The DOI matches its Crossref record; 55 of the 55 references it cites were found in a registry or an index.
Different telomere damage signaling pathways in human and mouse cells
Open accessAbstract
Programmed telomere shortening in human somatic cells is thought to act as a tumor suppressor pathway, limiting the replicative potential of developing tumor cells. Critically short human telomeres induce senescence either by activating p53 or by inducing the p16/RB pathway, and suppression of both pathways is required to suppress senescence of aged human cells. Here we report that removal of TRF2 from human telomeres and the ensuing de-protection of chromosome ends induced immediate premature senescence. Although the telomeric tracts remained intact, the TRF2(DeltaBDeltaM)-induced premature senescence was indistinguishable from replicative senescence and could be mediated by either the p53 or the p16/RB pathway. Telomere de-protection also induced a growth arrest and senescent morphology in mouse cells. However, in this setting the loss of p53 function was sufficient to completely abrogate the arrest, indicating that the p16/RB response to telomere dysfunction is not active in mouse cells. These findings reveal a fundamental difference in telomere damage signaling in human and mouse cells that bears on the use of mouse models for the telomere tumor suppressor pathway.
Overview
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
The source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“Consistent with previous reports (27), G4 mTerc -/ -Ink4a / Arf -/ -MEFs showed an intermediate phenotype of decreased growth rates after 10 population doublings with steady slow proliferation thereafter, indicating that telomere dysfunction suppresses the growth rate, but not the immortalization potential, of Ink4a / Arf -/ -MEFs.”
From Ink4a / Arf tumor suppressor does not modulate the degenerative conditions or tumor spectrum of the telomerase-deficient mouse (2007) · cites this paper as [27]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“In MEFs, p19 Arf and p16 Ink4a contribute to the growth arrest incurred by telomere deprotection (14, 27).”
From Ink4a / Arf tumor suppressor does not modulate the degenerative conditions or tumor spectrum of the telomerase-deficient mouse (2007) · cites this paper as [27]
Experimental — accuracy not yet measuredThe source backs part of the claim, not all of it — or backs it for a different population, condition or comparison.
In the citing paper
“For example, mouse cells are thought to rely primarily on the p53 pathway for both replicative and telomere-dependent senescence (Harvey et al., 1993; Smogorzewska and de Lange, 2002).”
From Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors (2005) · cites this paper as Smogorzewska and de Lange, 2002
Experimental — accuracy not yet measuredThe cited source says what the claim attributes to it.
In the citing paper
“Consistent with the latter, p19 Arf deficiency has been reported to provide partial rescue of growth arrest after acute deprotection of telomeres by expression of a dominant-negative mutant of the telomere binding protein, Trf2, in mouse embryonic fibroblasts (MEFs) (27).”
From Ink4a / Arf tumor suppressor does not modulate the degenerative conditions or tumor spectrum of the telomerase-deficient mouse (2007) · cites this paper as [27]
In the citing paper
“By contrast, p53 inactivation alone is sufficient to avoid telomere-induced senescence and apoptosis in mice49,50.”
From Telomeres in cancer: tumour suppression and genome instability (2017) · cites this paper as [50]
In the citing paper
“Damaged telomeres eventually register as a form of DNA damage (8) triggering among other things a p53-mediated cell cycle arrest (9).”
From Glycolytic Enzymes Can Modulate Cellular Life Span (2005) · cites this paper as [9]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Citations
Cites
A biomarker that identifies senescent human cells in culture and in aging skin in vivo.
Dimri, G. P., Lee, X., Basile, G., Acosta, M., Scott, G., Roskelley, C., Medrano, E. E., Linskens, M., Rubelj, I., & Pereira-Smith, O. (1995) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.92.20.9363 · Cited by 7,477
Telomeres shorten during ageing of human fibroblasts
Harley, C. B., Futcher, A. B., & Greider, C. W. (1990) · Nature · doi:10.1038/345458a0 · Cited by 5,750
Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a
Serrano, M., Lin, A. W., McCurrach, M. E., Beach, D., & Lowe, S. W. (1997) · Cell · doi:10.1016/s0092-8674(00)81902-9 · Cited by 5,218
Extension of Life-Span by Introduction of Telomerase into Normal Human Cells
Bodnar, A. G., Ouellette, M., Frolkis, M., Holt, S. E., Chiu, C.-P., Morin, G. B., Harley, C. B., Shay, J. W., Lichtsteiner, S., & Wright, W. E. (1998) · Science · doi:10.1126/science.279.5349.349 · Cited by 4,975
A survey of telomerase activity in human cancer
Shay, J. W., & Bacchetti, S. (1997) · European Journal of Cancer · doi:10.1016/s0959-8049(97)00062-2 · Cited by 2,794
Mammalian Telomeres End in a Large Duplex Loop
Griffith, J. D., Comeau, L., Rosenfield, S., Stansel, R. M., Bianchi, A., Moss, H., & de Lange, T. (1999) · Cell · doi:10.1016/s0092-8674(00)80760-6 · Cited by 2,447
Mice Lacking p21CIP1/WAF1 undergo normal development, but are defective in G1 checkpoint control
Deng, C., Zhang, P., Wade Harper, J., Elledge, S. J., & Leder, P. (1995) · Cell · doi:10.1016/0092-8674(95)90039-x · Cited by 2,113
Telomere Shortening and Tumor Formation by Mouse Cells Lacking Telomerase RNA
Blasco, M. A., Lee, H.-W., Hande, M. P., Samper, E., Lansdorp, P. M., DePinho, R. A., & Greider, C. W. (1997) · Cell · doi:10.1016/s0092-8674(01)80006-4 · Cited by 2,108
Counter, C. M., Avilion, A. A., LeFeuvre, C. E., Stewart, N. G., Greider, C. W., Harley, C. B., & Bacchetti, S. (1992) · The EMBO Journal · doi:10.1002/j.1460-2075.1992.tb05245.x · Cited by 2,096 · cited 1×
“& & ' 0- " < 8 3* .”
Tumor spectrum analysis in p53-mutant mice
Jacks, T., Remington, L., Williams, B. O., Schmitt, E. M., Halachmi, S., Bronson, R. T., & Weinberg, R. A. (1994) · Current Biology · doi:10.1016/s0960-9822(00)00002-6 · Cited by 2,051
Flagged first, then by citations
Cited by
Sorted by citations
Items 101–200 of 480
Cancer and aging: the importance of telomeres in genome maintenance
Rodier, F., Kim, S.-H., Nijjar, T., Yaswen, P., & Campisi, J. (2005) · The International Journal of Biochemistry & Cell Biology · doi:10.1016/j.biocel.2004.10.012 · Cited by 132
“Moreover, consistent with the in vitro results, overexpression of dominant negative forms of TRF2 appears to induce pervasive telomere uncapping in human and rodent cells [40, 57-59].”
BackgroundResultMLL Associates with Telomeres and Regulates Telomeric Repeat-Containing RNA Transcription
Caslini, C., Connelly, J. A., Serna, A. N., Broccoli, D., & Hess, J. L. (2009) · Molecular and Cellular Biology · doi:10.1128/mcb.00195-09 · Cited by 140
Cellular Senescence Impairs Circadian Expression of Clock Genes In Vitro and In Vivo
Kunieda, T., Minamino, T., Katsuno, T., Tateno, K., Nishi, J.-I., Miyauchi, H., Orimo, M., Okada, S., & Komuro, I. (2006) · Circulation Research · doi:10.1161/01.res.0000204504.25798.a8 · Cited by 129
Molecular signaling and genetic pathways of senescence: Its role in tumorigenesis and aging
Zhang, H. (2006) · Journal of Cellular Physiology · doi:10.1002/jcp.20919 · Cited by 136
“…between the maximum cumulative population doubling of cells in culture and the maximum lifespan of the species from which they are derived (Stanley et al., 1975; Rohme, 1981) and an inverse correlation between the in vitro lifespan of cells and the age of donors from which they are…”
BackgroundStress-induced Premature Senescence (SIPS)
Suzuki, M., & Boothman, D. A. (2008) · Journal of Radiation Research · doi:10.1269/jrr.07081 · Cited by 128
Evolving views of telomerase and cancer
Blasco, M. (2003) · Trends in Cell Biology · doi:10.1016/s0962-8924(03)00085-0 · Cited by 123
Telomere uncapping and alternative lengthening of telomeres
Cesare, A. J., & Reddel, R. R. (2007) · Mechanisms of Ageing and Development · doi:10.1016/j.mad.2007.11.006 · Cited by 125
Engineered telomere degradation models dyskeratosis congenitaPreprint
Hockemeyer, D. F., Palm, W., Wang, R. C., Couto, S. S., & de Lange, T. (2008) · Genes & Development · doi:10.1101/gad.1679208 · Cited by 117
Cellular Senescence - its role in cancer and the response to ionizing radiation
Sabin, R. J., & Anderson, R. M. (2011) · Genome Integrity · doi:10.1186/2041-9414-2-7 · Cited by 123
Importance of TRF1 for Functional Telomere Structure
Iwano, T., Tachibana, M., Reth, M. G., & Shinkai, Y. (2004) · Journal of Biological Chemistry · doi:10.1074/jbc.m309138200 · Cited by 115
Mulloy, J. C., Cammenga, J., Berguido, F. J., Wu, K., Zhou, P. H., Comenzo, R. L., Jhanwar, S. C., Moore, M. A. S., & Nimer, S. D. (2003) · Blood · doi:10.1182/blood-2003-05-1762 · Cited by 111
Use of exogenous hTERT to immortalize primary human cells
Lee, K. M., Choi, K. H., & Ouellette, M. M. (2004) · Cytotechnology · doi:10.1007/10.1007/s10616-004-5123-3 · Cited by 121
“Leonardo et al. 1994; Robles and Adami 1998; Smogorzewska and de Lange 2002 ).”
BackgroundAlternative Lengthening of Telomeres in Human Cells
Reddel, R. R., Bryan, T. M., Colgin, L. M., Perrem, K., & Yeager, T. R. (2001) · Radiation Research · doi:10.1667/0033-7587(2001)155[0194:alotih]2.0.co;2 · Cited by 109
“LFS patients inherit a mutant allele of the p53 tumour suppressor gene, which is involved in HR and the cellular response to telomere uncapping ( 75 ).”
BackgroundThe mitotic clock in skeletal muscle regeneration, disease and cell mediated gene therapy
Mouly, V., Aamiri, A., Bigot, A., Cooper, R. N., Di Donna, S., Furling, D., Gidaro, T., Jacquemin, V., Mamchaoui, K., Negroni, E., et al. (2005) · Acta Physiologica Scandinavica · doi:10.1111/j.1365-201x.2005.01417.x · Cited by 106
Mizunoe, Y., Sudo, Y., Okita, N., Hiraoka, H., Mikami, K., Narahara, T., Negishi, A., Yoshida, M., Higashibata, R., Watanabe, S., et al. (2017) · Autophagy · doi:10.1080/15548627.2016.1274850 · Cited by 111
“Choe) by PCR using PrimeSTAR HS DNA polymerase (Takara, R010A) and then subcloned into Xho1- and Not1-digested pMXsAMNN-Puro vector.(54) Oligonucleotide primers for Ctsb were chemically synthesized as follows: 50-GGGCTCGAGCACCATGTGGCAGCTCTGGGCC-30 (Xho1) and 50-GCCGCGGCC GCTTACTTATCGTCGTCATCCTTGTAATCGATCTTTTCCC AGTACT…”
BackgroundMethodLansdorp, P. M. (2009) · The EMBO Journal · doi:10.1038/emboj.2009.172 · Cited by 109
“The EMBO Journal (2009) 28, 2532–2540. doi:10.1038/ emboj.2009.172; Published online 23 July 2009 Subject Categories: molecular biology of disease Keywords: cancer; dyskeratosis; mutations; telomerase”
BackgroundInfluentialTelomere length mediates the effects of telomerase on the cellular response to genotoxic stress
Rubio, M. Á., Davalos, A. R., & Campisi, J. (2004) · Experimental Cell Research · doi:10.1016/j.yexcr.2004.04.004 · Cited by 105
Telomere looping in P. sativum (common garden pea)
Cesare, A. J., Quinney, N. L., Willcox, S., Subramanian, D., & Griffith, J. D. (2003) · The Plant Journal · doi:10.1046/j.1365-313x.2003.01882.x · Cited by 110
Puterman, E., & Epel, E. (2012) · Social and Personality Psychology Compass · doi:10.1111/j.1751-9004.2012.00465.x · Cited by 106
ATM Kinase Is Required for Telomere Elongation in Mouse and Human Cells
Lee, S. S., Bohrson, C. L., Pike, A. M., Wheelan, S. J., & Greider, C. W. (2015) · Cell Reports · doi:10.1016/j.celrep.2015.10.035 · Cited by 103
Ramirez, R. D., Herbert, B., Vaughan, M. B., Zou, Y. S., Gandia, K., Morales, C. P., Wright, W. E., & Shay, J. W. (2003) · Oncogene · doi:10.1038/sj.onc.1206046 · Cited by 103
Mitochondrial Localization of Telomeric Protein TIN2 Links Telomere Regulation to Metabolic Control
Chen, L., Zhang, Y., Zhang, Q., Li, H., Luo, Z., Fang, H., Kim, S. H., Qin, L., Yotnda, P., Xu, J., et al. (2012) · Molecular Cell · doi:10.1016/j.molcel.2012.07.002 · Cited by 109
Mesenchymal stem cell transformation and sarcoma genesis
Xiao, W., Mohseny, A. B., Hogendoorn, P. C. W., & Cleton-Jansen, A. (2013) · Clinical Sarcoma Research · doi:10.1186/2045-3329-3-10 · Cited by 104
“In human cells, the telomeric DNA is often 5–10 kb long and mouse cells have a telomeric DNA length of 30–40 kb [41,51].”
BackgroundPositive feedback between p53 and TRF2 during telomere-damage signalling and cellular senescence
Fujita, K., Horikawa, I., Mondal, A. M., Jenkins, L. M. M., Appella, E., Vojtěšek, B., Bourdon, J., Lane, D. P., & Harris, C. C. (2010) · Nature Cell Biology · doi:10.1038/ncb2123 · Cited by 111
“6b ), the other major effector of cellular senescence in human cell”
BackgroundSmurf2 up-regulation activates telomere-dependent senescence
Zhang, H., & Cohen, S. N. (2004) · Genes & Development · doi:10.1101/gad.1253004 · Cited by 100
Increased p53 activity does not accelerate telomere‐driven ageing
García‐Cao, I., García‐Cao, M., Tomás‐Loba, A., Martin‐Caballero, J., Flores, J. M., Klatt, P., Blasco, M. A., & Serrano, M. (2006) · The EMBO Reports · doi:10.1038/sj.embor.7400667 · Cited by 102
Telomere length in reproduction
Thilagavathi, J., Venkatesh, S., & Dada, R. (2012) · Andrologia · doi:10.1111/and.12008 · Cited by 106
p53-Dependent and -Independent Functions of the Arf Tumor SuppressorPreprint
Sherr, C. J., Bertwistle, D., den Besten, W., KUO, M.-L., SUGIMOTO, M., Tago, K., Williams, R. T., Zindy, F., & Roussel, M. F. (2005) · Cold Spring Harbor Symposia on Quantitative Biology · doi:10.1101/sqb.2005.70.004 · Cited by 106
Conserved senescence associated genes and pathways in primary human fibroblasts detected by RNA-seq
Marthandan, S., Baumgart, M., Priebe, S., Groth, M., Schaer, J., Kaether, C., Guthke, R., Cellerino, A., Platzer, M., Diekmann, S., et al. (2016) · PLOS ONE · doi:10.1371/journal.pone.0154531 · Cited by 91
Boeck, G. D., Forsyth, R. G., Praet, M. M., & Hogendoorn, P. C. W. (2008) · The Journal of Pathology · doi:10.1002/path.2500 · Cited by 102
“Telomeres without a G-tail are substrates for non-homologous end joining, resulting in telomere–telomere fusion and formation of dicentric and multicentric chromosomes [54,61].”
BackgroundZhou, G., Liu, X., Li, Y., Xu, S., Ma, C., Wu, X., Cheng, Y., Yu, Z., Zhao, G., & Chen, Y. (2016) · Oncotarget · doi:10.18632/oncotarget.7483 · Cited by 107
“To address the molecular mechanism associated with growth arrest and accelerated senescence induced by BRACO-19, immunoblottings were performed to investigate changes in the expression of p53 and p21 proteins, which have been considered as key regulators of cell cycle and cellular senescence [28, 44, 45].”
BackgroundInvolvement of the INK4a/Arf gene locus in senescence
Collins, C. J., & Sedivy, J. M. (2003) · Aging Cell · doi:10.1046/j.1474-9728.2003.00048.x · Cited by 113
Telomerase therapy reverses vascular senescence and extends lifespan in progeria mice
Mojiri, A., Walther, B. K., Jiang, C., Matrone, G., Holgate, R., Xu, Q., Morales, E., Wang, G., Gu, J., Wang, R., et al. (2021) · European Heart Journal · doi:10.1093/eurheartj/ehab547 · Cited by 97
MDC1 accelerates nonhomologous end-joining of dysfunctional telomeresPreprint
Dimitrova, N., & de Lange, T. (2006) · Genes & Development · doi:10.1101/gad.1496606 · Cited by 98
“…corner of the article or Receive free email alerts when new articles cite this article - sign up in the box at the Notes http://www.genesdev.org/subscriptions/ go to: Genes and DevelopmentTo subscribe to © 2006 Cold Spring Harbor Laboratory Press on December 15, 2006 www.genesdev.orgDownloaded from”
BackgroundMethodMallette, F. A., Goumard, S., Gaumont‐Leclerc, M., Moiseeva, O. V., & Ferbeyre, G. (2004) · Oncogene · doi:10.1038/sj.onc.1206886 · Cited by 99
The cellular level of telomere dysfunction determines induction of senescence or apoptosis in vivo
Lechel, A., Ande, S., Ju, Z., Plentz, R. R., Schaetzlein, S., Rudolph, C., Wilkens, L., Wiemann, S. U., Saretzki, G. C., Malek, N. P., et al. (2005) · EMBO Reports · doi:10.1038/sj.embor.7400352 · Cited by 88
BRCA1 Inhibition of Telomerase Activity in Cultured Cells
Xiong, J., Fan, S., Meng, Q., Schramm, L., Wang, C., Bouzahza, B., Zhou, J., Zafonte, B. T., Goldberg, I. D., Haddad, B. R., et al. (2003) · Molecular and Cellular Biology · doi:10.1128/mcb.23.23.8668-8690.2003 · Cited by 96
“Critically short telomeres may cause senescence, in part, by activating a p53/p21 pathway and/or a p16/Rb1 pathway (55).”
BackgroundTelomere repeat binding factors: keeping the ends in check
Karlseder, J. (2003) · Cancer Letters · doi:10.1016/s0304-3835(02)00706-1 · Cited by 88
Cudré-Mauroux, C., Occhiodoro, T., König, S., Salmon, P., Bernheim, L., & Trono, D. (2003) · Human Gene Therapy · doi:10.1089/104303403322495034 · Cited by 86
p16INK4a as a Second Effector of the Telomere Damage Pathway
Jacobs, J. J. L., & de Lange, T. (2005) · Cell Cycle · doi:10.4161/cc.4.10.2104 · Cited by 87
Telomeres: Implications for Cancer Development
Bernal, A., & Tusell, L. (2018) · International Journal of Molecular Sciences · doi:10.3390/ijms19010294 · Cited by 92
“Depletion of the shelterin proteins POT1a/b, or TRF2, in p53 defective mice, produced persistent telomeric DNA damage signalling that leads to the progressive accumulation of polyploid cells containing duplo- and quadruplo-chromosomes [103,131].”
BackgroundThioredoxin (Trx): A redox target and modulator of cellular senescence and aging-related diseases
Yang, B., Lin, Y., Huang, Y., Shen, Y.-Q., & Chen, Q. (2024) · Redox Biology · doi:10.1016/j.redox.2024.103032 · Cited by 94
“TRF2 forms t-loop structures that provide protection for telomeres from the DNA damage response and hinders the activation of ATM and NHEJ pathways, which can lead to telomere fusion and chromosomal instability [91,111,112].”
BackgroundTumor suppression by p53: making cells senescent.
Qian, Y., & Chen, X. (2010) · PubMed · doi:10.14670/hh-25.515 · Cited by 85
Dysfunctional mammalian telomeres join with DNA double-strand breaks
Bailey, S. M., Cornforth, M. N., Ullrich, R. L., & Goodwin, E. H. (2004) · DNA repair · doi:10.1016/j.dnarep.2003.11.007 · Cited by 87
Cellular senescence and DNA repair
Lou, Z., & Chen, J. (2006) · Experimental Cell Research · doi:10.1016/j.yexcr.2006.06.009 · Cited by 82
The kinase activity of DNA-PK is required to protect mammalian telomeres
Bailey, S. M., Brenneman, M. A., Halbrook, J., Nickoloff, J. A., Ullrich, R. L., & Goodwin, E. H. (2003) · DNA repair · doi:10.1016/j.dnarep.2003.10.013 · Cited by 83
Mukherjee, A. K., Sharma, S., Sengupta, S., Saha, D., Kumar, P., Hussain, T., Srivastava, V. K., Roy, S. D., Shay, J. W., & Chowdhury, S. (2018) · PLoS Genetics · doi:10.1371/journal.pgen.1007782 · Cited by 77
Ford, J. H. (2010) · AGE · doi:10.1007/s11357-009-9128-x · Cited by 79
“In humans, both the p53 gene and the RB1 (retinoblastoma) gene monitor telomere function but in mice the p53 gene seems to be the only gene involved ( Smogorzewska and de Lange 2002 ).”
BackgroundRhodes, D., Fairall, L., Simonsson, T., Court, R., & Chapman, L. (2002) · EMBO Reports · doi:10.1093/embo-reports/kvf246 · Cited by 82
Role of Telomeres and Telomeric Proteins in Human Malignancies and Their Therapeutic Potential
Fernandes, S. G., Dsouza, R., Pandya, G., Kirtonia, A., Tergaonkar, V., Lee, S. Y., Garg, M., & Khattar, E. (2020) · Cancers · doi:10.3390/cancers12071901 · Cited by 80
Ande, S., Greenberg, R. A., Schaetzlein, S., Buer, J., Masutomi, K., Hahn, W. C., Zimmermann, S., Martens, U. M., Manns, M. P., & Rudolph, K. L. (2004) · Molecular and Cellular Biology · doi:10.1128/mcb.24.12.5459-5474.2004 · Cited by 81
“6B), in line with previously identified species differences in the regulation of p16 during senescence in mouse and human cells (49).”
BackgroundAging of stromal-derived human breast fibroblasts might contribute to breast cancer progression
Sieuwerts, A. M., Vries, J. B.-D., Bosma, P. T., Swiggers, S. J. J., Klijn, J. G. M., Foekens, J. A., & Martens, J. W. M. (2003) · Thrombosis and Haemostasis · doi:10.1055/s-0037-1613457 · Cited by 79
Telomerase-independent Regulation of ATR by Human Telomerase RNA
Kedde, M., le Sage, C., Duursma, A. M., Zlotorynski, E., van Leeuwen, B., Nijkamp, W., Beijersbergen, R. L., & Agami, R. (2006) · Journal of Biological Chemistry · doi:10.1074/jbc.m607676200 · Cited by 78
Effects of Telomerase Modulation in Human Hematopoietic Progenitor Cells
Zimmermann, S., Glaser, S., Ketteler, R., Waller, C. F., Klingmüller, U., & Martens, U. M. (2004) · Stem Cells · doi:10.1634/stemcells.22-5-741 · Cited by 75
Making ends meet in old age: DSB repair and aging
Gorbunova, V. A., & Seluanov, A. (2005) · Mechanisms of Ageing and Development · doi:10.1016/j.mad.2005.02.008 · Cited by 74
Masutomi, K., & Hahn, W. C. (2003) · Cancer Letters · doi:10.1016/s0304-3835(02)00703-6 · Cited by 75
“It should be noted that in mice, shortened dysfunctional telomeres generate signals dependent upon the activity of the p53 pathway, while in human cells such signals appear to activate both the pRB and p53 pathways [74].”
BackgroundCellular senescence: a hitchhiker’s guide
Aravinthan, A. D. (2015) · Human Cell · doi:10.1007/s13577-015-0110-x · Cited by 83
“In humans, telomere dysfunction has also been shown to induce p16 [81].”
BackgroundMelanoma Cells Express Elevated Levels of Phosphorylated Histone H2AX Foci
Warters, R. L., Adamson, P. J., Pond, C. D., & Leachman, S. A. (2005) · Journal of Investigative Dermatology · doi:10.1111/j.0022-202x.2005.23674.x · Cited by 77
Hiding at the ends of yeast chromosomes: Telomeres, nucleases and checkpoint pathways
Lydall, D. (2003) · Journal of Cell Science · doi:10.1242/jcs.00765 · Cited by 72
Telomere Dysfunction and DNA-PKcs Deficiency: Characterization and Consequence
Williams, E. S., Klingler, R., Ponnaiya, B., Hardt, T., Schröck, E., Lees‐Miller, S. P., Meek, K., Ullrich, R. L., & Bailey, S. M. (2009) · Cancer Research · doi:10.1158/0008-5472.can-08-2854 · Cited by 73
“SCID p53 / and BALB/c p53 / fibroblasts exposed to IR (1 and 2 Gy of (137)Cs g-rays) were collected for analyses; absence of p53 facilitated continued cycling of mouse cells despite telomere dysfunction (35).”
MethodTelomerase Maintains Telomere Structure in Normal Human Cells
Masutomi, K., Yu, E. Y., Khurts, S., Ben-Porath, I., Currier, J. L., Metz, G. B., Brooks, M. W., Kaneko, S., Murakami, S., DeCaprio, J. A., et al. (2003) · Cell · doi:10.1016/s0092-8674(03)00550-6 · Cited by 70
Genome-wide Control of Heterochromatin Replication by the Telomere Capping Protein TRF2
Méndez-Bermúdez, A., Lototska, L., Bauwens, S., Giraud-Panis, M.-J. E., Croce, O., Jamet, K., Irizar, A., Mowinckel, M., Koundrioukoff, S., Nottet, N., et al. (2018) · Molecular Cell · doi:10.1016/j.molcel.2018.03.036 · Cited by 68
Sławińska, N., & Krupa, R. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22020590 · Cited by 68
“premature senescence resembling replicative ageing [29].”
BackgroundDisappearance of the Telomere Dysfunction-Induced Stress Response in Fully Senescent Cells
Bakkenist, C. J., Drissi, R., Wu, J., Kastan, M. B., & Dome, J. S. (2004) · Cancer Research · doi:10.1158/0008-5472.can-04-0453 · Cited by 68
“Experiments in which telomeres were artificially “uncapped” by the inhibition of TRF2 binding have demonstrated that lymphocytes undergo apoptosis in a p53- and ATM-dependent manner and fibroblasts undergo senescence in a p53- and Rb-dependent manner (7, 8).”
BackgroundThe Spectrum of Fundamental Basic Science Discoveries Contributing to Organismal Aging
Farr, J. N., & Almeida, M. (2018) · Journal of Bone and Mineral Research · doi:10.1002/jbmr.3564 · Cited by 70
“The phosphorylation of histone H2AX activates the transducer kinases Chk1 and Chk2, which converge on p53/p21 and p16.((12)) Additionally, the DDR stimulates the senescenceassociated secretory phenotype (SASP) by upregulating GATA4 and NF-kB.”
BackgroundHwang, H. H., Kreig, A., Calvert, J. S., Lormand, J. D., Kwon, Y., Daley, J. M., Sung, P., Opresko, P. L., & Myong, S. (2014) · Structure · doi:10.1016/j.str.2014.03.013 · Cited by 71
“The progressive telomere attrition results in replicative senescence, growth arrest or apoptosis (Karlseder et al., 1999; Smogorzewska and de Lange, 2002).”
BackgroundQi, L., Strong, M. A., Karim, B. O., Armanios, M. Y., Huso, D. L., & Greider, C. W. (2003) · PubMed · Cited by 68
Replicative senescence and the art of counting
von Zglinicki, T. (2003) · Experimental Gerontology · doi:10.1016/j.exger.2003.09.015 · Cited by 69
Telomeres and chromosomal instability
Mathieu, N., Pirzio, L. M., Freulet-Marrière, M.-A., Desmaze, C., & Sabatier, L. (2004) · Cellular and Molecular Life Sciences · doi:10.1007/s00018-003-3296-0 · Cited by 69
Genetic Pathways of Aging and Their Relevance in the Dog as a Natural Model of Human Aging
Sándor, S., & Kubinyi, E. (2019) · Frontiers in Genetics · doi:10.3389/fgene.2019.00948 · Cited by 68
Telomeres and Cancer: Resolving the Paradox
Nassour, J., Schmidt, T. T., & Karlseder, J. (2021) · Annual Review of Cancer Biology · doi:10.1146/annurev-cancerbio-050420-023410 · Cited by 70
Chromosome instability in neoplasia: chaotic roots to continuous growth
Gagos, S., & Irminger‐Finger, I. (2005) · The International Journal of Biochemistry & Cell Biology · doi:10.1016/j.biocel.2005.01.003 · Cited by 64
p16 and ARF: activation of teenage proteins in old age
Ande, S., & Rudolph, K. L. (2004) · Journal of Clinical Investigation · doi:10.1172/jci23437 · Cited by 64
Quantitative theory of telomere length regulation and cellular senescence
Rodriguez-Brenes, I. A., & Peskin, C. S. (2010) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0914502107 · Cited by 62
Else, T., Trovato, A., Kim, A. C., Wu, Y., Ferguson, D. O., Kuick, R. D., Lucas, P. C., & Hammer, G. D. (2009) · Cancer Cell · doi:10.1016/j.ccr.2009.04.011 · Cited by 62
Yang, Y.-C., Fu, H., Wu, C., Wei, K.-T., Huang, K., & Kang, H. (2013) · PLoS ONE · doi:10.1371/journal.pone.0079434 · Cited by 62
“Expression of p16 is induced by numerous stressors, including oxidative stress [42], overexpression of oncogenes [43,44], and DNA damage [45,46].”
BackgroundTelomere dysfunction and genome instability
Frías-López, C. (2012) · Frontiers in bioscience · doi:10.2741/4044 · Cited by 66
Telomere dysfunction and cell survival: roles for distinct TIN2-containing complexes
Kim, S., Davalos, A. R., Heo, S., Rodier, F., Zou, Y. S., Beausejour, C. M., Kaminker, P. G., Yannone, S. M., & Campisi, J. (2008) · The Journal of Cell Biology · doi:10.1083/jcb.200710028 · Cited by 62
“By contrast, cell death or growth inhibition due to expression of DN-TRF2 is p53dependent (Karlseder et al., 1999; Smogorzewska and De Lange, 2002).”
BackgroundTelomere structure, function and maintenance in Arabidopsis
Říha, K., & Shippen, D. E. (2003) · Chromosome Research · doi:10.1023/a:1022892010878 · Cited by 61
“However, proliferation capacity of telomerase-de¢cient mouse cells can be substantially extended by mutations in p53, but all cells ultimately succumbto genome catastrophe (Chin et al. 1999, Artandi et al. 2000, Smogorzewska & de Lange 2002 ).”
BackgroundGeneration of Telomeric G Strand Overhangs Involves Both G and C Strand Cleavage
Jacob, N. K., Kirk, K. E., & Price, C. M. (2003) · Molecular Cell · doi:10.1016/s1097-2765(03)00131-x · Cited by 59
Kokhaei, P., Palma, M., Hansson, L., Österborg, A., Mellstedt, H., & Choudhury, A. (2007) · Experimental Hematology · doi:10.1016/j.exphem.2006.10.006 · Cited by 60
Give me a break: How telomeres suppress the DNA damage response
Denchi, E. L. (2009) · DNA repair · doi:10.1016/j.dnarep.2009.04.013 · Cited by 61
A porcine model of osteosarcoma
Saalfrank, A., Janssen, K., Ravon, M., Flisikowski, K., Eser, S., Steiger, K., Flisikowska, T., Müller-Fliedner, P., Schulze, É. A., Brönner, C., et al. (2016) · Oncogenesis · doi:10.1038/oncsis.2016.19 · Cited by 58
Telomeres and cancer: a tale with many endings
Blasco, M. A. (2003) · Current Opinion in Genetics & Development · doi:10.1016/s0959-437x(02)00011-4 · Cited by 56
Telomeric DNA induces apoptosis and senescence of human breast carcinoma cells
Yaar, M., Eller, M. S., Panova, I. P., Kubera, J., Wee, L. H., Cowan, K. H., & Gilchrest, B. A. (2007) · Breast Cancer Research · doi:10.1186/bcr1646 · Cited by 56
“Consistent with our hypothesis, the same molecular pathways leading to apoptosis/senescence are activated by either Toligo treatment or telomere loop disruption through ectopic expression of TRF2DN in either MCF-7 cells in the present study or in fibroblasts as reported by our group [65] and other investigators [10,66…”
ResultLajoie, V., Lemieux, B., Sawan, B., Lichtensztejn, D., Lichtensztejn, Z., Wellinger, R. J., Mai, S., & Knecht, H. (2015) · Blood · doi:10.1182/blood-2014-08-594176 · Cited by 56
Han, R., Li, L., Ugalde, A. P., Tal, A., Manber, Z., Barberà, E. P., Chiara, V. D., Elkon, R., & Agami, R. (2018) · Genome biology · doi:10.1186/s13059-018-1494-1 · Cited by 53
Effects of the leukemia-associated AML1-ETO protein on hematopoietic stem and progenitor cells
Nimer, S. D., & Moore, M. A. S. (2004) · Oncogene · doi:10.1038/sj.onc.1207673 · Cited by 55
Regulation of Senescence in Cancer and Aging
Kong, Y., Cui, H., Ramkumar, C., & Zhang, H. (2011) · Journal of Aging Research · doi:10.4061/2011/963172 · Cited by 61
“There is indeed an example showing that telomere dysfunction induces p16 expression [69].”
BackgroundTelomere function and regulation from mouse models to human ageing and disease
Jones-Weinert, C. W., Mainz, L., & Karlseder, J. (2024) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-024-00800-5 · Cited by 63
“TIFs activate p53–p21 and p16 INK4a checkpoints, which leads to retinoblastoma-protein-dependent cellular senescence (hereinafter referred to as senescence) 18–20 .”
Erusalimsky, J. D., & Kurz, D. J. (2006) · Springer eBooks · doi:10.1007/3-540-36028-x_7 · Cited by 57
Beccaria, M. G., Martínez, P., Méndez‐Pertuz, M., Martínez, S., Blanco‐Aparicio, C., Cañamero, M., Mulero, F., Ambrogio, C., Flores, J. M., Megías, D., et al. (2015) · EMBO Molecular Medicine · doi:10.15252/emmm.201404497 · Cited by 57
Transient telomere dysfunction induces chromosomal instability and promotes carcinogenesis
Begus‐Nahrmann, Y., Hartmann, D., Kraus, J. M., Eshraghi, P., Scheffold, A., Grieb, M., Rasche, V., Schirmacher, P., Lee, H.-W., Kestler, H. A., et al. (2012) · Journal of Clinical Investigation · doi:10.1172/jci61745 · Cited by 61
“The molecular pathways of chromosomal fusion formation show differences when telomere dysfunction is induced by telomere shortening or TRF2 inhibition (21).”
BackgroundKhoo, C. M., Carrasco, D. R., Bosenberg, M. W., Paik, J.-H., & DePinho, R. A. (2007) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0700093104 · Cited by 52
A mathematical model of cellular apoptosis and senescence through the dynamics of telomere loss
Arkus, N. (2005) · Journal of Theoretical Biology · doi:10.1016/j.jtbi.2004.12.016 · Cited by 53
“…that, at the point of cell death and replicative senescence, cells contain significantly shortened telomeres and exhibit a dramatic increase in telomere fusions and in the number of dicentric chromosomes (Arino et al., 1995; Counter et al., 1992; Levy et al., 1992; Smogorzewska et al., 2002).”
BackgroundTINF2 is a haploinsufficient tumor suppressor that limits telomere length
Schmutz, I., Mensenkamp, A. R., Takai, K., Haadsma, M., Spruijt, L., de Voer, R. M., Choo, S.-A. S., Lorbeer, F. K., van Grinsven, E. J., Hockemeyer, D. F., et al. (2020) · eLife · doi:10.7554/elife.61235 · Cited by 56
Maurelli, R., Zambruno, G., Guerra, L., Abbruzzese, C., Dimri, G. P., Gellini, M., Bondanza, S., & Dellambra, E. (2006) · The FASEB Journal · doi:10.1096/fj.05-4480fje · Cited by 54
Nucleolar localization of the human telomeric repeat binding factor 2 (TRF2)
Zhang, S., Hemmerich, P. H., & Große, F. (2004) · Journal of Cell Science · doi:10.1242/jcs.01249 · Cited by 56
“This may suggest some species-related differences of telomere metabolism as already noted before (Smogorzewska and de Lange, 2002).”
BackgroundResultMolecular events in kidney ageing
Famulski, K. S., & Halloran, P. F. (2005) · Current Opinion in Nephrology and Hypertension · doi:10.1097/01.mnh.0000165890.60254.4e · Cited by 53
Ghareghomi, S., Ahmadian, S., Zarghami, N., & Kahroba, H. (2020) · Biochimie · doi:10.1016/j.biochi.2020.11.015 · Cited by 53
Metadata
- Authors
- Smogorzewska, A., & de Lange, T.
- Affiliations
- Rockefeller University (US)
- ORCID
- Smogorzewska, Agata
- Venue
- The EMBO Journal
- Published
- 2002-08-15
- Volume
- 21
- Issue
- 16
- Pages
- 4338-4348
- ISSN
- 0261-4189 (ISSN-L)
- 1460-2075
- PMC
- PMC126171
- OpenAlex
- W2126815966
- Cited by
- 482
- References
- 55
- Citations by year
- 2026: 4 · 2025: 8 · 2024: 11 · 2023: 9 · 2022: 3 · 2021: 16 · 2020: 10 · 2019: 9 · 2018: 17 · 2017: 13 · 2016: 14 · 2015: 19 · 2014: 14 · 2013: 20 · 2012: 25
- FWCI
- 28.62
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Locations
- The EMBO Journal (publishedVersion)
- Europe PMC (PubMed Central) (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Funders
- Ellison Medical Foundation
- Memorial Sloan-Kettering Cancer Center
- National Institutes of Health
- National Institute on Aging (AG 16643)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Cell Biology › Telomeres, Telomerase, and Senescence
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Aging › Genetics, Aging, and Longevity in Model Organisms
- Health Sciences › Medicine › Oncology › Cancer-related Molecular Pathways
- Keywords
- premature senescence, TRF2, p53, p16/Rb pathway, replicative senescence, tumor suppressor pathways, human-mouse differences, growth arrest, telomere dysfunction
- MeSH terms
- Animals, Cell Line, Chromosome Aberrations, DNA Damage, DNA-Binding Proteins, Fibroblasts, Humans, Signal Transduction, Tumor Suppressor Protein p53, Telomere, Cellular Senescence, Cyclin-Dependent Kinase Inhibitor p16, Telomeric Repeat Binding Protein 2, Mice
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
