The DOI matches its Crossref record; 80 of the 82 references it cites were found in a registry or an index; none of the 57 sources its claims cite is checked for support yet.
Neuronal defects in a human cellular model of 22q11.2 deletion syndrome
Open accessAbstract
22q11.2 deletion syndrome (22q11DS) is a highly penetrant and common genetic cause of neuropsychiatric disease. Here we generated induced pluripotent stem cells from 15 individuals with 22q11DS and 15 control individuals and differentiated them into three-dimensional (3D) cerebral cortical organoids. Transcriptional profiling across 100 days showed high reliability of differentiation and revealed changes in neuronal excitability-related genes. Using electrophysiology and live imaging, we identified defects in spontaneous neuronal activity and calcium signaling in both organoid- and 2D-derived cortical neurons. The calcium deficit was related to resting membrane potential changes that led to abnormal inactivation of voltage-gated calcium channels. Heterozygous loss of DGCR8 recapitulated the excitability and calcium phenotypes and its overexpression rescued these defects. Moreover, the 22q11DS calcium abnormality could also be restored by application of antipsychotics. Taken together, our study illustrates how stem cell derived models can be used to uncover and rescue cellular phenotypes associated with genetic forms of neuropsychiatric disease.
Overview
AI snapshot
Written from the paper’s full text.
TL;DR
This study used hiPS cell-derived 3D cortical organoids and 2D cortical neurons from 15 22q11DS patients and 15 controls to identify neuronal phenotypes in 22q11.2 deletion syndrome. It found increased spontaneous firing, impaired depolarization-induced calcium signaling, and depolarized resting membrane potential linked to voltage-dependent LTCC inactivation, with DGCR8 loss sufficient to phenocopy and antipsychotics/DGCR8 overexpression partially rescuing defects.
Key findings
- Transcriptional profiling across 100 days showed high reliability of differentiation and identified 87, 34, 258, and 46 differentially expressed genes at days 25, 50, 75, and 100, respectively, with enrichment for neuronal excitability, calcium transport/signaling, voltage-gated calcium channel activity, and resting membrane potential regulation.
- 22q11DS cortical neurons were approximately 4x more likely to spontaneously fire action potentials than controls (P=0.001; P=0.0006), and showed decreased depolarization-induced [Ca2+]i rise (P<0.0001; Cohen’s d=3.76 for hCS and 4.37 for 2D neurons) and a more depolarized RMP (P<0.0001).
- The calcium defect was linked to voltage-dependent inactivation of LTCCs: no difference was found in Ba2+ current amplitude/charge (P=0.68 amplitude; P=0.44 charge) or activation curve (P=0.78), but the fraction of available channels at –50 mV and –40 mV was decreased in patients.
- Heterozygous DGCR8 loss recapitulated increased spontaneous firing (P=0.003), decreased [Ca2+]i rise (P<0.0001), and depolarized RMP (P=0.009); DGCR8 overexpression partially rescued calcium in 22q11DS and hyperpolarized 22q11DS neurons by ~7 mV (P=0.01), while raclopride increased [Ca2+]i amplitude by ~104% in 22q11DS and hyperpolarized cells by ~5 mV.
Methods
- Generated 43 hiPS cell lines from 15 patients with the canonical 3Mb 22q11.2 deletion (22.8 ± 2.4 years; 60% female) and 15 controls (23.8 ± 4.0 years; 67% female), then differentiated them into 3D human cortical spheroids (hCS) and 2D cortical glutamatergic cultures.
- Collected bulk RNA-seq at days 25, 50, 75, and 100 from 15 hiPS cell lines derived from 12 22q11DS individuals and 14 hiPS cell lines from 11 controls; performed single-cell transcriptomics in four hiPS cell lines.
- Used patch-clamp electrophysiology, Fura-2 calcium imaging, HPLC neurotransmitter measurements, CRISPR/Cas9-generated DGCR8+/– isogenic lines, lentiviral DGCR8 overexpression, and antipsychotic drug application; analyses included mixed linear models, GSEA, GWAS enrichment, and mixed-model ANOVA.
Limitations
- Stated: the cohort with ascertained psychiatric diagnoses was limited; larger samples are needed to reliably estimate genotype–phenotype associations and distinguish molecular pathways unique to schizophrenia versus ASD.
- Stated: it remains to be established whether 22q11DS neurons recover following maturation, homeostatic events, or integration into circuits with interneurons; future studies should identify the microRNA(s) downstream of DGCR8 and whether other 22q11.2 locus genes or regulatory regions contribute.
- Stated and evident: the antipsychotic hyperpolarization rescue may be unrelated to antipsychotic response in patients; the study focuses on hiPS cell-derived cortical neurons in vitro, so circuit-level and in vivo disease relevance are not directly tested.
Model-written summary. Check it against the paper before relying on it.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
88 Own result · 29 Not checked yet · 22 Own interpretation · 19 Own method · 1 No basis given
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“its overexpression rescued these defects.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“we compared the proportion of cells in each cluster across lines and found that cell diversity was overall similar across lines and groups”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Cortical differentiation and transcriptomic changes in 22q11DS
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“which was consistent across the cohort (Fig. 2e, left; P< 0.0001).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Defects in cortical neuronal excitability and calcium signaling in 22q11DS
plainn = 10- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found that co–culturing did not affect the phenotype (Extended Data Fig. 6f; P = 0.008).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Defects in cortical neuronal excitability and calcium signaling in 22q11DS
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“we also observed an enrichment for genes related to neuronal excitability, including the regulation of calcium transport, calcium signaling or voltage gated calcium channel activity, but also with the regulation of RMP.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Cortical differentiation and transcriptomic changes in 22q11DS
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The main source of variation was related to the timing of differentiation, with the first principal component (PC1) explaining 33% of the variance”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Cortical differentiation and transcriptomic changes in 22q11DS
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In 22q11DS neurons, we observed a decrease in the amplitude of [Ca2+]i rise following 67 mM KCl depolarization (Fig. 2d), which was consistent across the cohort (Fig. 2e, left; P< 0.0001).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Defects in cortical neuronal excitability and calcium signaling in 22q11DS
plainn = 10- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Heterozygous loss of DGCR8 recapitulated the excitability and calcium phenotypes”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We measured the RMP and found that patient–derived neurons were more depolarized (Fig. 3d; P< 0.0001).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Defects in cortical neuronal excitability and calcium signaling in 22q11DS
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We also found no significant difference in the activation curve between the groups (Extended Data Fig. 7g; P = 0.78).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Defects in cortical neuronal excitability and calcium signaling in 22q11DS
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- It may state two separate claims as one. 47
- Probably not a substantial claim. 38
- The quote only partly states this claim. 3
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found either undetectable levels (dopamine, GABA) or no change (glutamate, norepinephrine) between groups”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Defects in cortical neuronal excitability and calcium signaling in 22q11DS
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“PC2 (7.4%), as well as PC5, PC6 and PC7 (8.1% combined), were related to differences between the 22q11DS and control groups.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Cortical differentiation and transcriptomic changes in 22q11DS
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found a decrease in the amplitude of the [Ca2+]i rise, but the difference between 22q11DS and control was still present following TTX”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Defects in cortical neuronal excitability and calcium signaling in 22q11DS
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“variance partitioning showed that differentiation time explained 28% of the variance, while the differentiation experiment and the hiPS cell line explained 9.3% and 3.9% of the variance, respectively”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Cortical differentiation and transcriptomic changes in 22q11DS
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“We observed an enrichment for variants associated with schizophrenia, but not for DEG found in ASD or SCZ postmortem brain tissue35,36.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Cortical differentiation and transcriptomic changes in 22q11DS
What the sources say
- Not checked yetcites [35] Parikshak, N. N. et al. Genome-wide changes in lncRNA, splicing, and regional gene expression patterns in autism. Nature 540, 423–427 (2016). source
- Not checked yetcites [36] Fromer, M. et al. Gene expression elucidates functional impact of polygenic risk for schizophrenia. Nat. Neurosci. 19, 1442–1453 (2016). source
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found that although there was an ~48% increase in the amplitude of the [Ca2+]i rise in 22q11DS neurons from day 70–80 to day 90–100, the overall defect was present even after 5.5 months of differentiation”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Defects in cortical neuronal excitability and calcium signaling in 22q11DS
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“we found no differences in AP amplitude (P= 0.69), threshold (P= 0.97), rheobase (P= 0.22), maximal rate of rise (P= 0.29), maximal rate of decay (P= 0.43) between 22q11DS and control neurons”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Defects in cortical neuronal excitability and calcium signaling in 22q11DS
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“pretreatment with nimodipine, a blocker of LTCCs, decreased the amplitude of the [Ca2+]i rise by ~64% in control cortical and by ~57% in 22q11DS”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Defects in cortical neuronal excitability and calcium signaling in 22q11DS
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The majority of protein–coding genes were downregulated in 22q11DS hCS by ~50% (Extended Fig. 2g), except for DGCR8 which was down regulated by about 20%.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Cortical differentiation and transcriptomic changes in 22q11DS
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found that, at 10–15 days following viral delivery, DGCR8 overexpression hyperpolarized the membrane potential of 22q11DS neurons by ~7 mV, while it had little or no effect in control neurons (Fig. 5e; P= 0.01).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Pharmacological rescue of defects in 22q11DS neurons
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found that the pretreatment (in 2D- and 3D-derived neurons) resulted in a decrease in the [Ca2+]i amplitude in control neurons (~31%), partly mimicking the phenotype in 22q11DS”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Defects in cortical neuronal excitability and calcium signaling in 22q11DS
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Imaging with Fura–2, showed that overexpression increased the amplitude of [Ca2+]i rise following depolarization, although it did not restore the amplitude to control levels”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Pharmacological rescue of defects in 22q11DS neurons
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found that the application of olanzapine, at a similar concentration of 10 μM, also resulted in hyperpolarization and rescue of the RMP of 22q11DS neurons (Extended Data Fig. 10f; P= 0.008).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Pharmacological rescue of functional defects in 22q11DS neurons
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Exogenously expressing DGCR8 rescued these defects in an isogenic line but only partially in 22q11DS.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > DISCUSSION
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“We found that ATP1A243, a sodium–potassium transporter ATPase involved in maintaining the RMP, WNT5A which regulates neuronal excitability and calcium signaling44, as well as ZNF132, were also downregulated in DGCR8+/– hCS”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Pharmacological rescue of defects in 22q11DS neurons
What the sources say
- Not checked yetcites [43] Gritz, S. M. & Radcliffe, R. A. Genetic effects of ATP1A2 in familial hemiplegic migraine type II and animal models. Hum. Genomics 7, 8 (2013). source
- Not checked yetcites [44] McQuate, A., Latorre-Esteves, E. & Barria, A. A Wnt/calcium signaling cascade regulates neuronal excitability and trafficking of NMDARs. Cell Rep. 21, 60–69 (2017). source
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“we observed a decrease in the amplitude of [Ca2+]i rise following depolarization (Fig. 4c), which was similar to the defects in 22q11DS neurons (Fig. 4d; P< 0.0001).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Heterozygous loss of DGCR8 recapitulates functional phenotypes of 22q11DS neurons
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found that pretreatment with raclopride was sufficient to restore the deficit in [Ca2+]i in 22q11DS neurons, while having no statistically significant effect on control neurons (Fig. 6a, b; P< 0.003).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Pharmacological rescue of functional defects in 22q11DS neurons
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Barium currents amplitude (left) and charge (right) (controls, n = 30 cells derived from 5 control hiPS cell lines derived from 5 subjects; 22q11DS, n = 17 cells derived from 4 patient hiPS cell lines derived from 4 subjects. Two–tailed Mann–Whitney, P = 0.23 for amplitude; two–tailed Mann–Whitney, P = 0.28 for charge).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > Extended Data
plainn = 4- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We did not observe any systematic differences between cells reprogrammed by the two methods.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > Reprogramming and hiPS cell culture
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. The quote only partly states this claim.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“n = 12 control neurons, one–way repeated measures ANOVA, F2, 22= 14.35, ****P < 0.0001; followed by Tukey’s multiple comparisons test: **P = 0.001 for pre–sulpiride versus sulpiride, ****P < 0.0001 for sulpiride versus post-wash, P = 0.56 for pre–sulpiride versus post–wash”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > Extended Data
plaindirectn = 12- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“n = 13 22q11DS neurons, one–way repeated measures ANOVA, F2, 22= 7.84, *P = 0.002; Tukey’s multiple comparisons test: *P = 0.01 for pre–sulpiride versus sulpiride, **P = 0.003 for sulpiride versus post–wash and P = 0.72 for pre–sulpiride versus post–wash”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > Extended Data
plaindirectn = 13- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Pearson’s correlation of all genes across all four lines (two control lines and two 22q11DS lines, R2> 0.96).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > Extended Data
plaincorrelationaln = 4- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Comparison of action potential properties (controls, n = 46 cells derived from 6 control hiPS cell lines; 22q11DS, n = 66 cells derived from 4 patient hiPS cell lines): amplitude (two–tailed t–test, P = 0.70), threshold (two–tailed t–test, P = 0.97), rheobase (two–tailed Mann–Whitney test, P = 0.22), maximal rate of rise (two–tailed t–test, P = 0.29) and minimal rate of decay (two–tailed Mann–Whit”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > Extended Data
plainn = 66- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“CACNB4 (two–tailed Wilcoxon test, P= 0.94), KCNJ11 (two–tailed Wilcoxon test, P= 0.94), CALY (two–tailed Wilcoxon test, P= 0.22), CALCB (two–tailed Wilcoxon test, P= 0.22), PCP4 (two–tailed Wilcoxon test, P= 0.08).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > Extended Data
plainn = 7- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Quantification of the effect of nimodipine on the Fura–2 ratio amplitude (Fura–2 ratio decreased by ~64% in control cortical and by ~57% in 22q11DS neurons; two–sided Kruskal–Wallis test, P < 0.0001; followed by Dunn’s multiple comparison test; **P = 0.001, ****P < 0.0001).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > Extended Data
plaindirectn = 2- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“n = 10 neurons derived from one 22q11DS hiPS cell line, one–way repeated measures ANOVA, F2,18= 6.3, **P = 0.008; followed by Tukey’s multiple comparisons test: *P = 0.05 for pre–olanzapine versus olanzapine, **P = 0.008 for olanzapine versus post–wash, P = 0.69 for pre–olanzapine versus post–wash”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > Extended Data
plaindirectSingle case- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Two-sided t–test, P = 0.72 for NE, P = 0.39 for GLUT, DA and GABA not detectable”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > Extended Data
plainn = 5- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Up to one in four 22q11.2DS patients develop psychosis, which correspond to a ~20–fold increase in risk, and accounts for 1–2% of all schizophrenia cases4–6.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > INTRODUCTION
What the sources say
- Not checked yetcites [4] Murphy, K. C., Jones, L. A. & Owen, M. J. High rates of schizophrenia in adults with velo-cardio-facial syndrome. Arch. Gen. Psychiatry 56, 940–945 (1999). source
- Not checked yetcites [5] Monks, S. et al. Further evidence for high rates of schizophrenia in 22q11.2 deletion syndrome. Schizophr. Res. 153, 231–236 (2014). source
- Not checked yetcites [6] Schneider, M. et al. Psychiatric disorders from childhood to adulthood in 22q11.2 deletion syndrome: results from the International Consortium on Brain and Behavior in 22q11.2 Deletion Syndrome. Am. J. Psychiatry 171, 627–639 (2014). source
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
The paper states this without a source or data behind it here, so there is nothing to check it against. The quote shows it is in the paper.
In the paper
“22q11.2 deletion syndrome (22q11DS) is a highly penetrant and common genetic cause of neuropsychiatric disease.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Rodent models of 22q11DS have provided important insights3,9,10, including describing circuit dysfunction11–13.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > INTRODUCTION
What the sources say
- Not checked yetcites [3] Zinkstok, J. R. et al. Neurobiological perspective of 22q11.2 deletion syndrome. Lancet Psychiatry 6, 951–960 (2019). source
- Not checked yetcites [9] Drew, L. J. et al. The 22q11.2 microdeletion: fifteen years of insights into the genetic and neural complexity of psychiatric disorders. Int. J. Dev. Neurosci. 29, 259–281 (2011). source
- Not checked yetcites [10] Karayiorgou, M., Simon, T. J. & Gogos, J. A. 22q11.2 microdeletions: linking DNA structural variation to brain dysfunction and schizophrenia. Nat. Rev. Neurosci. 11, 402–416 (2010). source
- Not checked yetcites [11] Chun, S. et al. Specific disruption of thalamic inputs to the auditory cortex in schizophrenia models. Science 344, 1178–1182 (2014). source
- Not checked yetcites [12] Sigurdsson, T., Stark, K. L., Karayiorgou, M., Gogos, J. A. & Gordon, J. A. Impaired hippocampal-prefrontal synchrony in a genetic mouse model of schizophrenia. Nature 464, 763–767 (2010). source
- Not checked yetcites [13] Fernandez, A. et al. Mitochondrial dysfunction leads to cortical under-connectivity and cognitive impairment. Neuron 102, 1127–1142 e1123 (2019). source
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Together, this data demonstrates high reliability of hCS and suggests that defects in early cortical differentiation may not be a significant contributor to developmental defects in 22q11DS.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Cortical differentiation and transcriptomic changes in 22q11DS
hedged- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“A power analysis based on our first batch indicated an 85% power of detecting ~18% change in expression (Extended Data Fig. 2h).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Cortical differentiation and transcriptomic changes in 22q11DS
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Recent studies16–18 have begun to explore transcriptional changes in neural cells derived from a small 22q11DS cohort, but the functional defects in human 22q11DS neurons and the underlying mechanisms have not been investigated.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > INTRODUCTION
What the sources say
- Not checked yetcites [16] Zhao, D. et al. MicroRNA profiling of neurons generated using induced pluripotent stem cells derived from patients with schizophrenia and schizoaffective disorder, and 22q11.2 Del. PLoS ONE 10, e0132387 (2015). source
- Not checked yetcites [17] Toyoshima, M. et al. Analysis of induced pluripotent stem cells carrying 22q11.2 deletion. Transl. Psychiatry 6, e934 (2016). source
- Not checked yetcites [18] Lin, M. et al. Integrative transcriptome network analysis of iPSC-derived neurons from schizophrenia and schizoaffective disorder patients with 22q11.2 deletion. BMC Syst. Biol. 10, 105 (2016).
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“hCS transcriptionally resemble the developing cerebral cortex, contain functional glutamatergic neurons and astrocytes, and their generation is highly reliable across differentiation experiments and lines22.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Cortical differentiation and transcriptomic changes in 22q11DS
What the sources say
- Not checked yetcites [22] Yoon, S. J. et al. Reliability of human cortical organoid generation. Nat. Methods 16, 75–78 (2019). source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“We used SNP arrays to verify genome integrity and to confirm the 22q11.2 deletion (Extended Data Fig. 1c; Supplementary Table 4).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Cortical differentiation and transcriptomic changes in 22q11DS
plaindirectn = 15- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“The 22q11.2 deletion syndrome (22q11DS) is the most frequent (1: 3000) deletion3.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > INTRODUCTION
What the sources say
- Not checked yetcites [3] Zinkstok, J. R. et al. Neurobiological perspective of 22q11.2 deletion syndrome. Lancet Psychiatry 6, 951–960 (2019). source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“We derived 3D human cortical spheroids (hCS)19–21, which are regionalized brain organoids that show high reliability of differentiation22”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > INTRODUCTION
What the sources say
- Not checked yetcites [19] Pasca, A. M. et al. Functional cortical neurons and astrocytes from human pluripotent stem cells in 3D culture. Nat. Methods 12, 671–678 (2015). source
- Not checked yetcites [20] Sloan, S. A., Andersen, J., Pasca, A. M., Birey, F. & Pasca, S. P. Generation and assembly of human brain region-specific three-dimensional cultures. Nat. Protoc. 13, 2062–2085 (2018). source
- Not checked yetcites [21] Sloan, S. A. et al. Human astrocyte maturation captured in 3D cerebral cortical spheroids derived from pluripotent stem cells. Neuron 95, 779–790 (2017). source
- Not checked yetcites [22] Yoon, S. J. et al. Reliability of human cortical organoid generation. Nat. Methods 16, 75–78 (2019). source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“This microdeletion also confers a 30–40% risk for ASD7,8.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > INTRODUCTION
What the sources say
- Not checked yetcites [7] Vorstman, J. A. et al. The 22q11.2 deletion in children: high rate of autistic disorders and early onset of psychotic symptoms. J. Am. Acad. Child Adolesc. Psychiatry 45, 1104–1113 (2006). source
- Not checked yetcites [8] Olsen, L. et al. Prevalence of rearrangements in the 22q11.2 region and population-based risk of neuropsychiatric and developmental disorders in a Danish population: a case-cohort study. Lancet Psychiatry 5, 573–580 (2018). source
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“A common feature of many antipsychotics is a modulation of dopamine D2 receptor function, which has been linked to clinical response46,47.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Pharmacological rescue of functional defects in 22q11DS neurons
What the sources say
- Not checked yetcites [46] Seeman, P., Lee, T., Chau-Wong, M. & Wong, K. Antipsychotic drug doses and neuroleptic/dopamine receptors. Nature 261, 717–719 (1976). source
- Not checked yetcites [47] Kapur, S., Zipursky, R., Jones, C., Remington, G. & Houle, S. Relationship between dopamine D2 occupancy, clinical response and side effects: a double-blind PET study of first-episode schizophrenia. Am. J. Psychiatry 157, 514–520 (2000). source
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Nonetheless, such changes could shape the formation of cortical circuits and contribute to disease susceptibility.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > DISCUSSION
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: fails — It may be too vague to check against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may be too vague to check against evidence. The paper’s conclusions may not depend on it. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Previous models for this disease have provided pathophysiological clues9,10,54, but we are still far from developing effective therapeutics for mental illness in 22q11DS.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > DISCUSSION
What the sources say
- Not checked yetcites [9] Drew, L. J. et al. The 22q11.2 microdeletion: fifteen years of insights into the genetic and neural complexity of psychiatric disorders. Int. J. Dev. Neurosci. 29, 259–281 (2011). source
- Not checked yetcites [10] Karayiorgou, M., Simon, T. J. & Gogos, J. A. 22q11.2 microdeletions: linking DNA structural variation to brain dysfunction and schizophrenia. Nat. Rev. Neurosci. 11, 402–416 (2010). source
- Not checked yetcites [54] Chun, S., Bayazitov, I. T., Blundon, J. A. & Zakharenko, S. S. Thalamocortical long-term potentiation becomes gated after the early critical period in the auditory cortex. J. Neurosci. 33, 7345–7357 (2013). source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
In the paper
“DGCR8 works in a complex with an RNAse, DROSHA, and regulates the expression of many transcripts30.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > DISCUSSION
What the sources say
- Not checked yetcites [30] Han, J. et al. The Drosha–DGCR8 complex in primary microRNA processing. Genes Dev. 18, 3016–3027 (2004). source
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Several reports have now confirmed an association between the LTCC CACNA1C gene and neurodevelopmental disorders25,58.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > DISCUSSION
What the sources say
- Not checked yetcites [25] Cross-Disorder Group of the Psychiatric Genomics Consortium. Identification of risk loci with shared effects on five major psychiatric disorders: a genome-wide analysis. Lancet 381, 1371–1379 (2013). source
- Not checked yetcites [58] Schizophrenia Working Group of the Psychiatric Genomics Consortium. Biological insights from 108 schizophrenia-associated genetic loci. Nature 511, 421–427 (2014). source
boostedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“Interestingly, by contrast to the reduced [Ca2+]i in 22q11DS, we recently reported increased [Ca2+]i in Timothy syndrome, a monogenic ASD23.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > DISCUSSION
What the sources say
- Not checked yetcites [23] Pașca, S. P. et al. Using iPSC-derived neurons to uncover cellular phenotypes associated with Timothy syndrome. Nat. Med. 17, 1657–1662 (2011). source
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“It is therefore possible that similar to 22q11DS, other disorders on the schizophrenia or autism spectrum may display convergence of multiple signaling defects in pathways suggested by GWAS.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > DISCUSSION
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“Microdeletions at the 22q11.2 locus are the most frequent interstitial deletion in humans53.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > DISCUSSION
What the sources say
- Not checked yetcites [53] Kobrynski, L. J. & Sullivan, K. E. Velocardiofacial syndrome, DiGeorge syndrome: the chromosome 22q11.2 deletion syndromes. Lancet 370, 1443–1452 (2007). source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Thereby, any level of alteration in DGCR8 would presumably have downstream effects on protein production and, potentially, neuronal physiology.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > DISCUSSION
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: unclear — It is unclear whether it could be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Importantly, we showed that neural differentiations are highly reliable and 22q11DS is not associated with major defects in corticogenesis.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > DISCUSSION
boosted- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“One of the genes deleted in the 22q11.2 region is DGCR8– a component of the microprocessor complex involved in microRNA biogenesis30, has been associated with neuronal defects in rodent models of disease, and therefore has an outsized potential to dysregulate downstream target genes contributing to neuronal phenotype11,42.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Heterozygous loss of DGCR8 recapitulates functional phenotypes of 22q11DS neurons
What the sources say
- Not checked yetcites [30] Han, J. et al. The Drosha–DGCR8 complex in primary microRNA processing. Genes Dev. 18, 3016–3027 (2004). source
- Not checked yetcites [11] Chun, S. et al. Specific disruption of thalamic inputs to the auditory cortex in schizophrenia models. Science 344, 1178–1182 (2014). source
- Not checked yetcites [42] Schofield, C. M. et al. Monoallelic deletion of the microRNA biogenesis gene Dgcr8 produces deficits in the development of excitatory synaptic transmission in the prefrontal cortex. Neural Dev. 6, 11 (2011). source
boostedcorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Electrophysiological and imaging experiments confirmed an increase in excitability and an impaired depolarization–induced LTCC calcium signaling in 22q11DS–derived neurons, which were related to a defect in the RMP that caused voltage–dependent inactivation of calcium channels.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > DISCUSSION
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“The modulation of LTCC by D2 receptors in neurons is well established, and blocking of D2 receptors can increase the activity of LTCC by multiple pathways27,48.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > DISCUSSION
What the sources say
- Not checked yetcites [27] Yasumoto, F. et al. Dopamine receptor 2 regulates L-type voltage-gated calcium channel in primary cultured mouse midbrain neural network. Cell. Mol. Neurobiol. 24, 877–882 (2004). source
- Not checked yetcites [48] Hernandez-Lopez, S. et al. D2 dopamine receptors in striatal medium spiny neurons reduce L-type Ca2+ currents and excitability via a novel PLCβ1-IP3-calcineurin-signaling cascade. J. Neurosci. 20, 8987–8995 (2000). source
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Cultures were regularly tested for mycoplasma and maintained mycoplasma free.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > Reprogramming and hiPS cell culture
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
In the paper
“Power analysis was performed using the PROPER package (v1.10.0)73 in R.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > Power analysis
What the sources say
- Not checked yetcites [73] Wu, H., Wang, C. & Wu, Z. PROPER: comprehensive power evaluation for differential expression using RNA-seq. Bioinformatics 31, 233–241 (2015). source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“Batch effect were accounted for by either including batch as a covariate in the linear model (allowing for correct estimation of degrees of freedom) or by Combat function form the sva package in R (for PCA and correlation analysis)67.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > RNA-seq processing
What the sources say
- Not checked yetcites [67] Johnson, W. E., Li, C. & Rabinovic, A. Adjusting batch effects in microarray expression data using empirical Bayes methods. Biostatistics 8, 118–127 (2007). source
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may state two separate claims as one.
In the paper
“Off target candidates were predicted using COSMID46 tool (https://crispr.bme.gatech.edu). Integrity was confirmed by Sanger sequencing at top 3 off–target candidates (Chr6:138404602–138404624 GCGCCGACTCGGGAGCGGAGGGG, Chr3:52534180–52534202 GGGCGGACCCGGGAGCGGAGAGG, Chr3:49902616–49902638 GGGCACCCACTGGAGCGGAGTGG)”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > Genome editing of hiPS cells
What the sources say
- Not checked yetcites [46] Seeman, P., Lee, T., Chau-Wong, M. & Wong, K. Antipsychotic drug doses and neuroleptic/dopamine receptors. Nature 261, 717–719 (1976). source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Batches were balanced for control and 22q11DS lines.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > Batch effects
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“These findings support the value of a major mutational model for elucidating the biology of complex neuropsychiatric disorders and open the avenue for uncovering therapeutics.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > DISCUSSION
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: fails — It may be too vague to check against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. It may be too vague to check against evidence. It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Sample identity was verified using the identity by descent (IBD) algorithm from PLINK (1.09). IBD was calculated for each sample based on genotypes derived from the RNA–seq analysis and a threshold of PI_HAT< 0.8 was set.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > RNA-seq processing
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“To account for this, samples from both control and 22q11DS lines were re–sequenced at one time point (day 75).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > Batch effects
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Picard sequencing metrics (http://broadinstitute.github.io/picard/, v2.5.0) were summarized using the first twenty principal components (seqPCs). These seqPCs were then included in the model to control for technical variation in the RNA sequencing.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > RNA-seq processing
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Fixed covariates that were included were differentiation day, sex, batch, the first two PCs calculated for genetic ancestry and twenty sequencings PCs (SeqPCs; see above).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > Differential expression
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Experiments were conducted blind to the disease status of the samples.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > High–performance liquid chromatography measurements
plain- Asserted: fails — The authors may not put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: fails — The paper may give no reason why it holds.
Probably not a substantial claim. The authors may not put it forward as true. The paper’s conclusions may not depend on it. The paper may give no reason why it holds. The quote only partly states this claim.
In the paper
“The differentiation of hiPS cells into cortical neural progenitor cells (NPCs) and neurons was carried using a previously described and validated protocol23.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > 2D Neuronal differentiation
What the sources say
- Not checked yetcites [23] Pașca, S. P. et al. Using iPSC-derived neurons to uncover cellular phenotypes associated with Timothy syndrome. Nat. Med. 17, 1657–1662 (2011). source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Experiments were conducted blind to the disease status of the samples.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > High–performance liquid chromatography measurements
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Additionally, for each hiPS cell line, the sex was verified by detection of genes expressed by the Y–chromosome.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > RNA-seq processing
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Experiments were conducted blind to the disease status of the samples.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > High–performance liquid chromatography measurements
plain- Asserted: fails — The authors may not put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: fails — The paper may give no reason why it holds.
Probably not a substantial claim. The authors may not put it forward as true. The paper’s conclusions may not depend on it. The paper may give no reason why it holds. It may state two separate claims as one. The quote only partly states this claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“A mixed linear model was used to account for multiple samples coming from the same individual, hiPS cell line and differentiation as well as to account for samples which were sequenced more than once.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > Differential expression
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Experiments in the initial calcium phenotyping assay were conducted blind to the disease status.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > Calcium imaging
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“hiPS cell lines were randomly selected for differentiation from each genotype.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > Generation of hCS from hiPS cells
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Some of the hiPS cell lines used in this study were extensively characterized previously23,61 using immunostaining with anti–NANOG and TRA 2–49/6E antibodies, karyotyping, generation of teratoma in nude mice and mapping of viral integration sites (Extended Data Fig. 1a).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > Reprogramming and hiPS cell culture
What the sources say
- Not checked yetcites [23] Pașca, S. P. et al. Using iPSC-derived neurons to uncover cellular phenotypes associated with Timothy syndrome. Nat. Med. 17, 1657–1662 (2011). source
- Not checked yetcites [61] Yazawa, M. et al. Using induced pluripotent stem cells to investigate cardiac phenotypes in Timothy syndrome. Nature 471, 230–234 (2011). source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Experiments were conducted blind to the disease status of the samples in neurons at 50–70 days of differentiation in vitro.”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > Electrophysiology in 2D neurons
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
The authors state this as an assumption.
The batch splitting created a larger positive difference between cases and controls, which should lead to a right-shifted or skewed distribution.
“This expectation for a right skewed distribution results from the assumption that the splitting created a larger (positive) difference between the cases and controls which should lead to a right shifted or skewed distribution.”
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The cited source says what the claim attributes to it.
In the citing paper
“The authors showed that antipsychotics could restore the functional defects found in 22q11.2 deletion syndrome providing further justification for the use of iPSC-derived organoids as a relevant model for disease modeling [65].”
From Utility of iPSC-Derived Cells for Disease Modeling, Drug Development, and Cell Therapy (2022) · cites this paper as [65]
The cited source says what the claim attributes to it.
In the citing paper
“Another study using 100 day cerebral cortical organoids showed that organoids derived from patients with 22q11.2 deletion syndrome had deficits in spontaneous neuronal activity and calcium signaling.”
From Utility of iPSC-Derived Cells for Disease Modeling, Drug Development, and Cell Therapy (2022) · cites this paper as [65]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
Each contradiction between two passages listed here was confirmed by an independent check.
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > Extended Data
“Asterisks indicate differential expression at the specified timepoints between control and 22q11DS lines (FDR> 0.05).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > Differential expression
“Genes with FDR< 0.05 were considered to be differentially expressed.”
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Defects in cortical neuronal excitability and calcium signaling in 22q11DS
“We found that co–culturing did not affect the phenotype (Extended Data Fig. 6f; P = 0.008).”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > Extended Data
“f, Changes in Fura–2 ratio in response to depolarization with 67 mM KCl in co–cultured neurons (two–tailed Mann–Whitney for peak amplitude, P < 0.0001).”
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > RESULTS > Cortical differentiation and transcriptomic changes in 22q11DS
“a cohort of 15 patients with 22q11DS”
§ Neuronal Defects in a Human Cellular Model of 22q11.2 Deletion Syndrome > METHODS > Reprogramming and hiPS cell culture
“A total of 43 hiPS cell lines were generated from 15 healthy subjects and 16 22q11DS patients.”
Citations
Cites
STAR: ultrafast universal RNA-seq aligner
Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., & Gingeras, T. R. (2013) · Bioinformatics · doi:10.1093/bioinformatics/bts635 · Cited by 51,709
Robinson, M. D., McCarthy, D. J., & Smyth, G. K. (2010) · Bioinformatics · doi:10.1093/bioinformatics/btp616 · Cited by 41,364
PLINK: a tool set for whole-genome association and population-based linkage analyses.
Purcell, S., Neale, B., Todd-Brown, K., Thomas, L., Ferreira, M. A. R., Bender, D., Maller, J., Sklar, P., de Bakker, P. I. W., Daly, M. J., et al. (2007) · The American Journal of Human Genetics · doi:10.1086/519795 · Cited by 34,089
The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data
McKenna, A., Hanna, M., Banks, E., Sivachenko, A., Cibulskis, K., Kernytsky, A., Garimella, K., Altshuler, D., Gabriel, S., Daly, M., et al. (2010) · Genome Research · doi:10.1101/gr.107524.110 · Cited by 27,895
RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome
Li, B., & Dewey, C. N. (2011) · BMC Bioinformatics · doi:10.1186/1471-2105-12-323 · Cited by 22,179
Integrating single-cell transcriptomic data across different conditions, technologies, and species
Butler, A., Hoffman, P., Smibert, P., Papalexi, E., & Satija, R. (2018) · Nature Biotechnology · doi:10.1038/nbt.4096 · Cited by 13,174
Adjusting batch effects in microarray expression data using empirical Bayes methods
Johnson, W. E., Li, C., & Rabinovic, A. (2007) · Biostatistics · doi:10.1093/biostatistics/kxj037 · Cited by 8,658
Biological insights from 108 schizophrenia-associated genetic loci
Schizophrenia Working Group of the Psychiatric Genomics Consortium (2014) · Nature · doi:10.1038/nature13595 · Cited by 7,577
Meijer, L., Nelson, D. J., Riazanski, V., Gabdoulkhakova, A. G., Héry-Arnaud, G., Berre, R. L., Loaëc, N., Oumata, N., Galons, H., Nowak, E., et al. (2016) · Journal of Innate Immunity · doi:10.1159/000444256 · Cited by 5,008
(2013) · The Lancet · doi:10.1016/s0140-6736(12)62129-1 · Cited by 3,010
Research works printed but not linked: 1
- Korotkevich, G., Sukhov, V. & Sergushichev, A. Fast gene set enrichment analysis. Preprint at bioRxiv 060012 https://www.biorxiv.org/content/10.1101/060012v2 (2019). · DOI
Cited by
Sorted by citations
Human organoids in basic research and clinical applications
Tang, X.-Y., Wu, S., Wang, D., Chu, C., Hong, Y., Tao, M., Hu, H., Xu, M., Guo, X. L., & Liu, Y. (2022) · Signal Transduction and Targeted Therapy · doi:10.1038/s41392-022-01024-9 · Cited by 539
Long-term maturation of human cortical organoids matches key early postnatal transitions
Gordon, A., Yoon, S., Tran, S. S., Makinson, C. D., Park, J. Y., Andersen, J., Valencia, A. M., Horvath, S., Xiao, X. G., Huguenard, J. R., et al. (2021) · Nature Neuroscience · doi:10.1038/s41593-021-00802-y · Cited by 361
Self-citationA reference human induced pluripotent stem cell line for large-scale collaborative studies
Pantazis, C. B., Yang, A., Lara, E., McDonough, J. A., Blauwendraat, C., Peng, L., Oguro, H., Kanaujiya, J., Zou, J., Sebesta, D., et al. (2022) · Cell Stem Cell · doi:10.1016/j.stem.2022.11.004 · Cited by 310
Human cerebral organoids — a new tool for clinical neurology research
Eichmüller, O. L., & Knoblich, J. A. (2022) · Nature Reviews Neurology · doi:10.1038/s41582-022-00723-9 · Cited by 319
Signalling pathways in autism spectrum disorder: mechanisms and therapeutic implications
Jiang, C.-C., Lin, L., Long, S., Ke, X., Fukunaga, K., Lu, Y., & Han, F. (2022) · Signal Transduction and Targeted Therapy · doi:10.1038/s41392-022-01081-0 · Cited by 295
Metadata
- Authors
- Khan, T. A., Revah, O., Gordon, A., Yoon, S.-J., Krawisz, A. K., Goold, C., Sun, Y., Kim, C. H., Tian, Y., Li, M.-Y., Schaepe, J. M., Ikeda, K., Amin, N. D., Sakai, N., Yazawa, M., Kushan, L., Nishino, S., Porteus, M. H., Rapoport, J. L., Bernstein, J. A., O’Hara, R., Bearden, C. E., Hallmayer, J. F., Huguenard, J. R., Geschwind, D. H., Dolmetsch, R. E., & Paşca, S. P.
- Affiliations
- Stanford Medicine (US)
- University of California, Los Angeles (US)
- Beth Israel Deaconess Medical Center (US)
- Yonsei University (KR)
- National Institute of Mental Health (US)
- ORCID
- Khan, Themasap A.
- Revah, Omer
- Gordon, Aaron
- Yoon, Se-Jin
- Krawisz, Anna K.
- Sun, Yishan
- Kim, Chul Hoon
- Tian, Yuan
- Li, Min-Yin
- Schaepe, Julia M.
- Ikeda, Kazuya
- Amin, Neal D.
- Sakai, Noriaki
- Yazawa, Masayuki
- Kushan, Leila
- Nishino, Seiji
- Porteus, Matthew H.
- Bernstein, Jonathan A.
- Bearden, Carrie E.
- Hallmayer, Joachim F.
- Huguenard, John R.
- Geschwind, Daniel H.
- Dolmetsch, Ricardo E.
- Paşca, Sergiu P.
- Venue
- Nature Medicine
- Published
- 2020-09-28
- Volume
- 26
- Issue
- 12
- Pages
- 1888-1898
- ISSN
- 1078-8956 (ISSN-L)
- 1546-170X
- PMC
- PMC8525897
- OpenAlex
- W3091490674
- Semantic Scholar
- 8d9001376156fc2b4b2a6f4a69591c78af571c64
- Cited by
- 186
- References
- 82
- Citations by year
- 2026: 22 · 2025: 35 · 2024: 33 · 2023: 28 · 2022: 45 · 2021: 21 · 2020: 2
- FWCI
- 7.78
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Locations
- Nature Medicine (publishedVersion)
- PubMed (publishedVersion)
- PubMed Central (acceptedVersion)
- eScholarship (California Digital Library) (submittedVersion)
- YUHSpace (Yonsei University Medical Library) (submittedVersion, cc-by-nc-nd)
- Funders
- Howard Hughes Medical Institute
- National Institutes of Health (5r01mh094714-04)
- National Institute of Mental Health (R01-MH094714, R01MH107800, U01MH115745, R01MH085953, R01MH100900, U01MH115746, R01MH121075, R37MH060233, R37MH085953)
- National Institute of Neurological Disorders and Stroke (R01NS034774)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Pluripotent Stem Cells Research
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Genomic variations and chromosomal abnormalities
- Life Sciences › Neuroscience › Developmental Neuroscience › Neurogenesis and neuroplasticity mechanisms
- Keywords
- 22q11.2 deletion syndrome, induced pluripotent stem cells, neuronal excitability, calcium signaling, voltage-gated calcium channels, resting membrane potential, DGCR8, spontaneous neuronal activity, neuropsychiatric disorders, gene expression profiling
- MeSH terms
- Adult, Cell Differentiation, Cerebral Cortex, DiGeorge Syndrome, Female, Humans, Male, Neurons, Organoids, Calcium Signaling, Young Adult, Induced Pluripotent Stem Cells
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
A language model drew the claims from the paper on 2026-10-07, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).
A second model labelled each claim on 2026-10-07 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
