Meira‐Lima, I., Pereira, A. C., da Mota, G. D. F. A., Krieger, J. E., & Vallada, H. (2000) · Neuroscience Letters · doi:10.1016/s0304-3940(00)01512-3 · Cited by 56 · see citing works
Masuyer, G., Yates, C. J., Sturrock, E. D., & Acharya, K. R. (2014) · Biological Chemistry · doi:10.1515/hsz-2014-0157 · Cited by 55 · see citing works
Risk and protective factors for sporadic Alzheimer's disease.
Stožická, Z., Žilka, N., & Novák, M. (2007) · PubMed · Cited by 55 · see citing works
Carnovale, C., Perrotta, C., Baldelli, S., Cattaneo, D., Montrasio, C., Barbieri, S. S., Pompilio, G., Vantaggiato, C., Clementi, E., & Pozzi, M. (2022) · Cardiovascular Research · doi:10.1093/cvr/cvac110 · Cited by 54 · see citing works
“Beside major depressive disorder, SNPs within the ACE gene were also significantly associated with acute stress response and higher mortality following a major trauma.273,280,281 In particular, the rs4311 SNP within the ACE gene, that has been associated with the panic attack syndrome, might be a functional polymorphi…”
BackgroundReal-time PCR for rapid genotyping of angiotensin-converting enzyme insertion/deletion polymorphism
Lin, M., Tseng, C., Tseng, C., Huang, C., Chong, C., & Tseng, C. (2001) · Clinical Biochemistry · doi:10.1016/s0009-9120(01)00281-8 · Cited by 53 · see citing works
Human gene polymorphisms and their possible impact on the clinical outcome of SARS-CoV-2 infection
Hashemi, S. M. A., Thijssen, M., Hosseini, S. Y., Tabarraei, A., Pourkarim, M. R., & Sarvari, J. (2021) · Archives of Virology · doi:10.1007/s00705-021-05070-6 · Cited by 53 · see citing works
DNA methylation in neurodegenerative disorders: a missing link between genome and environment?
Iraola‐Guzmán, S., Estivill, X., & Rabionet, R. (2011) · Clinical Genetics · doi:10.1111/j.1399-0004.2011.01673.x · Cited by 52 · see citing works
Takeda, S. (2007) · Frontiers in bioscience · doi:10.2741/2839 · Cited by 51 · see citing works
“Some studies showed that the frequency of the ACE-I allele was significantly increased in patients with AD, but others yielded conflicting results (116, 117, 118, 119, 120, 121, 122, 123, 124).”
ResultRibeiro, V. T., de Souza, L. C., & Silva, A. C. S. E. (2019) · Protein and Peptide Letters · doi:10.2174/0929866527666191230103739 · Cited by 50 · see citing works
Mattila, K. M., Rinne, J. O., Röyttä, M., Laippala, P., Pietilä, T., Kalimo, H., Koivula, T., Frey, H., & Lehtimäki, T. J. (2000) · Journal of Medical Genetics · doi:10.1136/jmg.37.10.766 · Cited by 51 · see citing works
Cheng, C., Hong, C., Liu, H.-C., Liu, T., & Tsai, S. (2002) · European Neurology · doi:10.1159/000047943 · Cited by 50 · see citing works
“These findings suggest that the ACE gene may be a candidate for susceptibility to AD. A recent report by Kehoe et al. [”
BackgroundThe ACE I allele is associated with increased risk for ruptured intracranial aneurysms
Keramatipour, M., McConnell, R. S., Kirkpatrick, P., Tebbs, S., Furlong, R. A., & Rubinsztein, D. C. (2000) · Journal of Medical Genetics · doi:10.1136/jmg.37.7.498 · Cited by 50 · see citing works
“Recently, the I allele has been associated with risk for Alzheimer's disease,”
BackgroundGenetics of menopause-associated diseases
Massart, F., Reginster, J., & Brandi, M. L. (2001) · Maturitas · doi:10.1016/s0378-5122(01)00283-3 · Cited by 50 · see citing works
Myllykangas, L., Polvikoski, T. M., Sulkava, R. O., Verkkoniemi, A., Tienari, P. J., Niinistö, L., Kontula, K., Hardy, J., Haltia, M., & Pérez‐Tur, J. (2000) · Neuroscience Letters · doi:10.1016/s0304-3940(00)01467-1 · Cited by 50 · see citing works
Katzov, H., Bennet, A. M., Kehoe, P. G., Wiman, B., Gatz, M., Blennow, K., Lenhard, B., Pedersen, N. L., Fairé, U. D., & Prince, J. A. (2004) · Human Molecular Genetics · doi:10.1093/hmg/ddh286 · Cited by 48 · see citing works
“We further show that the models employed to demonstrate effects upon obesity also efficiently capture effects upon MI and AD, two diseases that have long been posited to be associated with ACE (45,47).”
MethodSelf-citationEvaluation of the roles of common genetic mutations in leukoaraiosis
Szolnoki, Z., Somogyvári, F., Kondacs, A., Szabó, M., & Fodor, L. (2001) · Acta Neurologica Scandinavica · doi:10.1034/j.1600-0404.2001.00355.x · Cited by 49 · see citing works
“The distribution of ACE I/D polymorphism has been reported to influence the susceptibility to AD (29).”
BackgroundCandidate Gene Association Studies in Sporadic Alzheimer’s Disease
Combarros, O., Alvarez-Arcaya, A., Sánchez-Guerra, M., Infante, J., & Berciano, J. (2002) · Dementia and Geriatric Cognitive Disorders · doi:10.1159/000058332 · Cited by 48 · see citing works
Wang, H., Fung, H., Hsu, W.-W., Wu, Y., Lin, J., Ro, L. ‐., Chang, K. H., Hwu, F. J., Hsu, Y., Huang, S.-Y., et al. (2006) · Journal of Neural Transmission · doi:10.1007/s00702-005-0424-z · Cited by 46 · see citing works
“However, our study differs from those of the meta-analysis (Kehoe et al., 1999; Elkins et al., 2004) and previous studies on Taiwanese and Chinese populations (Yang et al., 2000; Cheng et al., 2002), in which the I allele was shown to be associated with AD.”
BackgroundResultSeripa, D., Matera, M. G., Forno, G. D., Gravina, C., Masullo, C., Daniele, A., Binetti, G., Bonvicini, C., Squitti, R., Palermo, M., et al. (2005) · Neurobiology of Aging · doi:10.1016/j.neurobiolaging.2004.04.001 · Cited by 48 · see citing works
“Among common population polymorphisms recently associated with AD, such as those for the genes of 2-macroglobulin [12], 1-antichymotrypsin [25], angiotensin-converting enzyme (ACE) [27], methylenetetrahydrofolate reductase (MTHFR) [50,58] and others, new evidence suggests that susceptibility to AD may be associated to…”
BackgroundLiolitsa, D. (2002) · Journal of Neurology Neurosurgery & Psychiatry · doi:10.1136/jnnp.73.3.261 · Cited by 45 · see citing works
“If insulin signalling has an important role in AD pathogenesis then polymorphic variation in the normal population, underlying variation in the genes encoding components of the insulin signalling pathway and leading to the quantitative trait of relative insulin resistance, would also underlie population variation in t…”
BackgroundSelf-citationLendon, C. L., Thaker, U., Harris, J. M., McDonagh, A. M., Lambert, J., Chartier‐Harlin, M., Iwatsubo, T., Pickering-Brown, S. M., & Mann, D. M. A. (2002) · Neuroscience Letters · doi:10.1016/s0304-3940(02)00553-0 · Cited by 44 · see citing works
Endothelin-Converting Enzymes and Related Metalloproteases in Alzheimer's Disease
Pacheco‐Quinto, J., Herdt, A. R., Eckman, C. B., & Eckman, E. A. (2012) · Journal of Alzheimer s Disease · doi:10.3233/jad-2012-129043 · Cited by 44 · see citing works
“In 1999, Kehoe and colleagues first reported that the II genotype was associated with risk for Alzheimer’s disease [75], and this finding was subsequently replicated in some population, but not in others.”
- Authors
- Kehoe, P. G., Russ, C., McIlroy, S., Williams, H., Holmans, P., Holmes, C., Liolitsa, D., Vahidassr, D., Powell, J., McGleenon, B., Liddell, M., Plomin, R., Dynan, K., Williams, N., Neal, J., Cairns, N. J., Wilcock, G., Passmore, P., Lovestone, S., Williams, J., & Owen, M. J.
- Affiliations
- Cardiff University (GB)
- Queen's University Belfast (GB)
- Medical Research Council (GB)
- Frenchay Hospital (GB)
- Corresponding author
- Owen, Michael J.
- ORCID
- Venue
- Nature Genetics
- Published
- 1999-01
- Volume
- 21
- Issue
- 1
- Pages
- 71-72
- ISSN
- 1061-4036 (ISSN-L)
- 1546-1718
- DOI
- 10.1038/5009
- OpenAlex
- W2102952062
- Cited by
- 260
- References
- 14
- Citations by year
- 2026: 4 · 2025: 4 · 2024: 6 · 2023: 5 · 2022: 4 · 2021: 9 · 2020: 3 · 2019: 11 · 2018: 7 · 2017: 10 · 2016: 5 · 2015: 5 · 2014: 9 · 2013: 6 · 2012: 10
- FWCI
- 9.29
- Type
- journal article
- Language
- en
- Open access
- closed
- Licence
- www.springer.com/tdm (tdm)
- Locations
- Nature Genetics (publishedVersion)
- PubMed (publishedVersion)
- Bristol Research (University of Bristol) (publishedVersion)
- ORCA Online Research @Cardiff (Cardiff University) (submittedVersion)
- Research Portal (King's College London) (submittedVersion)
- Research Portal (Queen's University Belfast) (submittedVersion)
- Explore Bristol Research (submittedVersion)
- Topics
- Health Sciences › Medicine › Physiology › Alzheimer's disease research and treatments
- Health Sciences › Medicine › Psychiatry and Mental health › Dementia and Cognitive Impairment Research
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Genetic Associations and Epidemiology
- Keywords
- DCP1, ACE, angiotensin-converting enzyme, Alzheimer's disease, genetic susceptibility, genetic association, renin-angiotensin system
- MeSH terms
- Alleles, Alzheimer Disease, Apolipoproteins E, Cardiovascular Diseases, Genotype, Humans, Peptidyl-Dipeptidase A, Endopeptidases, Genetic Variation, Case-Control Studies, Genetic Predisposition to Disease
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
