Cited by 541CRISPR and Genetic EngineeringPlant tissue culture and regenerationPlant Molecular Biology Research

The DOI matches its Crossref record; 27 of the 27 references it cites were found in a registry or an index.

Plant gene editing through de novo induction of meristems

Open access

Maher, Michael F., Nasti, Ryan A., Vollbrecht, Macy, Starker, Colby G., Clark, Matthew D., Voytas, Daniel F.·2020·Nature Biotechnology

DOI 10.1038/s41587-019-0337-2PMC PMC6954279

Open this paper in CoChat — free account

Abstract

Plant gene editing is typically performed by delivering reagents such as Cas9 and single guide RNAs to explants in culture. Edited cells are then induced to differentiate into whole plants by exposure to various hormones. The creation of edited plants through tissue culture is often inefficient, time-consuming, works for only limited species and genotypes, and causes unintended changes to the genome and epigenome. Here we report two methods to generate gene-edited dicotyledonous plants through de novo meristem induction. Developmental regulators and gene-editing reagents are delivered to somatic cells of whole plants. This induces meristems that produce shoots with targeted DNA modifications, and gene edits are transmitted to the next generation. The de novo induction of gene-edited meristems sidesteps the need for tissue culture and promises to overcome a bottleneck in plant gene editing.

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Integrity signals

Registry

Crossref · 10.1038/s41587-019-0337-2

Cites

27 of 27 references verified0 citation errors · 0 not checkable

Statistics

Claims the paper makes

The claims and statistics of this paper haven’t been checked yet.

Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

The self-check needs the paper’s full text.

Floral dip: a simplified method for Agrobacterium ‐mediated transformation of Arabidopsis thaliana
Clough, S. J., & Bent, A. F. (1998) · The Plant Journal · doi:10.1046/j.1365-313x.1998.00343.x · Cited by 22,014
Isolation of plant DNA from fresh tissue
Doyle, J. J. (1990) · Focus eBooks · Cited by 10,802
Easy quantitative assessment of genome editing by sequence trace decomposition
Brinkman, E. K., Chen, T., Amendola, M., & van Steensel, B. (2014) · Nucleic Acids Research · doi:10.1093/nar/gku936 · Cited by 2,390
Agrobacterium -Mediated Plant Transformation: the Biology behind the “Gene-Jockeying” Tool
Gelvin, S. B. (2003) · Microbiology and Molecular Biology Reviews · doi:10.1128/mmbr.67.1.16-37.2003 · Cited by 1,383
Comparison of Sequencing Utility Programs
Aronesty, E. (2013) · The Open Bioinformatics Journal · doi:10.2174/1875036201307010001 · Cited by 1,144
Morphogenic Regulators Baby boom and Wuschel Improve Monocot Transformation
Lowe, K., Wu, E., Wang, N., Hoerster, G., Hastings, C., Cho, M.-J., Scelonge, C., Lenderts, B., Chamberlin, M., Cushatt, J., et al. (2016) · The Plant Cell · doi:10.1105/tpc.16.00124 · Cited by 881
Advancing Crop Transformation in the Era of Genome Editing
Altpeter, F., Springer, N. M., Bartley, L., Blechl, A. E., Brutnell, T. P., Citovsky, V., Conrad, L. J., Gelvin, S. B., Jackson, D. P., Kausch, A. P., et al. (2016) · The Plant Cell · doi:10.1105/tpc.16.00196 · Cited by 707
Self-citation
A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants
Čermák, T., Curtin, S. J., Gil‐Humanes, J., Čegan, R., Kono, T. J. Y., Konečná, E., Belanto, J. J., Starker, C. G., Mathre, J. W., Greenstein, R. L., et al. (2017) · The Plant Cell · doi:10.1105/tpc.16.00922 · Cited by 668
Self-citation
Genetic instability of plant tissue cultures: breakdown of normal controls.
Phillips, R. L., Kaeppler, S. M., & Olhoft, P. M. (1994) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.91.12.5222 · Cited by 582
DNA Replicons for Plant Genome Engineering
Baltes, N. J., Gil‐Humanes, J., Čermák, T., Atkins, P., & Voytas, D. F. (2014) · The Plant Cell · doi:10.1105/tpc.113.119792 · Cited by 552
Self-citation

Show all 27 references

Sorted by citations

Items 301–400 of 539

Current approaches and future potential for delivering CRISPR/Cas components in oilseeds and millets
Ghosh, S. (2024) · The Nucleus · doi:10.1007/s13237-024-00486-2 · Cited by 8
Epigenetic factors related to recalcitrance in plant biotechnology
Hesami, M., Pepe, M., Spitzer‐Rimon, B., Eskandari, M., & Jones, A. M. P. (2024) · Genome · doi:10.1139/gen-2024-0098 · Cited by 8
Identification and application of bioparts for plant synthetic biology
Koo, H., Jung, M., Lee, S., Go, S., & Kim, Y. (2025) · Molecules and Cells · doi:10.1016/j.mocell.2025.100273 · Cited by 8
Building an expanded bio-based economy through synthetic biology
Elizondo, A. M. G., Valle, I. D., Prates, E. T., Komp, E., Phillips, E. K., Ashok, N., Jacobson, D., Webb, E., Bomble, Y. J., Alexander, W. G., et al. (2025) · Biotechnology Advances · doi:10.1016/j.biotechadv.2025.108775 · Cited by 9
Advances in the use of morphogenic regulators and peptide regenerating factors for boosting plant transformation and genome editing
Achary, V. M. M., Syombua, E. D., Kaur, S., Cindhuri, K. S., Zou, D., Hearne, S., & Bandyopadhyay, A. (2026) · Frontiers in Plant Science · doi:10.3389/fpls.2026.1699984 · Cited by 12
Targeted deletion of grape retrotransposon associated with fruit skin color via CRISPR/Cas9 in Vitis labrascana ‘Shine Muscat’
Nakajima, I., Kawahigashi, H., Nishitani, C., Azuma, A., Haji, T., Toki, S., & Endo, M. (2023) · PLoS ONE · doi:10.1371/journal.pone.0286698 · Cited by 8
Gene editing tool kit in millets: present status and future directions
Sapara, V., Khisti, M., Yogendra, K. N., & Reddy, P. S. (2024) · The Nucleus · doi:10.1007/s13237-024-00485-3 · Cited by 8
“Similarly, research in dicotyledon-ous plants has shown the induction of de novo meristems without tissue culture using different combinations of DR genes [110].”
First Successful Targeted Mutagenesis Using CRISPR /Cas9 in Stably Transformed Grain Amaranth Tissue
Vollmer, S., Stetter, M. G., & Hensel, G. (2026) · Plant Biotechnology Journal · doi:10.1111/pbi.70590 · Cited by 8
miRNA expression profiling and zeatin dynamic changes in a new model system of in vivo indirect regeneration of tomato
Cao, H., Zhang, X., Ruan, Y., Zhang, L., Cui, Z., Li, X., & Jia, B. (2020) · PLoS ONE · doi:10.1371/journal.pone.0237690 · Cited by 8
“Although the expression of miR160 was low, in many previous studies, the read of miRNA greater than 10 was regarded as expression [2,27,90].”
Background
Can genetic engineering-based methods for gene function identification be eclipsed by genome editing in plants? A comparison of methodologies
Amritha, P. P., & Shah, J. M. (2021) · Molecular Genetics and Genomics · doi:10.1007/s00438-021-01769-y · Cited by 8
Harnessing genetic variation at regulatory regions to fine-tune traits for climate-resilient crops
Ganguly, D. R., Hickey, L. T., & Crisp, P. A. (2021) · Molecular Plant · doi:10.1016/j.molp.2021.12.011 · Cited by 8
Future Prospects for Research on Catharanthus roseus
Mall, M., Singh, P., Yadav, S., Sundaresan, V., Mani, D. N., Shasany, A. K., & Shukla, A. K. (2022) · Compendium of plant genomes · doi:10.1007/978-3-030-89269-2_10 · Cited by 8
Multiple sgRNAs for one-step inactivation of the duplicatedacetyl-coenzyme A carboxylase 2(ACC2) genes inBrassica napus
LaManna, L. M., Parulekar, M., & Maliga, P. (2022) · PLANT PHYSIOLOGY · doi:10.1093/plphys/kiac069 · Cited by 8
Development of Agrobacterium-mediated in planta transformation protocol through coleoptile in rice
Ho, U., Song, S.-R., Choe, Y.-I., Pak, M.-H., Kim, M., Kim, K., & Ho, T.-S. (2023) · Transgenic Research · doi:10.1007/s11248-023-00355-9 · Cited by 8
“Hence, several gene transfer protocols independent of tissue culture have been developed (Maher et al. 2019; Abhishek et al. 2016; Aminedi et al. 2019).”
Background
Sand rice, a promising future crop for desert and marginal lands in northern China
Zhao, P., Ran, R., Sun, H. L., Liu, Y., Li, X., Wang, C., Zhao, X. Q., & Chen, G. (2023) · Grassland Research · doi:10.1002/glr2.12065 · Cited by 8
CRISPR/Cas9 –based genome editing to expedite the genetic improvement of palms: challenges and prospects
Ramesh., S., Rajesh, M., Das, A., & Hebbar, K. (2024) · Frontiers in Plant Science · doi:10.3389/fpls.2024.1385037 · Cited by 7
Non-tissue culture genetic modifications for plant improvement
Li, X., Gao, Y.-H., Ma, H.-W., Wang, Y., Bu, T., Yin, W., Xia, X., & Wang, H. (2025) · Plant Molecular Biology · doi:10.1007/s11103-025-01594-6 · Cited by 8
“These include fast-treated Agrobacterium co-culture (Fast-TrACC) (Maher et al. 2020; Cody et al. 2022), cut-dip-budding (CDB) (Cao et al. 2023a), barley yellow striate mosaic virus (Li et al. 2021), a nanomaterials-medi-ated delivery system (Zhang et al. 2020), and the grafting of wild-type shoots…”
Influential
Co‐transformation using T‐ DNA genes from Agrobacterium strain 82.139 enhances regeneration of transgenic shoots in Populus
Goralogia, G. S., Ma, C., Taylor, D. S., Lawrence, A., Conrad, V., Peremyslova, E., & Strauss, S. H. (2025) · Plant Biotechnology Journal · doi:10.1111/pbi.70159 · Cited by 7
“The cytokinin-producing ipt gene, reported nearly 30 years ago, continues to see use for that purpose (Ebinuma et al ., 1997; Endo et al ., 2002b; Maher et al ., 2020).”
Morphogenetic Factors as a Tool for Enhancing Plant Regeneration Capacity During In Vitro Transformation
Bakulin, S. D., Монахос, С. Г., & Bruskin, S. A. (2025) · International Journal of Molecular Sciences · doi:10.3390/ijms26178583 · Cited by 7
“WIND1 , LEC2 , and ipt are also promising, as demonstrated in tobacco [53,68,77], tomato [77], poplar [114].”
Precision plant epigenome editing: what, how, and why
Leech, D., Previtera, D. A., Zhang, Y., Botella, J. R., & Crisp, P. A. (2025) · Trends in Plant Science · doi:10.1016/j.tplants.2025.08.009 · Cited by 10
An insight into the journey of CRISPR-CAS9 and its application in crop improvement
Sharma, U., Nisha, N., & Ray, A. (2025) · Discover Plants. · doi:10.1007/s44372-025-00343-9 · Cited by 10
Genome Editing by Grafting
Simoni, S., Fambrini, M., Pugliesi, C., & Rogo, U. (2025) · International Journal of Molecular Sciences · doi:10.3390/ijms26199294 · Cited by 7
“An original system involves the in planta de novo induction of meristems [43].”
ROTIS: A RUBY-assisted one-shot tissue-culture-free system for in-planta soybean transformation from germinated seedlings
Li, Y., Ke, L., Feng, S., Ning, R., Li, H., Zhao, X., He, Y., & Han, Y. (2025) · PLANT PHYSIOLOGY · doi:10.1093/plphys/kiaf609 · Cited by 7
Vacuum and Sonication Treatment Enable Efficient Transient Gene Expression in Various Monocot and Eudicot Plant Seedlings
Li, E., Geng, Y., Khristoforova, T. R., Wang, Y., Jones, J. W., Muchenje, K. T., Grillo, E., Zhang, H., Schmitz, R. J., & Demirer, G. S. (2026) · ACS Synthetic Biology · doi:10.1021/acssynbio.5c00855 · Cited by 7
A geminivirus crosses the monocot-dicot boundary and acts as a viral vector for gene silencing and genome editing
Kumar, J., Alok, A., Steffenson, B. J., & Kianian, S. F. (2023) · Journal of Advanced Research · doi:10.1016/j.jare.2023.09.013 · Cited by 7
“We selected 5 0 TTGGTAGTAGCGACTCCATG3 0 as gRNA for targeting the PDS gene in tobacco as it was demonstrated to work efﬁ-ciently in a previous study [39].”
Method
Agrobacterium and biolistic mediated genetic transformation of mungbean cultivar Samrat using embryogenic explant
Tripathi, A., Rathore, M., Shukla, S., Das, A., & Debnath, S. C. (2024) · Plant Cell Tissue and Organ Culture (PCTOC) · doi:10.1007/s11240-024-02780-y · Cited by 7
“First, this method does not require tissue culture or any explant induction steps (Maher et al. 2020).”
Quinoa Diversity and Its Implications for Breeding
Böndel, K. B., & Schmid, K. J. (2021) · Compendium of plant genomes · doi:10.1007/978-3-030-65237-1_7 · Cited by 7
BabyBoom: 3-Dimensional Structure-Based Ligand and Protein Interaction Prediction by Molecular Docking
Panchangam, S. S. (2022) · Biomolecules · doi:10.3390/biom12111633 · Cited by 7
“Similar studies were carried out in sorghum [23], Arabidopsis, and Nicotiana [17,24].”
Metabolic engineering in woody plants: challenges, advances, and opportunities
Yu, S., Bekkering, C. S., & Tian, L. (2021) · aBIOTECH · doi:10.1007/s42994-021-00054-1 · Cited by 6
Potential of conventional and new breeding technologies to manage soybean diseases
Buzdar, M. I., Awan, M. J. A., Raza, G., Naqvi, R. Z., Mansoor, S., & Amin, I. U. (2025) · Phytopathology Research · doi:10.1186/s42483-025-00338-0 · Cited by 6
Toward a logic-based framework for plant epigenetic control
Zhang, L., & Zhu, J. (2025) · Trends in Plant Science · doi:10.1016/j.tplants.2025.10.019 · Cited by 7
Genome editing in plants
Wada, N., Osakabe, K., & Osakabe, Y. (2022) · Gene and Genome Editing · doi:10.1016/j.ggedit.2022.100020 · Cited by 7
Revolutionizing soybean genomics: How CRISPR and advanced sequencing are unlocking new potential
Razzaq, M. K., Babur, M., Awan, M. J. A., Raza, G., Mobeen, M., Aslam, A., & Siddique, K. H. M. (2024) · Functional & Integrative Genomics · doi:10.1007/s10142-024-01435-7 · Cited by 6
Modern Technologies Provide New Opportunities for Somatic Hybridization in the Breeding of Woody Plants
Liu, S., Li, X., Zhu, J., Jin, Y., Xia, C., Zheng, B., Silvestri, C., & Cui, F. (2024) · Plants · doi:10.3390/plants13182539 · Cited by 6
“Additionally, genes associated with auxin/cytokinin biosynthesis, injury responses, and cell-fate determination, such as IPTs, glutamate receptor-like proteins, STMs, and WOXs, have also been successfully employed to promote plant regeneration [114].”
Background
Advances in gene editing-led route for hybrid breeding in crops
Awan, M. J. A., Farooq, M. A., Buzdar, M. I., Zia, A., Ehsan, A., Waqas, M. A. B., Hensel, G., Amin, I. U., & Mansoor, S. (2025) · Biotechnology Advances · doi:10.1016/j.biotechadv.2025.108569 · Cited by 6
Applications of CPPs in Genome Editing of Plants
Soliman, A., Laurie, J. D., Bilichak, A., & Ziemienowicz, A. (2021) · Methods in molecular biology · doi:10.1007/978-1-0716-1752-6_39 · Cited by 6
Advances in identifying GM plants: toward the routine detection of ‘hidden’ and ‘new’ GMOs
Bertheau, Y. (2021) · Burleigh Dodds series in agricultural science · doi:10.19103/as.2021.0097.22 · Cited by 6
Origin of the genome editing systems: application for crop improvement
Viviani, A., Spada, M., Giordani, T., Fambrini, M., & Pugliesi, C. (2022) · Biologia · doi:10.1007/s11756-022-01142-3 · Cited by 6
Novel NF-Y genes expressed during somatic embryogenesis in Medicago truncatula
Potsenkovskaia, E. A., Tvorogova, V. E., Yakovleva, D., Zlydneva, N. S., & Lutova, L. A. (2022) · Plant Gene · doi:10.1016/j.plgene.2022.100364 · Cited by 6
Functional analysis of RsWUSb with Agrobacterium-mediated in planta transformation in radish (Raphanus sativus L.)
Hu, Q., Dong, J., Ying, J., Wang, Y., Xu, L., Ma, Y., Wang, L., Li, J., & Liu, L. (2023) · Scientia Horticulturae · doi:10.1016/j.scienta.2023.112504 · Cited by 6
Plant Functional Genomics Based on High‐Throughput CRISPR Library Knockout Screening: A Perspective
He, J., Zeng, C., & Li, M. (2023) · Advanced Genetics · doi:10.1002/ggn2.202300203 · Cited by 6
Advances of Biotechnology in Quinoa Production: A Global Perspective
Alandia, G., Rodríguez, J. P., Palmgren, M. B., Condori, B., & López‐Marqués, R. L. (2021) · Springer eBooks · doi:10.1007/978-981-16-3832-9_5 · Cited by 7
Biotechnological Approaches for Genetic Improvement of Castor Bean (Ricinus communis L.)
Kumaraswamy, H. H., Kumar, V. D., Lavanya, C., Ushakiran, B., Senthilvel, S., Sujatha, M., Bhavani, K. B. D., Konda, A. K., Lakshmidevi, G., Ashfaq, A. M., et al. (2022) · Springer eBooks · doi:10.1007/978-3-030-81107-5_11 · Cited by 6
FIND-IT: Ultrafast mining of genome diversityPreprint
Knudsen, S., Wendt, T., Dockter, C., Thomsen, H. C., Rasmussen, M. W., Jørgensen, M. E., Lu, Q., Voss, C., Murozuka, E., Østerberg, J. T., et al. (2021) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2021.05.20.444969 · Cited by 6
“…the need for time ‐ consuming and potentially chromosome rearranging transformation and/or tissue culture steps that limit the technology to the relatively small number of plant varieties that are transformable and will grow in culture 33 , or where de novo meristem induction can be used 34 .”
Background
Single-cell transcriptome reveals the redifferentiation trajectories of the early stage of de novo shoot regeneration in Arabidopsis thalianaPreprint
Liu, G., Li, J., Li, J.-M., Chen, Z., Yuan, P., Chen, R., Yin, R., Liao, Z., Li, X., Gu, Y., et al. (2022) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2022.01.01.474510 · Cited by 6
Shoot at Site: Advancing in planta transformation, regeneration and gene-editing through a cascade of wounding-mediated developmental regulatorsPreprint
Kshetry, A. O., Ghose, K., Alok, A., Devkar, V., Raman, V., Stupar, R. M., Herrera‐Estrella, L., Zhang, F., & Patil, G. (2025) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2025.02.06.636944 · Cited by 6
Unraveling the Functional Diversity of MYB Transcription Factors in Plants: A Systematic Review of Recent Advances
Caliskan, I. T., Ametefe, G. D., Caliskan, A., Lau, S.-E., Liew, Y. J. M., Ikram, N. K. K., & Tan, B. C. (2025) · Phyton · doi:10.32604/phyton.2025.067225 · Cited by 5
In planta transformation methods to accelerate the domestication of perennial grain crops
Correia, P. M. P., Dong, X., Chen, M., Nørrevang, A. F., Luo, G., & Palmgren, M. B. (2025) · Frontiers in Plant Science · doi:10.3389/fpls.2025.1638144 · Cited by 5
“The use of DRs might expand the application of Agrobacterium infection of meristems to more plant species (Lian et al., 2022; Maher et al., 2020), including perennial grasses (Figure 2).”
Engineering autonomously luminescent plants using the fungal bioluminescence pathway
Yu, X., Wang, T., Kong, C., & Du, H. (2025) · New Phytologist · doi:10.1111/nph.70601 · Cited by 7
“Recentadvances in tissue-culture-free transformation, such as de novo meristem induction (Maher et al ., 2020) and the ‘Cut-dip-budding’ system (Cao et al ., 2023), which offer promising pathways to overcome this bottleneck.”
Integrating genomic technologies with artificial intelligence, CRISPR editing, and high-throughput phenotyping for engineering disease-resistant crops
Kamran, M., Zhijun, T., Ullah, A., Alvi, M. H. A., Aqeel, T., Xuejun, C., Sagheer, S., Umaira, Bingguang, X., & Xu, H. (2026) · Plant Stress · doi:10.1016/j.stress.2026.101317 · Cited by 7
From Lab to Field: CRISPRing Major Cultivated Solanaceae for Crop Improvement
Martina, F., Acquadro, A., & Moglia, A. (2026) · International Journal of Molecular Sciences · doi:10.3390/ijms27052238 · Cited by 5
“Maher et al. [173] also demonstrated that genetically modified meristems could be induced on soil-grown Cas9 -overexpressing plants by pruning to remove axillary meristems and perfusing the cutting sites with a suspension of A. tumefaciens cultures expressing DRs and gRNA cassettes.”
CRISPR Revolution in Gene Editing: Targeting Plant Stress Tolerance and Physiology
Abbas, A., Shah, A. A., Shah, A. N., Niaz, Y., Ahmed, W., Ali, H., Nawaz, M., & Hassan, M. (2023) · Springer eBooks · doi:10.1007/978-3-031-15568-0_14 · Cited by 5
Advancing tree genomics to future proof next generation orchard production
Kerr, S. C., Shehnaz, S., Paudel, L., Manivannan, M. S., Shaw, L. M., Johnson, A. J., Velasquez, J. T. J., Tanurdžić, M., Cazzonelli, C. I., Varkonyi‐Gasic, E., et al. (2024) · Frontiers in Plant Science · doi:10.3389/fpls.2023.1321555 · Cited by 5
Techniques and advantages of microspore culture for crop improvement
Arabzai, M. G., Huang, D., Mohammadi, N. K., Gao, J., Wang, X., Zheng, P., Qin, Y., & Wang, L. (2025) · Plant Growth Regulation · doi:10.1007/s10725-025-01312-8 · Cited by 8
“This capability helps the rapid development of crops that are superior to their predecessors in traits such as yield, resistance to diseases, and greater climate resilience (Maher et al. 2020).”
A new climate for genomic and epigenomic innovation in grapevine
Schmidt, M., Strack, T., Andrews, H., Hickey, L. T., Crisp, P. A., & Voss‐Fels, K. P. (2025) · Molecular Horticulture · doi:10.1186/s43897-025-00171-1 · Cited by 5
“Because of grapevine’s amenability to grafting, there are also exciting possibilities to adapt recent advances in de novo meristem induction (Maher et al. 2019) to generate gene edited branches or to incorporate graft trans-missible gene editing via donor rootstocks (Yang et al. 2023).”
Nanomaterial mediated genome engineering for sustainable food production: Current status and future prospects
Tandon, A., Singh, A., Thakur, A., & Sharma, V. (2023) · Biocatalysis and Agricultural Biotechnology · doi:10.1016/j.bcab.2023.102891 · Cited by 5
Combating foodborne pathogens: Efficacy of plasma-activated water with supplementary methods for Staphylococcus aureus eradication on chicken, and beef
Moonsub, K., Seesuriyachan, P., Boonyawan, D., Rachtanapun, P., Sawangrat, C., Opassuwan, T., & Wattanutchariya, W. (2024) · Food Chemistry X · doi:10.1016/j.fochx.2024.101890 · Cited by 5
“Synergistic antimicrobial activity of PAW (Maher et al., 2020).”
Background
Plant gene editing improved
Baumann, K. (2019) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-019-0207-2 · Cited by 5
Moving genome edited crops forward from the laboratory bench to the kitchen table
Hong, J., Shi, Q., Biswas, S., Jiang, S., & Shi, J. (2020) · Food Control · doi:10.1016/j.foodcont.2020.107790 · Cited by 5
Development of Biotic Stress Resistant Pea in the Post-genomics Era
Anishkumar, P. K., Gondalia, N., Sharma, F., Barot, V., Vashi, R., Chatterjee, M., Karmakar, N., Gupta, P., Sarker, A., Kumar, S., et al. (2022) · Springer eBooks · doi:10.1007/978-3-030-91043-3_3 · Cited by 5
Domestication of the Floating Fern Symbiosis Azolla
Schluepmann, H., Bigot, I., Rijken, N., Grifoll, A. C., Gudde, P. A. N. M., Dijkhuizen, L. W., & Güngör, E. (2022) · Springer eBooks · doi:10.1007/978-981-16-6170-9_7 · Cited by 5
The Continuous Improvement of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)–CRISPR-Associated Protein System Has Led to Its Highly Efficient Application in Plants
Tan, W. Z., Wang, Z., & Liu, L. (2024) · Agriculture · doi:10.3390/agriculture15010029 · Cited by 5
Auxin affects gene editing efficiency through regulating chromatin accessibility and plant regeneration process
Lian, Z.-Y., Jiang, T., Liang, Y.-F., Hu, W., Peng, H.-M., Zhang, H., Gong, H., You, C.-X., Wang, G.-Y., Liu, L., et al. (2025) · Horticulture Research · doi:10.1093/hr/uhaf240 · Cited by 3
“…[19]; (vi) injecting wounded plants with A. tumefaciens that carry developmental regulatory genes (e.g. WUS2/IPT or WUS2/STM ) to induce direct shoot regeneration from the wounded sites as demonstrated by Maher et al. [20], where pds mutant shoots were successfully induced from soil-grown tobacco.”
CRISPR-Based genome editing in pulses: current approaches, challenges, and future prospects
Kumari, S., Keshari, A. K., Singh, S. K., Pandey, S., & Singh, A. K. (2025) · Plant Molecular Biology · doi:10.1007/s11103-025-01655-w · Cited by 4
CRISPR genome editing in plants without tissue culture
Li, C., Mei, D., Cheng, H., Pan, X., & Zhang, B. (2026) · Trends in biotechnology · doi:10.1016/j.tibtech.2025.12.017 · Cited by 4
The effect of ecological characteristics on the domestication of sand rice (Agriophyllum squarrosum)
Chen, C., Zuo, X., & Zhao, X. Q. (2024) · PeerJ · doi:10.7717/peerj.18320 · Cited by 4
“Application of delivery systems bypassing tissue culture may improve agronomic traits of sand rice ( Maher et al., 2019 ; Cody et al., 2023 ).”
Recent Advances in Cotton Transformation and Genome Editing Techniques: The Prospects and Challenges
Aluko, O. O., Ninkuu, V., Liu, Z., Qin, A., Liu, H., Yang, J., Hu, M., Ma, X., & Sun, X. (2025) · Modern Agriculture · doi:10.1002/moda.70014 · Cited by 5
Plant Transformation and Genome Editing for Precise Synthetic Biology Applications
Kambampati, S., Verma, P., & Janga, M. R. (2025) · SynBio · doi:10.3390/synbio3030009 · Cited by 5
“Non-transgenic and tissue-culture-free methods, such as the nanoparticle-mediated delivery of RNPs or plasmids, and in planta methods leveraging developmental regulators or meristem injection, are promising avenues for the future [2,90,109].”
Research progress and strategic considerations for the regeneration of Chinese medicine resources
Liu, J., Li, C., Zhang, Y., JIANG, C., Liu, C., & Huang, L. (2023) · Scientia Sinica Vitae · doi:10.1360/ssv-2023-0073 · Cited by 4
Nanocarriers in Plant Genetic Engineering
Ogidi, O. I., Okara, E., & Barwant, M. M. (2025) · IGI Global eBooks · doi:10.4018/979-8-3693-9869-2.ch004 · Cited by 4
Gene-editing in plants no longer requires tissue culture
Zhang, Y., & Palmgren, M. B. (2020) · Frontiers of Agricultural Science and Engineering · doi:10.15302/j-fase-2020330 · Cited by 4
Swiftly Evolving CRISPR Genome Editing: A Revolution in Genetic Engineering for Developing Stress-Resilient Crops
Nejat, N., Han, Y. N., Zhang, X., He, T., Wang, P., & Li, C. (2022) · Current Chinese Science · doi:10.2174/2210298102666220324112842 · Cited by 5
CRISPR/Cas9 for soybean improvement: A review
Kar, S. R., Choudhury, S., & Chakraborty, A. (2022) · Asia-Pacific Journal of Molecular Biology and Biotechnology · doi:10.35118/apjmbb.2022.030.3.05 · Cited by 4
“The de novo meristem induction was targeted to generate CRISPR/Cas9 genome-edited dicotyledonous plants sidestepping the need for tissue culture (Maher et al., 2020).”
Metabolic pathway genes for editing to enhance multiple disease resistance in plants
Kushalappa, A. C., Hegde, N., & Yogendra, K. N. (2022) · Journal of Plant Research · doi:10.1007/s10265-022-01409-5 · Cited by 4
Gene editing to improve drought tolerance
Núñez-Muñoz, L. A., Calderón-Pérez, B., Ruíz‐Medrano, R., & Xoconostle‐Cázares, B. (2022) · CABI Reviews · doi:10.1079/cabireviews202217048 · Cited by 5
Use of Mathematical Methods for the Biosafety Assessment of Agricultural Crops
Korotkov, E., Yakovleva, I. V., & Kamionskaya, A. M. (2021) · Applied Biochemistry and Microbiology · doi:10.1134/s000368382102006x · Cited by 4
Evaluation of diploid potato germplasm for applications of genome editing and genetic engineering
Jayakody, T. B., Enciso-Rodríguez, F. E., Jensen, J., Douches, D. S., & Nadakuduti, S. S. (2022) · American Journal of Potato Research · doi:10.1007/s12230-021-09855-y · Cited by 4
Genetic transformation of Primula sieboldii using Agrobacterium rhizogenes and whole-plant regeneration from transgenic hairy roots
Gad, K., Huu, C. N., Plaschil, S., Kappel, C., & Lenhard, M. (2025) · Frontiers in Plant Science · doi:10.3389/fpls.2025.1623387 · Cited by 3
“Only a limited number of plants can be transformed by methods such as the ﬂ oral dip (Clough and Bent, 1998), de novo induction of meristems (Maher et al., 2020), or the cut-dip-budding method (Cao et al., 2023) which can omit the need for regeneration through tissue culture.”
The role of CRISPR in modern plant breeding: overcoming breeding barriers and legislative challenges through transgene-free genome editing
Yıldırım, K., & Kavas, M. (2026) · Genome · doi:10.1139/gen-2025-0063 · Cited by 7
Cross‐Species Reprogramming of Developmental Plasticity and Metabolic Rewiring via Banana‐Derived WUS2 Developmental Regulator
Chaudhary, R., Singh, S., Ali, U., & Tiwari, S. (2026) · Plant Biotechnology Journal · doi:10.1111/pbi.70625 · Cited by 3
“Recent approaches have coexpressed WUS with other DRs or repressor motifs to promote de-novo shoot regeneration with improved transformation and genome editing efficiency (Maher et al. 2020; Shin et al. 2020; Lee et al. 2024; Kumar et al. 2024, 2025).”
植物病毒介导基因编辑的研究进展
Wang, X., Yang, Y., & Qiao, J. (2025) · Chinese Science Bulletin (Chinese Version) · doi:10.1360/tb-2025-0177 · Cited by 3
Functional analysis of the woody oil crop Plukenetia volubilis L. LEC2 homolog PvoB3-69 in promoting regeneration
Yu, J., Deng, S., Mo, J., Huang, H., Xu, Z., & Wang, Y. (2025) · Plant Cell Reports · doi:10.1007/s00299-025-03493-y · Cited by 3
“At the same time, the combination of ZmWUS2 & STM ( NOS pro ::ZmWUS2&CmYLCV pro ::STM ) that had been demonstrated to have the function of promoting regeneration in previous studies (Maher et al. 2020) used as a positive con-trol.”
Comparative analysis of endophytic bacterial localization and microbiome diversity in plant varieties under varied growth conditions through microscopic imaging and sequencing techniques
Shadab, M. K., Samanta, S. K., Baruah, J., Deka, S., Raj, G., & Talukdar, N. C. (2025) · Frontiers in Microbiology · doi:10.3389/fmicb.2025.1568209 · Cited by 3
Tissue-culture free gene editing in plants using virus-induced gene editing: a brief overview
Chauhan, H., Alok, A., & Singh, K. (2025) · The Nucleus · doi:10.1007/s13237-025-00562-1 · Cited by 3
“The DRs were delivered in combination with sgRNAs specific to NbPDS1, NbPDS2, which resulted in the successful knockout of PDS [51].”
Empowering Agrobacterium: Ternary vector systems as a new arsenal for plant transformation and genome editing
Jeong, J.-H., Kim, S. H., & Kim, J. (2025) · Biotechnology Advances · doi:10.1016/j.biotechadv.2025.108631 · Cited by 3
Strategies for CRISPR/Cas9-mediated genome editing: from delivery to production of modified plants
Corteva Agriscience, U., Gordon-Kamm, W. J., Barone, P., Corteva Agriscience, U., Svitashev, S. K., Corteva Agriscience, U., Sander, J. D., Corteva Agriscience, U., Kumar, S., Corteva Agriscience, U., et al. (2021) · Burleigh Dodds series in agricultural science · doi:10.19103/as.2020.0082.12 · Cited by 3
“A recent variation on using morphogenic genes to assist in gene editing has also been reported by Maher et al. (2020).”
Influential
If Mendel Was Using CRISPR: Genome Editing Meets Non‐Mendelian Inheritance
Hudzieczek, V., Hobza, R., Cápal, P., Šafář, J., & Doležel, J. (2022) · Advanced Functional Materials · doi:10.1002/adfm.202202585 · Cited by 3
Making headway toward enduring changes: perspectives on breeding tree crops through genome editing
Pinto, R. T., Abeyratne, C. R., Paiva, L. V., & Benedito, V. A. (2023) · Tree Genetics & Genomes · doi:10.1007/s11295-022-01583-6 · Cited by 3
Biotechnological Approaches for Genetic Improvement of Sesame (Sesamum indicum L.)
Kumaraswamy, H. H., Ramya, K. T., Mandal, S. N., Pasala, R., JAWAHARLAL, J., Pushpa, H. D., Ramesh, K., Rathnakumar, A. L., Duraimurugan, P., & Sakthivel (2023) · Springer eBooks · doi:10.1007/978-981-19-8218-7_11 · Cited by 3
Tomato mosaic virus movement protein enhances the transient expression of recombinant protein in the stem of the tomato plant, Solanum lycopersicum
Kobayashi, M., Aoyagi, M., Uto, A., & Miura, K. (2023) · Journal of Plant Biochemistry and Biotechnology · doi:10.1007/s13562-023-00857-x · Cited by 3
“Recently, it has been shown that transformation and genome editing can be achieved by delivery of viral vectors to plant organs and transient expression of genes on the vectors (Maher et al. 2020; Lian et al. 2022).”
Progress and future impacts on genomic dissection of soybean domestication and improvement
Wu, T., Xu, X., Zhang, L., Yuan, S., Chen, F., Sun, S., & Jiang, B. (2023) · Critical Reviews in Plant Sciences · doi:10.1080/07352689.2023.2275870 · Cited by 3
“…technologies in plants, such as base editing, prime editing, and gene targeting (Chen et al. , 2019; Lu et al. , 2020); new genetic transformation techniques that bypass the need for callus induction (Maher et al. , 2020; Cao et al. , 2023) and rapid breeding techniques (Watson et al. , 2018).”
Background
Opportunities for Gene Editing of Sweetpotato
Huang, D., Livengood, C., Yencho, G. C., & Liu, W. (2024) · Compendium of plant genomes · doi:10.1007/978-3-031-65003-1_10 · Cited by 3
Induced mutagenesis in wheat: from ionizing radiation to site-specific gene editing
Kishchenko, O., Stepanenko, A., & Borisjuk, N. V. (2021) · Fiziologia rastenij i genetika · doi:10.15407/frg2021.01.029 · Cited by 3
Identification of BABY BOOM-like genes (SbBBM) in Sorghum [(Sorghum bicolor) L. Moench]
Yavuz, C., & Çalışkan, M. E. (2021) · Cereal Research Communications · doi:10.1007/s42976-021-00210-9 · Cited by 3
Genome Editing: Prospects and Challenges
Lineesha, K. A., & Antony, G. (2021) · Compendium of plant genomes · doi:10.1007/978-3-030-76649-8_14 · Cited by 3
DNA-free CRISPR-Cas9 gene editing of tetraploid tomatoes using protoplast regenerationPreprint
Hsu, C., Yuan, Y., Zheng, P., Wu, F., Cheng, Q., Wu, Y., Lin, S., Yue, J.-J., Cheng, Y. H., Lin, S.-I., et al. (2021) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2021.11.02.466947 · Cited by 3
“Such knowledge could be 416 applied to develop efficient tissue culture, gene transformation, and genome editing 417 system, tools that are important for de novo plant domestication (Li et al., 2018; 418 Zsogon et al., 2018; Maher et al., 2020; Yu et al., 2021).”
BackgroundInfluential
Efficient transformation and genome editing of watermelon assisted by genes that encode developmental regulatorsPreprint
Pan, W., Cheng, Z., Han, Z., Yang, H., Zhang, W., & Zhang, H. (2021) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2021.11.05.467370 · Cited by 3
Utilizing CRISPR-Cas in Tropical Crop Improvement: A Decision Process for Fitting Genome Engineering to Your Species
Joo, K., Muszynski, M. G., Kantar, M. B., Wang, M.-L., He, X., & Valle-Echevarria, A. R. D. (2021) · Frontiers in Genetics · doi:10.3389/fgene.2021.786140 · Cited by 2
“The DR-based strategy involves the expression of meristem-organizing genes, either in vitro or ectopically, to generate new shoots that give rise to fertile plantlets from somatic tissue (Maher et al., 2020).”
Background
Plant Tissue Culture: A Boon or Enigma in Gene Editing for Plants Using CRISPR/Cas System
Purkaystha, S., Pramanik, B., Das, A., Kumari, S., & Debnath, S. (2024) · Interdisciplinary biotechnological advances · doi:10.1007/978-981-99-9338-3_11 · Cited by 2
Stable transformation mediated by Agrobacterium tumefaciens in Jonquil is better than Agrobacterium rhizogenes
Yu, W., Tian, H., Chen, Y., Lyu, S., & Fan, Y. (2025) · Frontiers in Plant Science · doi:10.3389/fpls.2025.1594197 · Cited by 2

Authors: Maher, M. F., Nasti, R. A., Vollbrecht, M., Starker, C. G., Clark, M. D., & Voytas, D. F.
Affiliations: University of Minnesota (US)
Corresponding author: Voytas, Daniel F.
ORCID: Maher, Michael F.
Nasti, Ryan A.
Vollbrecht, Macy
Starker, Colby G.
Clark, Matthew D.
Voytas, Daniel F.
Venue: Nature Biotechnology
Publisher: Springer Science and Business Media LLC
Published: 2019-12-16
Volume: 38
Issue: 1
Pages: 84-89
ISSN: 0733-222X (ISSN-L)
1087-0156
1546-1696
DOI: 10.1038/s41587-019-0337-2
PMC: PMC6954279
OpenAlex: W2995711654
Cited by: 541
References: 27
Citations by year: 2026: 64 · 2025: 86 · 2024: 68 · 2023: 78 · 2022: 94 · 2021: 93 · 2020: 55 · 2019: 2
FWCI: 20.08
Type: journal article
Language: en
Open access: green
www.ncbi.nlm.nih.gov
Licence: www.springer.com/tdm (tdm)
www.springer.com/tdm (vor)
Locations: Nature Biotechnology (publishedVersion)
PubMed (publishedVersion)
PubMed Central (acceptedVersion)
Funders: U.S. Department of Health & Human Services | NIH | National Institute of General Medical Sciences (T32-GM008347)
Hackett Fund of the University of Minnesota TechAccel
TechAccel
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › CRISPR and Genetic Engineering
Life Sciences › Agricultural and Biological Sciences › Plant Science › Plant tissue culture and regeneration
Life Sciences › Agricultural and Biological Sciences › Plant Science › Plant Molecular Biology Research
Keywords: Cas9, single guide RNA, somatic cells, dicotyledonous plants, transgenerational inheritance, developmental regulators, epigenome, genome editing
MeSH terms: Gene Editing, CRISPR-Associated Protein 9, Base Sequence, Mutation, Plant Proteins, Soil, Nicotiana, Meristem, Plant Shoots, Transgenes, Plants, Genetically Modified, Seedlings

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

Plant gene editing through de novo induction of meristems

Abstract

Overview

Integrity signals

Verification

Claims the paper makes

Claims other papers make about this one

Self-check

Citations

Cites

Cited by

Related

Metadata

Record

About these checks