Cited by 276Alzheimer's disease research and treatmentsDementia and Cognitive Impairment ResearchGenetic Associations and Epidemiology

The DOI matches its Crossref record; 14 of the 14 references it cites were found in a registry or an index.

Variation in DCP1, encoding ACE, is associated with susceptibility to Alzheimer disease

Kehoe, Patrick G., Russ, Carsten, McIlroy, Stephen, Williams, Hywel, Holmans, Peter, Holmes, Clive, Liolitsa, Danae, Vahidassr, Djamil, Powell, John, McGleenon, Bronagh, Liddell, Malcolm, Plomin, Robert, Dynan, Kevin, Williams, Nigel, Neal, Jim, Cairns, Nigel J., Wilcock, Gordon, Passmore, Peter, Lovestone, Simon, Williams, Julie, Owen, Michael J.·1999·Nature Genetics

DOI 10.1038/5009

Open this paper in CoChat — free account

Integrity signals

Registry

Crossref · 10.1038/5009

Cites

14 of 14 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

We couldn’t retrieve this paper’s full text, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

“Mini-mental state”
Folstein, M. F., Folstein, S. E., & McHugh, P. R. (1975) · Journal of Psychiatric Research · doi:10.1016/0022-3956(75)90026-6 · Cited by 88,282
An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels
Rigat, B., Hubert, C., Alhenc-Gelas, F., Cambien, F., Corvol, P., & Soubrier, F. (1990) · Journal of Clinical Investigation · doi:10.1172/jci114844 · Cited by 3,767
ON ESTIMATING THE RELATION BETWEEN BLOOD GROUP AND DISEASE
Woolf, B. (1955) · Annals of Human Genetics · doi:10.1111/j.1469-1809.1955.tb01348.x · Cited by 2,724
PCR detection of the insertion/deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1)
Rigat, B. A., Hübert, C., Corvol, P. L., & Soubrier, R. (1992) · Nucleic Acids Research · doi:10.1093/nar/20.6.1433-a · Cited by 1,237
Genetic associations with human longevity at the APOE and ACE loci
Schächter, F., Faure-Delanef, L., Guénot, F., Rouger, H., Froguel, P., Lesueur-Ginot, L., & Cohen, D. (1994) · Nature Genetics · doi:10.1038/ng0194-29 · Cited by 1,095
Apolipoprotein E genotyping by one-stage PCR
Wenham, P. R., Price, W. H., & Blundell, G. (1991) · The Lancet · doi:10.1016/0140-6736(91)92823-k · Cited by 1,070
A Prospective Evaluation of an Angiotensin-Converting–Enzyme Gene Polymorphism and the Risk of Ischemic Heart Disease
Lindpaintner, K., Pfeffer, M. A., Kreutz, R. H., Stampfer, M. J., Grodstein, F., Lamotte, F., Buring, J. E., & Hennekens, C. H. (1995) · New England Journal of Medicine · doi:10.1056/nejm199503163321103 · Cited by 899
Angiotensin-converting enzyme: new concepts concerning its biological role.
Ehlers, M., & Riordan, J. (1989) · Biochemistry · doi:10.1021/bi00439a001 · Cited by 395
Genetic susceptibility to Alzheimer disease
Pericak‐Vance, M. A., & Haines, J. L. (1995) · Trends in Genetics · doi:10.1016/s0168-9525(00)89161-1 · Cited by 126
Attenuation of scopolamine-induced spatial learning impairments by an angiotensin IV analog
Pederson, E. S., Harding, J. W., & Wright, J. W. (1998) · Regulatory Peptides · doi:10.1016/s0167-0115(98)00028-7 · Cited by 103

Show all 14 references

Research works printed but not linked: 1

McIlroy, S.P. et al. Am. J. Med. Genet. (in press).

Sorted by citations

Genetic meta-analysis of diagnosed Alzheimer’s disease identifies new risk loci and implicates Aβ, tau, immunity and lipid processing
Alzheimer Disease Genetics Consortium (ADGC), Kunkle, B. W., The European Alzheimer’s Disease Initiative (EADI), Cohorts for Heart and Aging Research in Genomic Epidemiology Consortium (CHARGE), Genetic and Environmental Risk in AD/Defining Genetic, P. A. E. R. F. A. D. C. (., Grenier-Boley, B., Sims, R., Bis, J. C., Damotte, V., Naj, A. C., et al. (2019) · Nature Genetics · doi:10.1038/s41588-019-0358-2 · Cited by 2,946
Self-citation
The Genetics of Alzheimer Disease: Back to the Future
Bertram, L., Lill, C. M., & Tanzi, R. E. (2010) · Neuron · doi:10.1016/j.neuron.2010.10.013 · Cited by 834
The Genetics of Alzheimer's Disease
Bertram, L., & Tanzi, R. E. (2012) · Progress in molecular biology and translational science · doi:10.1016/b978-0-12-385883-2.00008-4 · Cited by 794
The genetics of Alzheimer disease
Tanzi, R. E. (2012) · Cold Spring Harbor Perspectives in Medicine · doi:10.1101/cshperspect.a006296 · Cited by 727
“ACE is also able to degrade Ab in vitro (Hu et al. 2001; Hemming et al. 2005).”
Background
Thirty years of Alzheimer's disease genetics: the implications of systematic meta-analyses
Bertram, L., & Tanzi, R. E. (2008) · Nature Reviews Neuroscience · doi:10.1038/nrn2494 · Cited by 747
Amyloid cascade hypothesis: Pathogenesis and therapeutic strategies in Alzheimer's disease
Barage, S. H., & Sonawane, K. D. (2015) · Neuropeptides · doi:10.1016/j.npep.2015.06.008 · Cited by 579
“of Angiotensin II has been implicated in AD (Kehoe et al., 1999).”
The role of cerebral ischemia in Alzheimer’s disease
Kalaria, R. N. (2000) · Neurobiology of Aging · doi:10.1016/s0197-4580(00)00125-1 · Cited by 526
The molecular bases of Alzheimer’s disease and other neurodegenerative disorders
Maccioni, R. B., Muñoz, J. P., & Barbeito, L. (2001) · Archives of Medical Research · doi:10.1016/s0188-4409(01)00316-2 · Cited by 474
SYMPOSIUM: Clearance of Aβ from the Brain in Alzheimer's Disease: Aβ‐Degrading Enzymes in Alzheimer's Disease
Miners, J. S., Baig, S., Palmer, J. C., Palmer, L. E., Kehoe, P. G., & Love, S. (2008) · Brain Pathology · doi:10.1111/j.1750-3639.2008.00132.x · Cited by 393
Self-citation
Angiotensin-converting Enzyme Degrades Alzheimer Amyloid β-Peptide (Aβ); Retards Aβ Aggregation, Deposition, Fibril Formation; and Inhibits Cytotoxicity*
Hu, J.-G., Igarashi, A., Kamata, M., & Nakagawa, H. (2001) · Journal of Biological Chemistry · doi:10.1074/jbc.m104068200 · Cited by 307
ACE polymorphisms.
Sayed-Tabatabaei, F., Oostra, B., Isaacs, A., van Duijn, C. V., & Witteman, J. (2006) · Circulation Research · doi:10.1161/01.res.0000223145.74217.e7 · Cited by 306
Amyloid β-Protein Is Degraded by Cellular Angiotensin-converting Enzyme (ACE) and Elevated by an ACE Inhibitor*
Hemming, M. L., & Selkoe, D. (2005) · Journal of Biological Chemistry · doi:10.1074/jbc.m508460200 · Cited by 344
Causative and susceptibility genes for Alzheimer’s disease: a review
Rocchi, A., Pellegrini, S., Siciliano, G., & Murri, L. (2003) · Brain Research Bulletin · doi:10.1016/s0361-9230(03)00067-4 · Cited by 326
Clearance of cerebral Aβ in Alzheimer’s disease: reassessing the role of microglia and monocytes
Zuroff, L. R., Daley, D. A., Black, K. L., & Koronyo‐Hamaoui, M. (2017) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-017-2463-7 · Cited by 292
Demonstrating the case that AD is a vascular disease: epidemiologic evidence
Launer, L. J. (2002) · Ageing Research Reviews · doi:10.1016/s0047-6374(01)00364-5 · Cited by 231
Cortical alterations of angiotensin converting enzyme, angiotensin II and AT1 receptor in Alzheimer's dementia.
Savaskan, E., Hock, C., Olivieri, G., Bruttel, S., Rosenberg, C., Hulette, C., & Muller-Spahn, F. (2001) · Neurobiology of Aging · doi:10.1016/s0197-4580(00)00259-1 · Cited by 220
Molecular genetics of Alzheimer's disease: An update
Brouwers, N., Sleegers, K., & Broeckhoven, C. V. (2008) · Annals of Medicine · doi:10.1080/07853890802186905 · Cited by 213
“In candidate-gene-based studies re- searchers have focused on genes encoding function- ally relevant proteins, e.g. proteins that belong to the g-secretase complex (for example PSEN1 (185,225, 245) or NCSTN (225,246)), regulate APP traffick- ing (SORL1 (247,248)), or are involved in fibrillization or clearance of the…”
Background
Genotype-Phenotype Relationships for the Renin-Angiotensin-Aldosterone System in a Normal Population
Paillard, F., Chansel, D., Brand, E., Bénétos, A., Thomas, F., Czekałski, S., Ardaillou, R., & Soubrier, F. (1999) · Hypertension · doi:10.1161/01.hyp.34.3.423 · Cited by 206
Angiotensin-converting enzyme 2 is reduced in Alzheimer’s disease in association with increasing amyloid-β and tau pathology
Kehoe, P. G., Wong, S., AL Mulhim, N., Palmer, L. E., & Miners, J. S. (2016) · Alzheimer's Research & Therapy · doi:10.1186/s13195-016-0217-7 · Cited by 203
“(rs1799752) is a genetic risk factor for sporadic AD [17].”
BackgroundInfluentialSelf-citation
Large Meta-Analysis Establishes the ACE Insertion-Deletion Polymorphism as a Marker of Alzheimer's Disease
Lehmann, D. J., Cortina-Borja, M., Warden, D. R., Smith, A. D., Sleegers, K., Prince, J. A., van Duijn, C. M., & Kehoe, P. G. (2005) · American Journal of Epidemiology · doi:10.1093/aje/kwi202 · Cited by 199
“(1) Cardiff, Wales 198 77 NINCDS-ADRDA probable”
BackgroundMethodResultInfluentialSelf-citation
No association between the angiotensin-converting enzyme ID polymorphism and elite endurance athlete status
Rankinen, T., Wolfarth, B., Simoneau, J., Maier-Lenz, D., Rauramaa, R., Rivera, M. A., Boulay, M. R., Chagnon, Y. C., Përusse, L., Keul, J., et al. (2000) · Journal of Applied Physiology · doi:10.1152/jappl.2000.88.5.1571 · Cited by 188
“Moreover, the reports showing that, unlike one would assume, the D allele and DD genotype were more common in centenarians (38) and were associated with a lower risk of Alzheimer’s disease (15) further add to the confusion.”
Are amyloid-degrading enzymes viable therapeutic targets in Alzheimer’s disease?
Nalivaeva, N. N., Beckett, C., Belyaev, N. D., & Turner, A. J. (2012) · Journal of Neurochemistry · doi:10.1111/j.1471-4159.2011.07510.x · Cited by 169
Angiotensin-Converting Enzyme Converts Amyloid β-Protein 1–42 (Aβ 1–42 ) to Aβ 1–40 , and Its Inhibition Enhances Brain Aβ Deposition
Zou, K., Yamaguchi, H., Akatsu, H., Sakamoto, T., Ko, M.-H., Mizoguchi, K., Gong, J.-S., Yu, W., Yamamoto, T., Kosaka, K., et al. (2007) · Journal of Neuroscience · doi:10.1523/jneurosci.1549-07.2007 · Cited by 193
“Numerous studies have shown that the I allele of ACE D/I polymorphism is associated with an increased risk of late-onset AD (Hu et al., 1999; Kehoe et al., 1999; Elkins et al., 2004; Lehmann et al., 2005) and that I polymorphism is associated with a decreased serum ACE level (Rigat et al., 1990).”
Background
β ‐Amyloid Degradation and Alzheimer′s Disease
Wang, D.-S., Dickson, D. W., & Malter, J. S. (2006) · BioMed Research International · doi:10.1155/jbb/2006/58406 · Cited by 195
“Patients at higher AD risk had an insertion (I) polymorphism within intron 16 of the ACE gene, which was associated with AD [121].”
Background
Is inhibition of the renin–angiotensin system a new treatment option for Alzheimer's disease?
Kehoe, P. G., & Wilcock, G. K. (2007) · The Lancet Neurology · doi:10.1016/s1474-4422(07)70077-7 · Cited by 183
Self-citation
Targeting amyloid clearance in Alzheimer's disease as a therapeutic strategy
Nalivaeva, N. N., & Turner, A. J. (2019) · British Journal of Pharmacology · doi:10.1111/bph.14593 · Cited by 177
“reports that a common polymorphism in the ACE gene was associated with sporadic cases of AD (Kehoe et al., 1999).”
Background
Angiotensin‐converting enzyme (ACE) levels and activity in Alzheimer's disease, and relationship of perivascular ACE‐1 to cerebral amyloid angiopathy
Miners, J., Ashby, E. L., van Helmond, Z., Chalmers, K., Palmer, L., Love, S., & Kehoe, P. (2008) · Neuropathology and Applied Neurobiology · doi:10.1111/j.1365-2990.2007.00885.x · Cited by 170
Self-citation
Angiotensins in Alzheimer's disease – friend or foe?
Kehoe, P. G., Miners, J. S., & Love, S. (2009) · Trends in Neurosciences · doi:10.1016/j.tins.2009.07.006 · Cited by 164
Self-citation
Decreased Expression and Activity of Neprilysin in Alzheimer Disease Are Associated With Cerebral Amyloid Angiopathy
Miners, J. S., Helmond, Z. V., Chalmers, K. A., Wilcock, G. K., Love, S., & Kehoe, P. G. (2006) · Journal of Neuropathology & Experimental Neurology · doi:10.1097/01.jnen.0000240463.87886.9a · Cited by 156
Self-citation
Chapter 5 Biomarkers Related To Aging In Human Populations
Crimmins, E. M., Vasunilashorn, S. M., Kim, J. K., & Alley, D. E. (2008) · Advances in clinical chemistry · doi:10.1016/s0065-2423(08)00405-8 · Cited by 159
Lack of replication of association findings in complex disease: an analysis of 15 polymorphisms in prior candidate genes for sporadic Alzheimer's disease
Prince, J. A., Feuk, L., Sawyer, S. L., Gottfries, J., Ricksten, A., Nägga, K., Bogdanović, N., Blennow, K., & Brookes, A. J. (2001) · European Journal of Human Genetics · doi:10.1038/sj.ejhg.5200651 · Cited by 141
“Probe 1 GCATGGACGGCTCAG Probe 2 GCATGGATGGCTCAG DCP1 SNP000006569 Forward CAGATCTGACGAATGTTATGGC (Kehoe et al., 1999): Found in late-onset AD.”
Background
SARS-CoV-2 infections and COVID-19 mortalities strongly correlate with ACE1 I/D genotype
Yamamoto, N., Ariumi, Y., Nishida, N., Yamamoto, R., Bauer, G., Gojobori, T., Shimotohno, K., & Mizokami, M. (2020) · Gene · doi:10.1016/j.gene.2020.144944 · Cited by 141
The Coming of Age of the Angiotensin Hypothesis in Alzheimer’s Disease: Progress Toward Disease Prevention and Treatment?
Kehoe, P. G. (2018) · Journal of Alzheimer’s Disease · doi:10.3233/jad-171119 · Cited by 133
“We observed a statistically significant and consistent increase in ACE (I) allele bearing genotypes and increased risk of AD, in three independent case-control cohorts, that was independent of any APOE associated risk [34].”
BackgroundSelf-citation
Genetic variants ofABCA1 modify Alzheimer disease risk and quantitative traits related to ?-amyloid metabolism
Katzov, H., Chalmers, K. A., Palmgren, J., Andreasen, N., Johansson, B. E. A., Cairns, N. J., Gatz, M., Wilcock, G. K., Love, S., Pedersen, N. L., et al. (2004) · Human Mutation · doi:10.1002/humu.20012 · Cited by 128
“Two genes have been reproducibly shown to influence risk for the sporadic form of AD, these encoding apolipoprotein E (APOE; MIM# 107741) and angiotensin I converting enzyme (ACE; MIM# 106180) [Strittmatter et al., 1993; Kehoe et al., 1999b; Kehoe et al., 2003].”
BackgroundSelf-citation
Haplotypes extending across ACE are associated with Alzheimer's disease
Kehoe, P. G. (2003) · Human Molecular Genetics · doi:10.1093/hmg/ddg094 · Cited by 120
Self-citation
The ACE gene and Alzheimer's disease susceptibility
Narain, Y., Yip, A., Murphy, T., Brayne, C., Easton, D., Evans, J. G., Xuereb, J., Cairns, N., Esiri, M., Furlong, R., et al. (2000) · Journal of Medical Genetics · doi:10.1136/jmg.37.9.695 · Cited by 121
Self-citation
Neuropsychological Profile of a Large Kindred with Familial Alzheimer's Disease Caused by the E280A Single Presenilin-1 Mutation
Ardila, A., Lopera, F., Rosselli, M., Moreno, S., Madrigal, L., Arango-Lasprilla, J. C., Arcos, M., Murcia, C., Arango-Viana, J. C., Ossa, J., et al. (2000) · Archives of Clinical Neuropsychology · doi:10.1093/arclin/15.6.515 · Cited by 113
“Differences in the age of onset in the very same family carrying the very same mutation indicates that there are some other nongenetic and/or other genetic factors capable to modify the onset of the disease (Corder et al., 1993; Kehoe et al., 1999; Liao et al., 1998).”
Pharmacogenomics in Alzheimer's Disease
Cacabelos, R. (2008) · Methods in molecular biology · doi:10.1007/978-1-59745-205-2_10 · Cited by 109
A polymorphism in the cystatin C gene is a novel risk factor for late-onset Alzheimer’s disease
Crawford, F., Freeman, M. J., Schinka, J. A., Abdullah, L. I., Gold, M., Hartman, R. D., Krivian, K., Morris, M. D., Richards, D., Duara, R., et al. (2000) · Neurology · doi:10.1212/wnl.55.6.763 · Cited by 109
Senescence-associated phenotypes in Akita diabetic mice are enhanced by absence of bradykinin B2 receptors
Kakoki, M. (2006) · Journal of Clinical Investigation · doi:10.1172/jci26958 · Cited by 107
“Introduction Genetically determined higher levels of angiotensin-converting enzyme (ACE), which do not significantly affect blood pressure or angiotensin II and aldosterone levels (1), have been correlated in several studies with an increased risk of a broad and overlapping constellation of diseases, including diabeti…”
Background
Alzheimer disease risk and genetic variation in ACE
Elkins, J. S., Douglas, V. C., & Johnston, S. C. (2004) · Neurology · doi:10.1212/01.wnl.0000106823.72493.ff · Cited by 108
“1999 (17) UK 209 198 76 77 C 57 52 P 0.”
Angiotensin converting enzyme and endothelial nitric oxide synthase DNA polymorphisms and late onset Alzheimer's disease
Álvarez, R., Álvarez, V., Lahoz, C. H., Martinez, C., Pena, J., Sanchez, J. M., Guisasola, L. M., Salas‐Puig, J., Morís, G., Vidal, J. A. C., et al. (1999) · Journal of Neurology Neurosurgery & Psychiatry · doi:10.1136/jnnp.67.6.733 · Cited by 98
“In accordance with a role for the renin-angiotensin system in Alzheimer's disease, the ACE-I allele has been associated with an increased risk of developing late onset Alzheimer's disease.”
Background
Multiple cellular and molecular mechanisms Are involved in human Aβ clearance by transplanted adult astrocytes
Pihlaja, R., Koistinaho, J., Kauppinen, R., Sandholm, J., Tanila, H., & Koistinaho, M. (2011) · Glia · doi:10.1002/glia.21212 · Cited by 96
“Some previous studies suggest that polymorphism of ACE gene might be involved in the development of AD (Kehoe et al., 1999).”
Background
Association Between Angiotensin-Converting Enzyme and Alzheimer Disease
Farrer, L. A., Sherbatich, T., Keryanov, S. A., Коровайцева, Г. И., Rogaeva, E. A., Petruk, S., Premkumar, S., Moliaka, Y., Song, Y., Pei, Y., et al. (2000) · Archives of Neurology · doi:10.1001/archneur.57.2.210 · Cited by 94
Activity‐Regulated Cytoskeleton‐Associated Protein in Rodent Brain is Down‐Regulated by High Fat Diet in vivo and by 27‐Hydroxycholesterol in vitro
Mateos, L., Akterin, S., Gil-Bea, F. J., Spulber, S. D., Rahman, A., Björkhem, I., Schultzberg, M., Flores‐Morales, A., & Cedazo-Mı́nguez, Á. (2008) · Brain Pathology · doi:10.1111/j.1750-3639.2008.00174.x · Cited by 92
“In addition, we decided to analyze by RT-PCR the expression of the angiotensin-converting enzyme (Ace), a molecule of reported importance in AD (2, 4, 21), which values were very close to the criteria for significance in the microarray analysis (Fold change 1.”
BackgroundMethod
Genetic susceptibility factors for Alzheimer's disease
Richard, F., & Amouyel, P. (2001) · European Journal of Pharmacology · doi:10.1016/s0014-2999(00)00903-1 · Cited by 92
The effects of commonly prescribed drugs in patients with Alzheimer's disease on the rate of deterioration
Ellul, J., Archer, N. J., Foy, C. M. L., Poppe, M., Boothby, H., Nicholas, H., Brown, R. G., & Lovestone, S. (2006) · Journal of Neurology Neurosurgery & Psychiatry · doi:10.1136/jnnp.2006.104034 · Cited by 91
Self-citation
Effects of centrally acting ACE inhibitors on the rate of cognitive decline in dementia
Gao, Y., Ó’Caoimh, R., Healy, L. O., Kerins, D. M., Eustace, J. A., Guyatt, G. H., Sammon, D., & Molloy, D. W. (2013) · BMJ Open · doi:10.1136/bmjopen-2013-002881 · Cited by 89
Soluble adhesion molecules and angiotensin-converting enzyme in dementia
Nielsen, H. M., Londos, E., Minthon, L., & Janciauskiene, S. M. (2007) · Neurobiology of Disease · doi:10.1016/j.nbd.2006.11.011 · Cited by 80
Investigation of association of 13 polymorphisms in eight genes in southeastern African American Alzheimer disease patients as compared to age‐matched controls
Perry, R. T., Collins, J. S., Harrell, L. E., Acton, R. T., & Go, R. C. P. (2001) · American Journal of Medical Genetics · doi:10.1002/ajmg.1371 · Cited by 81
Psychiatric genetics: back to the future
Owen, M. J., Cardno, A. G., & O’Donovan, M. C. (2000) · Molecular Psychiatry · doi:10.1038/sj.mp.4000702 · Cited by 82
Self-citation
Effects of Centrally Acting Angiotensin Converting Enzyme Inhibitors on Functional Decline in Patients with Alzheimer's Disease
Ó’Caoimh, R., Healy, L. O., Gao, Y., Svendrovski, A., Kerins, D. M., Eustace, J. A., Kehoe, P. G., Guyatt, G. H., & Molloy, D. W. (2014) · Journal of Alzheimer s Disease · doi:10.3233/jad-131694 · Cited by 82
“ACE gene polymorphisms are associated with increased risk of AD [24, 25]: alleles putatively associated with AD are also associated with low levels of plasma ACE [26, 27].”
BackgroundSelf-citation
Phosphorylation of Amyloid-β Peptide at Serine 8 Attenuates Its Clearance via Insulin-degrading and Angiotensin-converting Enzymes
Kumar, S., Singh, S., Hinze, D., Josten, M., Sahl, H., Siepmann, M., & Walter, J. (2012) · Journal of Biological Chemistry · doi:10.1074/jbc.m111.279133 · Cited by 77
Aβ42-to-Aβ40- and Angiotensin-converting Activities in Different Domains of Angiotensin-converting Enzyme
Zou, K., Maeda, T., Watanabe, A., Liu, J., Liu, S., Oba, R., Satoh, Y.-I., Komano, H., & Michikawa, M. (2009) · Journal of Biological Chemistry · doi:10.1074/jbc.m109.011437 · Cited by 81
Insights into the pathogenesis and pathogenicity of cerebral amyloid angiopathy
Love, S. (2009) · Frontiers in bioscience · doi:10.2741/3567 · Cited by 78
Genetic risk of Alzheimer's disease: advising relatives
Liddell, M. B., Lovestone, S., & Owen, M. J. (2001) · The British Journal of Psychiatry · doi:10.1192/bjp.178.1.7 · Cited by 75
Self-citation
Angiotensin-converting enzyme genotype is associated with Alzheimer disease in the Japanese population
Hu, J., Miyatake, F., Aizu, Y., Nakagawa, H., Nakamura, S., Tamaoka, A., Takahash, R., Urakami, K., & Shoji, M. (1999) · Neuroscience Letters · doi:10.1016/s0304-3940(99)00827-7 · Cited by 74
The N-domain of angiotensin-converting enzyme specifically hydrolyzes the Arg-5-His-6 bond of Alzheimer's Abeta-(1-16) peptide and its isoAsp-7 analogue with different efficiency as evidenced by quantitative matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.
Toropygin, I., Kugaevskaya, E. V., Mirgorodskaya, O., Elisseeva, Y. E., Kozmin, Y., Popov, I., Nikolaev, E., Makarov, A., & Kozin, S. (2008) · Rapid Communications in Mass Spectrometry · doi:10.1002/rcm.3357 · Cited by 61
Peripherally derived angiotensin converting enzyme-enhanced macrophages alleviate Alzheimer-related disease
Koronyo‐Hamaoui, M., Sheyn, J., Hayden, E. Y., Li, S., Fuchs, D.-T. S., Regis, G. C., Lopes, D. H. J., Black, K. L., Bernstein, K. E., Teplow, D. B., et al. (2019) · Brain · doi:10.1093/brain/awz364 · Cited by 75
“Importantly, individuals carrying variants of the ACE gene (D/D alleles) resulting in increased plasma expression of the enzyme were associated with lower risk for Alzheimer’s disease (Kehoe et al., 1999; Lehmann et al., 2005).”
Background
The geographic distribution of the ACE II genotype: a novel finding.
Saab, Y., Gard, P. R., & Overall, A. (2007) · Genetical research · doi:10.1017/s0016672307009019 · Cited by 67
A transcriptome-wide association study of Alzheimer’s disease using prediction models of relevant tissues identifies novel candidate susceptibility genes
Sun, Y., Zhu, J., Zhou, D., Canchi, S., Wu, C., Cox, N. J., Rissman, R. A., Gamazon, E. R., & Wu, L. (2021) · Genome Medicine · doi:10.1186/s13073-021-00959-y · Cited by 70
“ACE, which encodes angiotensin I converting enzyme, is a known gene for AD [41, 42].”
Background
Risk factors for dementia
McCullagh, C. D., Craig, D. W., McIlroy, S. P., & Passmore, A. P. (2001) · Advances in Psychiatric Treatment · doi:10.1192/apt.7.1.24 · Cited by 74
Self-citation
ACE I/D polymorphism is a risk factor of Alzheimer's disease but not of vascular dementia
Kölsch, H., Jessen, F., Freymann, N., Kreis, M., Hentschel, F., Maier, W., & Heun, R. (2004) · Neuroscience Letters · doi:10.1016/j.neulet.2004.11.062 · Cited by 69
Angiotensin-converting Enzyme, Sleep-disordered Breathing, and Hypertension
Lin, L., Finn, L. A., Zhang, J., Young, T. B., & Mignot, E. J.-M. (2004) · American Journal of Respiratory and Critical Care Medicine · doi:10.1164/rccm.200405-616oc · Cited by 68
The Renin Angiotensin System and Alzheimer's Disease
Amouyel, P., RICHARD, F., Berr, C., David-Fromentin, I., & Helbecque, N. (2000) · Annals of the New York Academy of Sciences · doi:10.1111/j.1749-6632.2000.tb06395.x · Cited by 68
Angiotensin I converting enzyme (ACE) gene polymorphism in centenarians: Different allele frequencies between the North and South of Europe
Panza, F. (2003) · Experimental Gerontology · doi:10.1016/s0531-5565(03)00154-2 · Cited by 65
Angiotensin I-Converting Enzyme (ACE) Gene Polymorphism in Relation to Physical Performance, Cognition and Survival—A Follow-up Study of Elderly Danish Twins
Frederiksen, H., Gaist, D., Bathum, L., Andersen, K., McGue, M. K., Vaupel, J. W., & Christensen, K. (2003) · Annals of Epidemiology · doi:10.1016/s1047-2797(02)00254-5 · Cited by 62
“An increased risk of AD was associated with the I allele in one study (7), but the D allele in another (8).”
BackgroundResult
ACE gene is associated with Alzheimer's disease and atrophy of hippocampus and amygdala
Sleegers, K., den Heijer, T., van Dijk, E. J., Albert Hofman, D., Bertoli‐Avella, A. M., Koudstaal, P. J., Breteler, M. M. B., & van Duijn, C. M. (2004) · Neurobiology of Aging · doi:10.1016/j.neurobiolaging.2004.09.011 · Cited by 60
Methylenetetrahydrofolate reductase and angiotensin converting enzyme gene polymorphisms in two genetically and diagnostically distinct cohort of Alzheimer patients.
Seripa, D., Forno, G. D., Matera, M. G., Gravina, C., Margaglione, M., Palermo, M., Wekstein, D., Antuono, P., Davis, D., Daniele, A., et al. (2003) · Neurobiology of Aging · doi:10.1016/s0197-4580(03)00040-x · Cited by 61
“A few large studies on Caucasian found an association between the I allele and increased susceptibility to AD [1,23,34].”
Background
Vascular risk and genetics of sporadic late-onset Alzheimer’s disease
Panza, F., D’Introno, A., Colacicco, A. M., Basile, A. M., Capurso, C. A., Kehoe, P. G., Capurso, C. A., & Solfrizzi, V. (2003) · Journal of Neural Transmission · doi:10.1007/s00702-003-0071-1 · Cited by 60
Self-citation
The angiotensin AT 4 receptor subtype as a target for the treatment of memory dysfunction associated with Alzheimer's disease
Wright, J. W., & Harding, J. W. (2008) · Journal of the Renin-Angiotensin-Aldosterone System · doi:10.1177/1470320308099084 · Cited by 62
Genetics and Underlying Pathology of Dementia
Ferencz, B., & Gerritsen, L. (2015) · Neuropsychology Review · doi:10.1007/s11065-014-9276-3 · Cited by 58
Pharmacogenomics of neurodegenerative diseases
Maimone, D., Dominici, R., & Grimaldi, L. M. E. (2001) · European Journal of Pharmacology · doi:10.1016/s0014-2999(00)00939-0 · Cited by 56
Renin Angiotensin System in Cognitive Function and Dementia
Bodiga, V. L., & Bodiga, S. (2013) · Asian Journal of Neuroscience · doi:10.1155/2013/102602 · Cited by 57
“A potential relation between ACE and AD was first suggested by human genetic studies, which reported that an insertion/deletion polymorphismwithin intron 16 of theACE gene is associated with AD [186].”
Background
A clinical dose of angiotensin-converting enzyme (ACE) inhibitor and heterozygous ACE deletion exacerbate Alzheimer's disease pathology in mice
Liu, S., Ando, F., Fujita, Y., Liu, J., Maeda, T., Shen, X., Kikuchi, K., Matsumoto, A., Yokomori, M., Tanabe, C., et al. (2019) · Journal of Biological Chemistry · doi:10.1074/jbc.ra118.006420 · Cited by 58
“Abeta(1-40), and its inhibition enhances brain Abeta deposition.”
BackgroundMethodInfluential
Novel modulators of amyloid‐β precursor protein processing
Tang, B. L., & Liou, Y. C. (2006) · Journal of Neurochemistry · doi:10.1111/j.1471-4159.2006.04215.x · Cited by 57
Gender-specific association of the angiotensin converting enzyme gene with Alzheimer's disease
Crawford, F., Abdullah, L. I., Schinka, J. A., Suo, Z., Gold, M., Duara, R., & Mullan, M. (2000) · Neuroscience Letters · doi:10.1016/s0304-3940(00)00791-6 · Cited by 57
Potential Enzymatic Targets in Alzheimer’s: A Comprehensive Review
Alam, J., & Sharma, L. K. (2018) · Current Drug Targets · doi:10.2174/1389450119666180820104723 · Cited by 56
Angiotensinogen and angiotensin converting enzyme gene polymorphisms and the risk of bipolar affective disorder in humans
Meira‐Lima, I., Pereira, A. C., da Mota, G. D. F. A., Krieger, J. E., & Vallada, H. (2000) · Neuroscience Letters · doi:10.1016/s0304-3940(00)01512-3 · Cited by 56
Angiotensin-I converting enzyme (ACE): structure, biological roles, and molecular basis for chloride ion dependence
Masuyer, G., Yates, C. J., Sturrock, E. D., & Acharya, K. R. (2014) · Biological Chemistry · doi:10.1515/hsz-2014-0157 · Cited by 55
Risk and protective factors for sporadic Alzheimer's disease.
Stožická, Z., Žilka, N., & Novák, M. (2007) · PubMed · Cited by 55
Antihypertensive drugs and brain function: mechanisms underlying therapeutically beneficial and harmful neuropsychiatric effects
Carnovale, C., Perrotta, C., Baldelli, S., Cattaneo, D., Montrasio, C., Barbieri, S. S., Pompilio, G., Vantaggiato, C., Clementi, E., & Pozzi, M. (2022) · Cardiovascular Research · doi:10.1093/cvr/cvac110 · Cited by 62
“Beside major depressive disorder, SNPs within the ACE gene were also significantly associated with acute stress response and higher mortality following a major trauma.273,280,281 In particular, the rs4311 SNP within the ACE gene, that has been associated with the panic attack syndrome, might be a functional polymorphi…”
Background
Real-time PCR for rapid genotyping of angiotensin-converting enzyme insertion/deletion polymorphism
Lin, M., Tseng, C., Tseng, C., Huang, C., Chong, C., & Tseng, C. (2001) · Clinical Biochemistry · doi:10.1016/s0009-9120(01)00281-8 · Cited by 53
Human gene polymorphisms and their possible impact on the clinical outcome of SARS-CoV-2 infection
Hashemi, S. M. A., Thijssen, M., Hosseini, S. Y., Tabarraei, A., Pourkarim, M. R., & Sarvari, J. (2021) · Archives of Virology · doi:10.1007/s00705-021-05070-6 · Cited by 56
DNA methylation in neurodegenerative disorders: a missing link between genome and environment?
Iraola‐Guzmán, S., Estivill, X., & Rabionet, R. (2011) · Clinical Genetics · doi:10.1111/j.1399-0004.2011.01673.x · Cited by 52
The renin-angiotensin system, hypertension and cognitive dysfunction in alzheimer's disease: new therapeutic potential
Takeda, S. (2007) · Frontiers in bioscience · doi:10.2741/2839 · Cited by 51
“Some studies showed that the frequency of the ACE-I allele was significantly increased in patients with AD, but others yielded conflicting results (116, 117, 118, 119, 120, 121, 122, 123, 124).”
Result
Renin-Angiotensin System and Alzheimer’s Disease Pathophysiology: From the Potential Interactions to Therapeutic Perspectives
Ribeiro, V. T., de Souza, L. C., & Silva, A. C. S. E. (2019) · Protein and Peptide Letters · doi:10.2174/0929866527666191230103739 · Cited by 50
Dipeptidyl carboxypeptidase 1 (DCP1) and butyrylcholinesterase (BCHE) gene interactions with the apolipoprotein E ε4 allele as risk factors in Alzheimer's disease and in Parkinson's disease with coexisting Alzheimer pathology
Mattila, K. M., Rinne, J. O., Röyttä, M., Laippala, P., Pietilä, T., Kalimo, H., Koivula, T., Frey, H., & Lehtimäki, T. J. (2000) · Journal of Medical Genetics · doi:10.1136/jmg.37.10.766 · Cited by 51
Study of the Association between Alzheimer’s Disease and Angiotensin-Converting Enzyme Gene Polymorphism Using DNA from Lymphocytes
Cheng, C., Hong, C., Liu, H.-C., Liu, T., & Tsai, S. (2002) · European Neurology · doi:10.1159/000047943 · Cited by 50
“These findings suggest that the ACE gene may be a candidate for susceptibility to AD. A recent report by Kehoe et al. [”
Background
The ACE I allele is associated with increased risk for ruptured intracranial aneurysms
Keramatipour, M., McConnell, R. S., Kirkpatrick, P., Tebbs, S., Furlong, R. A., & Rubinsztein, D. C. (2000) · Journal of Medical Genetics · doi:10.1136/jmg.37.7.498 · Cited by 50
“Recently, the I allele has been associated with risk for Alzheimer's disease,”
Background
Genetics of menopause-associated diseases
Massart, F., Reginster, J., & Brandi, M. L. (2001) · Maturitas · doi:10.1016/s0378-5122(01)00283-3 · Cited by 53
Cardiovascular risk factors and Alzheimer's disease: a genetic association study in a population aged 85 or over
Myllykangas, L., Polvikoski, T. M., Sulkava, R. O., Verkkoniemi, A., Tienari, P. J., Niinistö, L., Kontula, K., Hardy, J., Haltia, M., & Pérez‐Tur, J. (2000) · Neuroscience Letters · doi:10.1016/s0304-3940(00)01467-1 · Cited by 50
A cladistic model of ACE sequence variation with implications for myocardial infarction, Alzheimer disease and obesity
Katzov, H., Bennet, A. M., Kehoe, P. G., Wiman, B., Gatz, M., Blennow, K., Lenhard, B., Pedersen, N. L., Fairé, U. D., & Prince, J. A. (2004) · Human Molecular Genetics · doi:10.1093/hmg/ddh286 · Cited by 48
“We further show that the models employed to demonstrate effects upon obesity also efficiently capture effects upon MI and AD, two diseases that have long been posited to be associated with ACE (45,47).”
MethodSelf-citation
Evaluation of the roles of common genetic mutations in leukoaraiosis
Szolnoki, Z., Somogyvári, F., Kondacs, A., Szabó, M., & Fodor, L. (2001) · Acta Neurologica Scandinavica · doi:10.1034/j.1600-0404.2001.00355.x · Cited by 49
“The distribution of ACE I/D polymorphism has been reported to influence the susceptibility to AD (29).”
Background
Candidate Gene Association Studies in Sporadic Alzheimer’s Disease
Combarros, O., Alvarez-Arcaya, A., Sánchez-Guerra, M., Infante, J., & Berciano, J. (2002) · Dementia and Geriatric Cognitive Disorders · doi:10.1159/000058332 · Cited by 48
Apolipoprotein E, angiotensin-converting enzyme and kallikrein gene polymorphisms and the risk of Alzheimer’s disease and vascular dementia
Wang, H., Fung, H., Hsu, W.-W., Wu, Y., Lin, J., Ro, L. ‐., Chang, K. H., Hwu, F. J., Hsu, Y., Huang, S.-Y., et al. (2006) · Journal of Neural Transmission · doi:10.1007/s00702-005-0424-z · Cited by 46
“However, our study differs from those of the meta-analysis (Kehoe et al., 1999; Elkins et al., 2004) and previous studies on Taiwanese and Chinese populations (Yang et al., 2000; Cheng et al., 2002), in which the I allele was shown to be associated with AD.”
BackgroundResult
Genotypes and haplotypes in the IL-1 gene cluster: analysis of two genetically and diagnostically distinct groups of Alzheimer patients
Seripa, D., Matera, M. G., Forno, G. D., Gravina, C., Masullo, C., Daniele, A., Binetti, G. G., Bonvicini, C., Squitti, R., Palermo, M. T., et al. (2004) · Neurobiology of Aging · doi:10.1016/j.neurobiolaging.2004.04.001 · Cited by 45
“Among common population polymorphisms recently associated with AD, such as those for the genes of 2-macroglobulin [12], 1-antichymotrypsin [25], angiotensin-converting enzyme (ACE) [27], methylenetetrahydrofolate reductase (MTHFR) [50,58] and others, new evidence suggests that susceptibility to AD may be associated to…”
Background
Genetic variability in the insulin signalling pathway may contribute to the risk of late onset Alzheimer's disease
Liolitsa, D. (2002) · Journal of Neurology Neurosurgery & Psychiatry · doi:10.1136/jnnp.73.3.261 · Cited by 45
“If insulin signalling has an important role in AD pathogenesis then polymorphic variation in the normal population, underlying variation in the genes encoding components of the insulin signalling pathway and leading to the quantitative trait of relative insulin resistance, would also underlie population variation in t…”
BackgroundSelf-citation
The angiotensin 1-converting enzyme insertion (I)/deletion (D) polymorphism does not influence the extent of amyloid or tau pathology in patients with sporadic Alzheimer's disease
Lendon, C. L., Thaker, U., Harris, J. M., McDonagh, A. M., Lambert, J., Chartier‐Harlin, M., Iwatsubo, T., Pickering-Brown, S. M., & Mann, D. M. A. (2002) · Neuroscience Letters · doi:10.1016/s0304-3940(02)00553-0 · Cited by 44
Endothelin-Converting Enzymes and Related Metalloproteases in Alzheimer's Disease
Pacheco‐Quinto, J., Herdt, A. R., Eckman, C. B., & Eckman, E. A. (2012) · Journal of Alzheimer s Disease · doi:10.3233/jad-2012-129043 · Cited by 45
“In 1999, Kehoe and colleagues first reported that the II genotype was associated with risk for Alzheimer’s disease [75], and this finding was subsequently replicated in some population, but not in others.”

Authors: Kehoe, P. G., Russ, C., McIlroy, S., Williams, H., Holmans, P., Holmes, C., Liolitsa, D., Vahidassr, D., Powell, J., McGleenon, B., Liddell, M., Plomin, R., Dynan, K., Williams, N., Neal, J., Cairns, N. J., Wilcock, G., Passmore, P., Lovestone, S., Williams, J., & Owen, M. J.
Affiliations: Cardiff University (GB)
Queen's University Belfast (GB)
Medical Research Council (GB)
Frenchay Hospital (GB)
Corresponding author: Owen, Michael J.
ORCID: Kehoe, Patrick G.
Williams, Hywel
Holmans, Peter
Holmes, Clive
Powell, John
Plomin, Robert
Williams, Nigel
Wilcock, Gordon
Passmore, Peter
Lovestone, Simon
Williams, Julie
Owen, Michael J.
Venue: Nature Genetics
Publisher: Springer Science and Business Media LLC
Published: 1999-01
Volume: 21
Issue: 1
Pages: 71-72
ISSN: 1061-4036 (ISSN-L)
1546-1718
DOI: 10.1038/5009
OpenAlex: W2102952062
Cited by: 260
References: 14
Citations by year: 2026: 4 · 2025: 4 · 2024: 6 · 2023: 5 · 2022: 4 · 2021: 9 · 2020: 3 · 2019: 11 · 2018: 7 · 2017: 10 · 2016: 5 · 2015: 5 · 2014: 9 · 2013: 6 · 2012: 10
FWCI: 9.29
Type: journal article
Language: en
Open access: closed
Licence: www.springer.com/tdm (tdm)
Locations: Nature Genetics (publishedVersion)
PubMed (publishedVersion)
Bristol Research (University of Bristol) (publishedVersion)
ORCA Online Research @Cardiff (Cardiff University) (submittedVersion)
Research Portal (King's College London) (submittedVersion)
Research Portal (Queen's University Belfast) (submittedVersion)
Explore Bristol Research (submittedVersion)
Topics: Life Sciences › Neuroscience › Cellular and Molecular Neuroscience › Alzheimer's disease research and treatments
Health Sciences › Medicine › Psychiatry and Mental health › Dementia and Cognitive Impairment Research
Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Genetic Associations and Epidemiology
Keywords: DCP1, ACE, angiotensin-converting enzyme, Alzheimer's disease, genetic susceptibility, genetic association, renin-angiotensin system
MeSH terms: Alleles, Alzheimer Disease, Apolipoproteins E, Cardiovascular Diseases, Genotype, Humans, Peptidyl-Dipeptidase A, Endopeptidases, Genetic Variation, Case-Control Studies, Genetic Predisposition to Disease

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Variation in DCP1, encoding ACE, is associated with susceptibility to Alzheimer disease

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Citations

Cites

Cited by

Related

Metadata

Record

About these checks