Vibrio vulnificus in aquariums is a novel threat to marine mammals and public health
Open accessAbstract
Vibrio vulnificus is a Gram-negative, curved, obligate halophilic marine bacterium that exclusively exists in coastal seawaters. Previous studies revealed that V. vulnificus is one of the most dangerous foodborne zoonotic pathogens for human beings. However, it remains unknown whether marine mammals can be infected by V. vulnificus. In May 2016, a captive spotted seal (Phoca largha) died due to septicemia induced by V. vulnificus. Upon post-mortem examination, V. vulnificus was isolated, identified, and named as BJ-PH01. Further analysis showed that BJ-PH01 belongs to biotype 1 and the Clinical genotype. Furthermore, we performed an epidemiological investigation of V. vulnificus in six aquariums in northern China. As a result, V. vulnificus was successfully isolated from all investigated aquariums. The positive rates ranged from 20% to 100% in each investigated aquarium. During the investigation, 12 strains of V. vulnificus were isolated, and all 12 isolates were classified into biotype 1. Eleven of the 12 isolates belonged to the Clinical genotype, and one isolate belonged to the Environmental genotype. All 12 isolated V. vulnificus strains showed limited antibiotic resistance. Overall, our work demonstrated that V. vulnificus is frequently distributed in aquariums, thus constituting a threat to captive marine mammals and to public health.
AI snapshot
Written from the paper’s full text.
TL;DR
A captive spotted seal died from *Vibrio vulnificus* septicemia, and subsequent sampling found *V. vulnificus* in all six investigated aquariums in northern China. The authors conclude that aquarium *V. vulnificus* poses a threat to captive marine mammals and public health.
Key findings
- A captive spotted seal (*Phoca largha*) died in May 2016 due to septicemia induced by *V. vulnificus*; the isolate BJ-PH01 was recovered from fester, blood, lung, liver, intestine, and spleen, and no known viral pathogens were detected.
- In six aquariums in northern China, *V. vulnificus* was isolated from all six; among 54 samples, the average positive rate was 44.4%, ranging from 20% to 100% per aquarium, and 12 strains were isolated.
- All 12 isolates were biotype 1; 11 of 12 belonged to the Clinical genotype and 1 to the Environmental genotype; all were positive for *ary*, *mtlABC*, and *nanA*, and all were sensitive to levofloxacin, tetracycline, piperacillin, and gentamicin, with no drug-resistant isolates.
- In mice, the median lethal dose of BJ-PH01 was 3.16 × 10⁵ CFU; infected mice showed severe hemorrhage, lung and intestinal edema/hemorrhage, and *V. vulnificus* was re-isolated from dead mice.
Methods
- Post-mortem and microbiological analysis of the dead seal: tissue samples cultured on blood, MacConkey, chocolate, and TCBS agar; colonies identified by 16S rDNA sequencing, BD Phoenix system, and species-specific PCR; viral PCR tested for type A influenza virus, phocine distemper virus, coronavirus, and rotavirus.
- Epidemiological investigation: 54 water and animal body-surface swab samples from six aquariums in northern China, with freshwater samples as negative controls; processed per FDA Bacteriological Analytical Manual using APW enrichment, blood agar culture, *vvhA* PCR, 16S rDNA sequencing, and BD Phoenix.
- Isolate characterization: biotyping by biochemical tests; genotyping by PCR for *vcg*, *serE*, *cps*, *bt2*, *ary*, *mtlABC*, and *nanA*; antibiotic susceptibility by Kirby-Bauer disk diffusion; mouse infection with BJ-PH01 via intraperitoneal or intramuscular injection in 6-week-old female BALB/c mice (n = 4 per group).
Limitations
- Stated: the authors could not perform Koch’s postulates because they could not confirm infection using a healthy seal; typical clinical manifestations in infected seals are poorly understood, and diagnosis relied mainly on detection/isolation from visceral tissues and blood.
- Stated: risk assessment is difficult because *V. vulnificus* is opportunistic and requires predisposing factors, the minimum infectious dose is poorly understood even in humans, and the interface between *V. vulnificus* and wild marine mammals has never been studied.
- Evident from the text: the epidemiological sample is small (54 samples, 12 isolates) and geographically limited to six aquariums in northern China; no marine mammal challenge experiment was performed, and the mouse model may not fully reflect seal or human disease.
Model-written summary. Check it against the paper before relying on it.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
10 of 18 cited sources checked · 3 supported · 0 flagged · accuracy not yet measured
- Premisecitation
Oral ingestion of contaminated raw or uncooked seafood mainly leads to primary septicemia.
“Oral ingestion mainly leads to primary septicemia when people consume contaminated raw or uncooked seafood (Kim, Bae, Ma, & Kim, 2015).”
Quote in the paperNot a substantial claim1 of 1 sources checked- cites Kim, Bae, Ma, & Kim, 2015 source
The Background reports severe septicemia after the patient ingested raw seafood, supporting the link between ingestion and septicemia. It does not say that oral ingestion mainly leads to primary septicemia; the Conclusions describe this patient's peritonitis as preceding her septicemia. No page numbers are available in our copy. (LLM, conf=0.84)
Experimental — accuracy not yet measured
- Premisecitation
The ary gene is associated with virulence of clinical strains by providing sulfur within the host, thus providing an immune evasion approach.
“The ary gene has been demonstrated to be associated with virulence of clinical strains by providing a pathogen with sulfur within the host, thus providing an immune evasion approach (Morrison et al., 2012).”
Quote in the paperNot a substantial claim1 of 1 sources checked- cites Morrison et al., 2012 source
The Results and Discussion section, under “Arylsulfatases” (page unavailable), reports that an arylsulfatase gene cluster distinguishes clinical C-genotype from environmental E-genotype strains and that the enzymes release sulfate. It suggests the cluster may aid survival in the sulfur-limited human gut, but does not demonstrate that it causes virulence or describe immune evasion. (LLM, conf=0.89)
Experimental — accuracy not yet measured
- Premisecitation
V. vulnificus can survive under nutrient starvation in seawater for years without losing its pathogenic potential for animals and humans.
“Previous studies have demonstrated that V. vulnificus can survive under nutrient starvation in seawater for years without losing its pathogenic potential for animals and humans (Marco-Noales, Biosca, & Amaro, 1999).”
Quote in the paperSubstantial claim1 of 1 sources checked- cites Marco-Noales, Biosca, & Amaro, 1999 source
- Findingown data
BJ-PH01 grew opaque colonies on blood agar.
“As shown in Figure 2b, the V. vulnificus isolate BJ-PH01 grew opaque colonies on blood agar.”
Quote in the paperSubstantial claim - Findingown data
BJ-PH01 belongs to the Clinical genotype.
“Further analysis showed that BJ-PH01 belongs to biotype 1 and the Clinical genotype.”
Quote in the paperNot a substantial claim
- Findingown data
The average positive rate of V. vulnificus across the six aquariums was 44.4%.
“The average positive rate was 44.4%, ranging from 20% to 100% (Table 2).”
Quote in the paperSubstantial claim - Findingown data
All isolated V. vulnificus strains were positive for the nanA gene by PCR.
“Positive nanA gene PCR results were obtained for all of the isolated strains.”
Quote in the paperSubstantial claim - Findingown data
Eleven of the 12 isolated V. vulnificus strains belonged to the Clinical genotype.
“Eleven of the 12 isolates belonged to the Clinical genotype, and one isolate belonged to the Environmental genotype.”
Quote in the paperSubstantial claim - Findingown data
One of the 12 isolated V. vulnificus strains belonged to the Environmental genotype.
“Eleven of the 12 isolates belonged to the Clinical genotype, and one isolate belonged to the Environmental genotype.”
Quote in the paperNot a substantial claim - Findingown data
V. vulnificus was isolated from all six investigated aquariums in northern China.
“As a result, V. vulnificus was successfully isolated from all investigated aquariums.”
- Also stated in: § 3.3 | Epidemiological investigation of V. vulnificus in aquariums in northern China · plain
“V. vulnificus was isolated from all six of the investigated aquariums.”
Quote in the paperSubstantial claim - Also stated in: § 3.3 | Epidemiological investigation of V. vulnificus in aquariums in northern China · plain
- Findingown data
All isolated V. vulnificus strains were positive for mtlABC by PCR.
“In our experiments, we obtained positive mtlABC results for all of the isolated strains.”
Quote in the paperSubstantial claim - Findingown data
Severe hemorrhage was observed at the inoculation site and tails of mice infected with BJ-PH01.
“Severe hemorrhage was observed at the inoculation site and tails (Figure 3a).”
Quote in the paperSubstantial claim - Findingown data
V. vulnificus was isolated from the dead seal's fester, blood, and several tissue samples (lung, liver, intestine, spleen).
“In addition, V. vulnificus was successfully isolated from the fester, blood, and several tissue samples (i.e., lung, liver, intestine, and spleen) (Figure 2b).”
Quote in the paperSubstantial claim - Findingown data
All 12 isolated V. vulnificus strains belonged to biotype 1.
“The results indicated that all 12 isolated strains belonged to biotype 1.”
Quote in the paperNot a substantial claim - Findingown data
Twelve strains of V. vulnificus were isolated from the aquariums.
“During the investigation, 12 strains of V. vulnificus were isolated, and all 12 isolates were classified into biotype 1.”
Quote in the paperSubstantial claim - Findingown data
No drug-resistant V. vulnificus isolates were isolated.
“No drug-resistant V. vulnificus isolates were isolated.”
Quote in the paperNot a substantial claim - Findingown data
The positive rate of V. vulnificus in each investigated aquarium ranged from 20% to 100%.
“The positive rates ranged from 20% to 100% in each investigated aquarium.”
Quote in the paperSubstantial claim - Findingown data
BJ-PH01 belongs to biotype 1.
“Further analysis showed that BJ-PH01 belongs to biotype 1 and the Clinical genotype.”
Quote in the paperNot a substantial claim - Findingown data
V. vulnificus could be re-isolated from the dead mice.
“Furthermore, extensive edema and hemorrhage were noted in the lungs (Figure 3b) and intestines of the dead mice (Figure 3c), and V. vulnificus could be re-isolated from the dead mice.”
Quote in the paperSubstantial claim - Findingown data
All isolated V. vulnificus strains were positive for the ary gene by PCR.
“Positive Ary PCRs were obtained in all of the isolated strains.”
Quote in the paperSubstantial claim - Findingown data
Extensive edema and hemorrhage were noted in the lungs and intestines of dead mice infected with BJ-PH01.
“Furthermore, extensive edema and hemorrhage were noted in the lungs (Figure 3b) and intestines of the dead mice (Figure 3c), and V. vulnificus could be re-isolated from the dead mice.”
Quote in the paperSubstantial claim - Findingown data
In addition to V. vulnificus, other opportunistic pathogens of the Vibrio genus (Vibrio parahaemolyticus, Vibrio alginolyticus, and Vibrio fluvialis) were detected in this investigation.
“In addition to V. vulnificus, other opportunistic pathogens of the Vibrio genus were also detected in this investigation, such as Vibrio parahaemolyticus, Vibrio alginolyticus, and Vibrio fluvialis.”
Quote in the paperSubstantial claim - Interpretationcitation
BJ-PH01 is virulent in animal models.
“This result prompted us to consider that BJ-PH01 is virulent in animal models (Simpson, White, Zane, & Oliver, 1987).”
Quote in the paperSubstantial claim0 of 1 sources checked- cites Simpson, White, Zane, & Oliver, 1987 source
- Rests on an assumption: Possession of an antiphagocytic capsule is one of the absolute requirements for V. vulnificus virulence.
- Rests on an assumption: Encapsulated V. vulnificus cells produce opaque colonies, and only opaque cells are able to utilize transferrin-bound iron.
- Interpretationown data
A captive spotted seal died due to septicemia induced by V. vulnificus in May 2016.
“In May 2016, a captive spotted seal (Phoca largha) died due to septicemia induced by V. vulnificus.”
- Also stated in: § 3.1 | A spotted seal died due to V. vulnificus infection · hedged
“These results suggested that the seal died due to septicemia induced by V. vulnificus.”
Quote in the paperSubstantial claim0 of 1 sources checked- cites Bross, Soch, Morales, & Mitchell, 2007b
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Also stated in: § 3.1 | A spotted seal died due to V. vulnificus infection · hedged
- Interpretationown data
V. vulnificus in aquariums constitutes a threat to captive marine mammals.
“Overall, our work demonstrated that V. vulnificus is frequently distributed in aquariums, thus constituting a threat to captive marine mammals and to public health.”
Quote in the paperSubstantial claim - Study design and conductcitation
The diagnosis of V. vulnificus-induced septicemia was mainly based on detection and isolation of V. vulnificus from visceral tissues and blood.
“We provided a diagnosis mainly based on the detection and isolation of V. vulnificus from the visceral tissues and blood, which indicated that V. vulnificus induced septicemia (Bross, Soch, Morales, & Mitchell, 2007b).”
Quote in the paperSubstantial claim0 of 1 sources checked- cites Bross, Soch, Morales, & Mitchell, 2007b
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
- Interpretationown data
V. vulnificus in aquariums constitutes a threat to public health.
“Overall, our work demonstrated that V. vulnificus is frequently distributed in aquariums, thus constituting a threat to captive marine mammals and to public health.”
Quote in the paperSubstantial claim - Study design and conductown data
The study failed to perform Koch's postulate test because it was impossible to confirm infection using a healthy seal.
“The major limitation of our research is that we failed to perform Koch's postulate test because it was impossible for us to confirm the infection using a healthy seal.”
Quote in the paperNot a substantial claim - Interpretationreasoning
The 12 isolated V. vulnificus strains display a potential threat to mammals, including marine animals and humans.
“These results indicate that the 12 isolated V. vulnificus strains display a potential threat to mammals, including marine animals and humans.”
Quote in the paperSubstantial claim - Interpretationown data
V. vulnificus is not the only threat to marine animals and public health in aquariums.
“These results suggest that V. vulnificus is not the only threat to marine animals and public health in aquariums.”
Quote in the paperSubstantial claim - Interpretationreasoning
The prevalence of V. vulnificus is a persistent threat to marine mammals.
“Nevertheless, the prevalence of V. vulnificus is a persistent threat to marine mammals.”
Quote in the paperSubstantial claim - Interpretationreasoning
V. vulnificus in aquariums constitutes a novel threat to marine animals, workers, and tourists in relevant aquariums.
“Epidemiological investigations of V. vulnificus showed that this lethal bacterium can frequently be detected in aquariums, thus constituting a novel threat to marine animals, workers, and tourists in relevant aquariums.”
Quote in the paperSubstantial claim - Interpretationown data
Marine mammals can be infected by V. vulnificus.
“Here, we provide evidence that marine mammals can also be infected by V. vulnificus.”
- Also stated in: § 4 | DISCUSSION · boosted
“We demonstrated that V. vulnificus can infect and kill marine mammals.”
Quote in the paperSubstantial claim - Also stated in: § 4 | DISCUSSION · boosted
- Interpretationown data
Spotted seals can be infected by V. vulnificus.
“Here, we demonstrated that spotted seals can be infected by V. vulnificus.”
Quote in the paperSubstantial claim - Interpretationown data
V. vulnificus is frequently distributed in aquariums.
“Overall, our work demonstrated that V. vulnificus is frequently distributed in aquariums, thus constituting a threat to captive marine mammals and to public health.”
- Also stated in: § 4 | DISCUSSION · plain
“Epidemiological investigations of V. vulnificus showed that this lethal bacterium can frequently be detected in aquariums, thus constituting a novel threat to marine animals, workers, and tourists in relevant aquariums.”
Quote in the paperSubstantial claim - Also stated in: § 4 | DISCUSSION · plain
- Classified as probably not a substantial claim. 10
- May combine two claims. 4
- The quote only partly states this claim. 1
Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.
PremisecitationWound infection is generally acquired through exposure of a preexisting wound to contaminated seawater or shellfish, resulting in fulminant necrotizing skin and soft tissue infections.
“Wound infection is generally acquired through the exposure of a preexisting wound to contaminated seawater or shellfish, resulting in fulminant necrotizing skin and soft tissue infections (Huang et al., 2016;Kotton, Soboh, & Bisharat, 2015).”
Quote in the paperNot a substantial claim2 of 2 sources checked- cites Huang et al., 2016 source
The Introduction (page unavailable) says V. vulnificus in seawater can cause necrotizing infections following traumatic injuries and describes necrotizing skin and soft-tissue infections as fulminant. It identifies shellfish as a habitat for the bacterium, but describes contaminated-oyster exposure through ingestion, not through contact with a preexisting wound. It also does not establish that wound infection is generally acquired by the route claimed. (LLM, conf=0.86)
Experimental — accuracy not yet measured - cites Kotton, Soboh, & Bisharat, 2015 source
The Introduction says wound infections follow injury before or during exposure to seawater or marine animals, and that necrotizing fasciitis can be a rapidly progressive complication. The claim narrows the injury to a preexisting wound and implies that wound infection results in necrotizing infection, whereas the source says necrotizing fasciitis can occur. (LLM, conf=0.84)
Experimental — accuracy not yet measured
Probably not a substantial claim: may not pass S3 (load-bearing).
PremisecitationV. vulnificus is considered one of the most dangerous foodborne pathogens for humans.
“Due to its capacity to cause rapid death among high-risk populations, V. vulnificus is considered one of the most dangerous foodborne pathogens for humans (Baker-Austin & Oliver, 2016;Oliver, 2005).”
Quote in the paperNot a substantial claim2 of 2 sources checked- cites Baker-Austin & Oliver, 2016 source
The paper’s discussion (page unavailable) reports that V. vulnificus wound infections can progress rapidly, have approximately 20% mortality, and warrant particular attention in patients with diabetes, immune disorders, or liver dysfunction. It does not describe V. vulnificus as a foodborne pathogen or rank it among the most dangerous foodborne pathogens for humans. (LLM, conf=0.85)
Experimental — accuracy not yet measured - cites Oliver, 2005 source
Probably not a substantial claim: may not pass S3 (load-bearing).
PremisecitationMales are more susceptible to V. vulnificus than females.
“Moreover, males are more susceptible than females (Ito et al., 2012), perhaps due to the role of estrogen in protecting against the bacterium's endotoxins (Miyamoto et al., 1999;Soucy, Boivin, Labrie, & Rivest, 2005).”
Quote in the paperNot a substantial claim1 of 1 sources checked- cites Ito et al., 2012 source
Probably not a substantial claim: may not pass S3 (load-bearing).
PremisecitationSeveral other risk factors contribute to the high pathogenicity of V. vulnificus in humans, such as capsule, iron, and the vcg gene.
“Several other risk factors contribute to the high pathogenicity of V. vulnificus in humans, such as capsule, iron, and the vcg gene (Jones & Oliver, 2009).”
Quote in the paperNot a substantial claim1 of 1 sources checked- cites Jones & Oliver, 2009 source
The opening overview identifies capsular polysaccharide expression and iron acquisition as virulence factors, and IRON ACQUISITION describes the association between serum iron and disease. BIOTYPES AND GENOTYPES calls vcg a “virulence-correlated gene” whose variants correlate with clinical versus environmental isolation; it does not establish that the gene itself contributes to pathogenicity. (LLM, conf=0.88)
Experimental — accuracy not yet measured
May combine two claims.
PremisecitationThe nanA gene is involved in sialic acid metabolism and is essential for V. vulnificus virulence.
“The nanA gene has been demonstrated to be involved in sialic acid metabolism and is essential for V. vulnificus virulence (Kim, Hwang, Kim, & Choi, 2011).”
Quote in the paperSubstantial claim1 of 1 sources checked- cites Kim, Hwang, Kim, & Choi, 2011 source
The Results identify NanA as involved in catabolic degradation of Neu5Ac, a sialic acid. The paper’s introductory passage (page unavailable) reports that a V. vulnificus nanA mutant had significantly diminished virulence in a mouse model, but that does not establish that nanA is essential for virulence. (LLM, conf=0.86)
Experimental — accuracy not yet measured
The quote only partly states this claim.
Findingown dataThe median lethal dose of BJ-PH01 in mice was 3.16 × 10^5 CFU.
“In our research, we found that the median lethal dose of isolated V. vulnificus BJ-PH01 was 3.16 × 10 5 CFU.”
Quote in the paperNot a substantial claimMay combine two claims.
PremisecitationV. vulnificus causes human infection through oral ingestion and wound infection.
“Vibrio vulnificus causes human infection through oral ingestion and wound infection (Kashimoto et al., 2015;Madiyal et al., 2016).”
Quote in the paperNot a substantial claim0 of 2 sources checkedProbably not a substantial claim: may not pass S3 (load-bearing).
PremisecitationPatients with underlying chronic diseases including alcoholism, diabetes, cancer, or renal diseases are more susceptible to V. vulnificus.
“As mentioned previously, patients with underlying chronic diseases, including alcoholism, diabetes, cancer, or renal diseases, are more susceptible to V. vulnificus (Bross, Soch, Morales, & Mitchell, 2007a).”
Quote in the paperNot a substantial claim0 of 1 sources checked- cites Bross, Soch, Morales, & Mitchell, 2007a
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
May combine two claims.
Study design and conductown dataThe identification of V. vulnificus was confirmed by 16S rDNA sequencing, vvhA gene-specific PCR, BD Phoenix system, and SEM analysis.
“The result was confirmed by 16S rDNA sequencing, V. vulnificus vvhA (cytolysin/hemolysin) gene-specific PCR amplification (Figure 2c), the BD Phoenix Automated Microbiology System, and electron scanning microscope (SEM) analysis (Figure 2d).”
Quote in the paperSubstantial claimProbably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductreasoningThe typical clinical manifestations of V. vulnificus infected seals are poorly understood due to limited background information.
“Due to limited background information, the typical clinical manifestations of V. vulnificus infected seals are poorly understood.”
Quote in the paperNot a substantial claimProbably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductcitationSusceptibility tests were conducted by the Kirby-Bauer method according to NCCLS recommendations.
“Susceptibility tests were conducted by the Kirby-Bauer method according to the recommendations of the National Committee for Clinical Laboratory Standards (M45)(Clinical & institute, 2015).”
Quote in the paperNot a substantial claim0 of 1 sources checked- cites Clinical & institute, 2015
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
Probably not a substantial claim: may not pass S2 (checkable).
InterpretationcitationIt is difficult to eliminate V. vulnificus without scientific measures.
“Thus, it is difficult to eliminate V. vulnificus without scientific measures, and it is necessary to take measures to control the water quality in aquariums.”
Quote in the paperNot a substantial claimProbably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductcitationThe study used FDA Bacteriological Analytical Manual procedures for sample examination.
“All samples were examined using procedures in the Bacteriological Analytical Manual of The Food and Drug Administration (FDA) (Kaysner & DePaola, 2004).”
Quote in the paperNot a substantial claim0 of 1 sources checked- cites Kaysner & DePaola, 2004
Couldn’t be matched to a paper in Crossref, so it can’t be checked.
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductnone givenThe study was approved by the Animal Ethics Committee of the Institute of Zoology, Chinese Academy of Sciences.
“This study was evaluated and approved by the Animal Ethics Committee of Institute of Zoology, Chinese Academy of Sciences.”
Quote in the paperNot a substantial claim
The paper relies on this without support.
V. vulnificus can only affect humans and other primates.
“Previous reports indicated that V. vulnificus can only affect humans and other primates.”
The paper relies on this without support.
There is an overlap in the distributions of V. vulnificus and marine mammals.
“There is an overlap in the distributions of V. vulnificus and marine mammals.”
The paper relies on this without support.
No evidence has shown that marine mammals can be infected by V. vulnificus.
“No evidence has shown that marine mammals can be infected by V. vulnificus; however, the concerns cannot be excluded.”
The paper relies on this without support.
Possession of an antiphagocytic capsule is one of the absolute requirements for V. vulnificus virulence.
“Possession of an antiphagocytic capsule is one of the absolute requirements for virulence.”
The paper relies on this without support.
Encapsulated V. vulnificus cells produce opaque colonies, and only opaque cells are able to utilize transferrin-bound iron.
“Encapsulated cells produce opaque colonies, and only opaque cells are able to utilize transferrin-bound iron.”
The paper relies on this without support.
V. vulnificus is an opportunistic pathogen, and one or more predisposing factors are required to initiate disease.
“V. vulnificus is an opportunistic pathogen, and one or more predisposing factors are required to initiate disease;”
The paper relies on this without support.
The minimum dose for V. vulnificus to cause an infection is poorly understood, even in humans.
“the minimum dose for V. vulnificus to cause an infection is poorly understood, even in humans;”
The paper relies on this without support.
The interface between V. vulnificus and marine mammals in the wild has never been studied.
“the interface between V. vulnificus and marine mammals in the wild has never been studied.”
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
Each contradiction between two passages listed here was confirmed by an independent check.
Ornithine decarboxylase results are described as positive but tabulated as negative
MajorThe results text says every tested strain was positive, while the corresponding Table 3 row shows a minus sign for every strain.
“All the tested V. vulnificus samples were positive for the indole test, ONPG test, and ornithine decarboxylase test (Table 3).”
“Ornithine decarboxylase - - - - - - - - - - - -”
BJ-PH01 is assigned conflicting genotypes
MajorThe figure caption identifies BJ-PH01 as vcgE, whereas the genotype table assigns it vcg C.
“Further analysis showed that BJ-PH01 belongs to the vcgE genotype.”
“BJ-PH01 Spotted seal ﹢ C - 0 - ﹢ ﹢ ﹢”
Cites
The Status of the World's Land and Marine Mammals: Diversity, Threat, and Knowledge
Schipper, J., Chanson, J. S., Chiozza, F., Cox, N. A., Hoffmann, M., Katariya, V., Lamoreux, J., Rodrigues, A. S. L., Stuart, S. N., Temple, H. J., et al. (2008) · Science · doi:10.1126/science.1165115 · Cited by 1,534 · see citing works
Severe acute respiratory syndrome coronavirus-like virus in Chinese horseshoe bats
Lau, S. K. P., Woo, P. C. Y., Li, K. S. M., Huang, Y. P., Tsoi, H., Wong, B. H. L., Wong, S. S. Y., Leung, S.-Y., Chan, K., & Yuen, K. (2005) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0506735102 · Cited by 1,529 · see citing works
Jorgensen, J. H., & Clinical (2006) · Clinical and Laboratory Standards Institute eBooks · Cited by 1,052 · see citing works
<i>Vibrio vulnificus</i>: Disease and Pathogenesis
Jones, M. K., & Oliver, J. D. (2009) · Infection and Immunity · doi:10.1128/iai.01046-08 · Cited by 720 · cited 2× · see citing works
“Several other risk factors contribute to the high pathogenicity of V. vulnificus in humans, such as capsule, iron, and the vcg gene (Jones & Oliver, 2009 ).”
BackgroundJorgensen, J. H., Hindler, J. F., Reller, L. B., & Weinstein, M. P. (2006) · Clinical Infectious Diseases · doi:10.1086/510431 · Cited by 533 · see citing works
Epidemiology and pathogenesis of
Strom, M. S., & Paranjpye, R. N. (2000) · Microbes and Infection · doi:10.1016/s1286-4579(00)00270-7 · Cited by 467 · cited 3× · see citing works
“The inoculum was serially diluted to 10 8 , 10 7 , 10 6 , 10 5 , 10 4 , and 10 3 CFU/ml 6-week-old female BALB/c mice were intraperitoneally (for each group, n = 4) (Strom & Paranjpye, 2000) or intramuscularly (for each group, n = 4) (”
BackgroundInfluentialWound infections caused by <i>Vibrio vulnificus</i> and other marine bacteria
OLIVER, J. D. (2005) · Epidemiology and Infection · doi:10.1017/s0950268805003894 · Cited by 345 · cited 2× · see citing works
“Due to its capacity to cause rapid death among high‐risk populations, V. vulnificus is considered one of the most dangerous foodborne pathogens for humans (Baker‐Austin & Oliver, 2016; Oliver, 2005).”
BackgroundBisharat, N., Agmon, V., Finkelstein, R., Raz, R., Ben-Dror, G., Lerner, L. V., Soboh, S., Colodner, R., Cameron, D. N., Wykstra, D. L., et al. (1999) · The Lancet · doi:10.1016/s0140-6736(99)02471-x · Cited by 318 · see citing works
Iturriza‐Gómara, M., Wong, C., Blome, S., et al. (2002) · Journal of Virology · doi:10.1128/jvi.76.13.6596-6601.2002 · Cited by 305 · cited 1× · see citing works
“The primers used in this study are listed in Table 1 (Chatzidaki-Livanis, Jones, & Wright, 2006; Gómara, Wong, Blome, Desselberger, & Gray, 2002; Hill et al., 1991; Lau et al., 2005; Miller et al., 2011; Reynaud, Pitchford, De Decker, Wikfors, & Brown, 2013; Sea, 2015; Warner & Oliver, 2008 CCATCATCAGATAGAATCATCATA an…”
Correlation between virulence and colony morphology in Vibrio vulnificus
Simpson, L. M., White, V. K., Zane, S. F., & Oliver, J. D. (1987) · Infection and Immunity · doi:10.1128/iai.55.1.269-272.1987 · Cited by 217 · cited 1× · see citing works
“This result prompted us to consider that BJ-PH01 is virulent in animal models (Simpson, White, Zane, & Oliver, 1987) .”
ResultVibrio vulnificus infection: diagnosis and treatment.
Bross, M. H., Soch, K., Morales, R. E., & Mitchell, R. B. (2007) · PubMed · Cited by 194 · see citing works
Polymerase chain reaction identification of Vibrio vulnificus in artificially contaminated oysters
Hill, W. E., Keasler, S. P., Trucksess, M. W., Feng, P., Kaysner, C. A., & Lampel, K. A. (1991) · Applied and Environmental Microbiology · doi:10.1128/aem.57.3.707-711.1991 · Cited by 174 · cited 1× · see citing works
“The primers used in this study are listed in Table 1 (Chatzidaki‐Livanis, Jones, & Wright, 2006; Gómara, Wong, Blome, Desselberger, & Gray, 2002; Hill et al., 1991; Lau et al., 2005; Miller et al., 2011; Reynaud, Pitchford, De Decker, Wikfors, & Brown, 2013; Sea, 2015; Warner & Oliver, 2008).”
Marine Mammal Zoonoses: A Review of Disease Manifestations
Waltzek, T. B., Cortés-Hinojosa, G., Wellehan, J. F. X., & Gray, G. C. (2012) · Zoonoses and Public Health · doi:10.1111/j.1863-2378.2012.01492.x · Cited by 153 · see citing works
Characterization of phylogenetically diverse astroviruses of marine mammals
Rivera, R., Nollens, H. H., Venn-Watson, S. K., Gulland, F. M. D., & Wellehan, J. F. X. (2009) · Journal of General Virology · doi:10.1099/vir.0.015222-0 · Cited by 147 · see citing works
Vibrio fluvialis: an emerging human pathogen
Ramamurthy, T., Chowdhury, G., Pazhani, G. P., et al. (2014) · Frontiers in Microbiology · doi:10.3389/fmicb.2014.00091 · Cited by 141 · cited 1× · see citing works
“Vibrio fluvialis has been considered an emerging pathogen that induces foodborne diarrhea (Ramamurthy, Chowdhury, Pazhani, & Shinoda, 2014) .”
BackgroundSoucy, G., Boivin, G., Labrie, F., & Rivest, S. (2005) · The Journal of Immunology · doi:10.4049/jimmunol.174.10.6391 · Cited by 138 · cited 1× · see citing works
“Moreover, males are more susceptible than females (Ito et al., 2012) , perhaps due to the role of estrogen in protecting against the bacterium's endotoxins (Miyamoto et al., 1999; Soucy, Boivin, Labrie, & Rivest, 2005) .”
BackgroundMiyamoto, N., Mandai, M., Suzuma, I., Suzuma, K., Kobayashi, K., & Honda, Y. (1999) · The Journal of Immunology · doi:10.4049/jimmunol.163.1.374 · Cited by 111 · see citing works
Genetic Variation in the Vibrio vulnificus Group 1 Capsular Polysaccharide Operon
Chatzidaki‐Livanis, M., Jones, M. K., & Wright, A. C. (2006) · Journal of Bacteriology · doi:10.1128/jb.188.5.1987-1998.2006 · Cited by 95 · cited 1× · see citing works
“The primers used in this study are listed in Table 1 (Chatzidaki-Livanis, Jones, & Wright, 2006; Gómara, Wong, Blome, Desselberger, & Gray, 2002; Hill et al., 1991; Lau et al., 2005; Miller et al., 2011; Reynaud, Pitchford, De Decker, Wikfors, & Brown, 2013; Sea, 2015; Warner & Oliver, 2008 CCATCATCAGATAGAATCATCATA an…”
Williamson, J. R., Rowold, E., Chang, K. C., et al. (1986) · Diabetes · doi:10.2337/diab.35.1.20 · Cited by 87 · see citing works
Mechanism of High Susceptibility of Iron‐Overloaded Mouse to Vibrio vulnificus Infection
Hor, L., Chang, Y., Chang, C., Lei, H., & Ou, J. T. (2000) · Microbiology and Immunology · doi:10.1111/j.1348-0421.2000.tb02577.x · Cited by 86 · see citing works
Jensen, S.-K., Aars, J., Lydersen, C., et al. (2009) · Polar Biology · doi:10.1007/s00300-009-0735-x · Cited by 85 · see citing works
Phylogenetic analysis of marine mammal herpesviruses
Maness, H. T. D., Nollens, H. H., Jensen, E. D., Goldstein, T., LaMere, S. A., Childress, A. L., Sykes, J. M., Leger, J. S., Lacave, G., Latson, F. E., et al. (2010) · Veterinary Microbiology · doi:10.1016/j.vetmic.2010.09.035 · Cited by 69 · see citing works
Pyrosequencing-based comparative genome analysis of Vibrio vulnificus environmental isolates
Morrison, S. S., Williams, T., Cain, A., Froelich, B., Taylor, C., Baker-Austin, C., Verner-Jeffreys, D., Hartnell, R., Oliver, J. D., & Gibas, C. J. (2012) · PLoS ONE · doi:10.1371/journal.pone.0037553 · Cited by 68 · cited 1× · see citing works
“The ary gene has been demonstrated to be associated with virulence of clinical strains by providing a pathogen with sulfur within the host, thus providing an immune evasion approach (Morrison et al., 2012) .”
BackgroundBrandon‐Warner, E., & Oliver, J. D. (2008) · Foodborne Pathogens and Disease · doi:10.1089/fpd.2008.0120 · Cited by 67 · cited 3× · see citing works
“In this analysis, we successfully collected 54 samples from six aquariums in northern China ( genotypes based on its virulence-correlated gene (vcg) (Warner & Oliver, 2008) ; our analysis showed that 11 of the 12 isolated V. vulnificus strains were classified into the C genotype, and only one of the 12 belonged to the…”
MethodSTEFANIUK, E. M., Baraniak, A., Gniadkowski, M., et al. (2003) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-003-0962-y · Cited by 64 · cited 1× · see citing works
“The results were further confirmed by the BD Phoenix automated Microbiology System (BD Diagnostic Systems, Sparks, MD.) (Stefaniuk, Baraniak, Gniadkowski, & Hryniewicz, 2003) and species-specific PCR amplification.”
ResultPhocine Distemper Virus in Northern Sea Otters in the Pacific Ocean, Alaska, USA
Goldstein, T., Mazet, J. A. K., Gill, V. A., et al. (2009) · Emerging infectious diseases · doi:10.3201/eid1506.090056 · Cited by 64 · cited 1× · see citing works
“…pathogens of marine mammals include viruses (e.g., adenovirus, calicivirus, herpesvirus, morbillivirus, poxvirus, influenza virus, retrovirus) (Goldstein et al., 2009; Maness et al., 2011; Ohishi et al., 2010; Ramis, van Riel, van de Bildt, Osterhaus, & Kuiken, 2012; Rivera, Nollens,…”
Marco-Noales, E., Biosca, E. G., & Amaro, C. (1999) · Applied and Environmental Microbiology · doi:10.1128/aem.65.3.1117-1126.1999 · Cited by 58 · see citing works
Ohishi, K., Ando, A., Suzuki, R., et al. (2008) · Comparative Immunology Microbiology and Infectious Diseases · doi:10.1016/j.cimid.2008.10.003 · Cited by 55 · see citing works
Huang, K.-C., Weng, H.-H., Yang, T.-Y., Chang, T.-S., Huang, T.-W., & Lee, M. S. (2016) · Medicine · doi:10.1097/md.0000000000002627 · Cited by 53 · see citing works
Kim, B. S., Hwang, J., Kim, M. H., & Choi, S. H. (2011) · Journal of Biological Chemistry · doi:10.1074/jbc.m111.300988 · Cited by 43 · cited 1× · see citing works
“The nanA gene has been demonstrated to be involved in sialic acid metabolism and is essential for V. vulnificus virulence (Kim, Hwang, Kim, & Choi, 2011) .”
BackgroundInfluenza A and B Virus Attachment to Respiratory Tract in Marine Mammals
Ramis, A. J., van Riel, D. A. J., van de Bildt, M. W. G., et al. (2012) · Emerging infectious diseases · doi:10.3201/eid1805.111828 · Cited by 28 · see citing works
Reynaud, Y., PITCHFORD, S., Decker, S. D., et al. (2013) · PLoS ONE · doi:10.1371/journal.pone.0083357 · Cited by 28 · cited 2× · see citing works
“| 1867 yet understood (Reynaud et al., 2013) .”
Gao, X., Liu, Y., Liu, H., Yang, Z. L., Liu, Q., Zhang, Y., & Wang, Q. (2017) · Journal of Bacteriology · doi:10.1128/jb.00252-17 · Cited by 22 · cited 1× · see citing works
“Vibrio alginolyticus was recently recognized as a human pathogen after excessive exposure to seawater (Gao et al., 2017).”
BackgroundBier, N. S., Jäckel, C., Dieckmann, R., et al. (2015) · International Journal of Environmental Research and Public Health · doi:10.3390/ijerph121215031 · Cited by 20 · see citing works
A checklist of the helminth parasites of marine mammals from Argentina
Hernández-Orts, J. S., Viola, M. N. P., García, N. A., et al. (2015) · Zootaxa · doi:10.11646/zootaxa.3936.3.1 · Cited by 19 · cited 1× · see citing works
“, Acanthocephalans, Toxoplasma gondii, Sarcocystis, Coccidia, and Parafilaroides decorus) (Hernandez‐Orts et al., 2015; Jensen, Aars, Lydersen, Kovacs, & Åsbakk, 2010).”
Rapidly developing and fatal Vibrio vulnificus wound infection
Baker-Austin, C., & Oliver, J. D. (2016) · IDCases · doi:10.1016/j.idcr.2016.07.014 · Cited by 18 · see citing works
Miller, D. S., Finnie, J. W., Bowden, T. R., et al. (2011) · Journal of General Virology · doi:10.1099/vir.0.028985-0 · Cited by 16 · cited 1× · see citing works
“The primers used in this study are listed in Table 1 (Chatzidaki-Livanis, Jones, & Wright, 2006; Gómara, Wong, Blome, Desselberger, & Gray, 2002; Hill et al., 1991; Lau et al., 2005; Miller et al., 2011; Reynaud, Pitchford, De Decker, Wikfors, & Brown, 2013; Sea, 2015; Warner & Oliver, 2008 CCATCATCAGATAGAATCATCATA an…”
Madiyal, M., Eshwara, V., Halim, I., Stanley, W., Prabhu, M., & Mukhopadhyay, C. (2016) · Indian Journal of Medical Microbiology · doi:10.4103/0255-0857.188361 · Cited by 16 · see citing works
Ibuprofen augments pro‐inflammatory cytokine release in a mouse model of Vibrio vulnificus infection
Lee, Y., & Chuang, Y. (2010) · Microbiology and Immunology · doi:10.1111/j.1348-0421.2010.00249.x · Cited by 14 · see citing works
Kim, C. S., Bae, E. H., Ma, S. K., & Kim, S. W. (2015) · BMC Infectious Diseases · doi:10.1186/s12879-015-1163-x · Cited by 12 · cited 1× · see citing works
“Oral ingestion mainly leads to primary septicemia when people consume contaminated raw or uncooked seafood (Kim, Bae, Ma, & Kim, 2015).”
BackgroundVibrio vulnificus detected in the spleen leads to fatal outcome in a mouse oral infection model
Kashimoto, T., Iwasaki, C., Gojo, M., Sugiyama, H., Yoshioka, K., Yamamoto, Y., Okamura, M., Susa, N., & Ueno, S. (2015) · FEMS Microbiology Letters · doi:10.1093/femsle/fnv005 · Cited by 11 · cited 1× · see citing works
“Vibrio vulnificus causes human infection through oral ingestion and wound infection (Kashimoto et al., 2015; Madiyal et al., 2016).”
BackgroundVibrio vulnificus necrotizing fasciitis associated with acupuncture
Kotton, Y., Soboh, S., & Bisharat, N. (2015) · Infectious Disease Reports · doi:10.4081/idr.2015.5901 · Cited by 10 · see citing works
Sakata, J., Yonekita, T., & Kawatsu, K. (2017) · International Journal of Food Microbiology · doi:10.1016/j.ijfoodmicro.2017.10.016 · Cited by 8 · see citing works
Ito, H., Shibayama, A., Abe, M., Antoku, S., Nawata, H., Isonishi, M., Fujita, M., & Kato, S. (2012) · Journal of Diabetes Mellitus · doi:10.4236/jdm.2012.21020 · Cited by 7 · see citing works
Flagged first, then by citations
1 of the 45 references couldn’t be matched to a known paper.
Research works printed but not linked: 1
- Bross, 2007b, Vibrio vulnificus infection: diagnosis and treatment, Diabetes, 35, 20
Cited by
Sorted by citations
Brauge, T., Mougin, J., Ells, T. C., & Midelet, G. (2023) · Comprehensive Reviews in Food Science and Food Safety · doi:10.1111/1541-4337.13283 · Cited by 87 · see citing works
Levofloxacin in veterinary medicine: a literature review
Šitovs, A., Sartini, I., & Gıorgı, M. (2021) · Research in Veterinary Science · doi:10.1016/j.rvsc.2021.04.031 · Cited by 56 · see citing works
Vibrio vulnificus, eine zunehmende Sepsisgefahr in Deutschland?
Metelmann, C., Metelmann, B., Gründling, M., Hahnenkamp, K., Hauk, G., & Scheer, C. S. (2020) · Der Anaesthesist · doi:10.1007/s00101-020-00811-9 · Cited by 23 · see citing works
Vibrio vulnificus, an Underestimated Zoonotic Pathogen
Amaro, C., & Carmona-Salido, H. (2023) · Advances in experimental medicine and biology · doi:10.1007/978-3-031-22997-8_9 · Cited by 14 · see citing works
Su, J., Zhang, Y., Tian, H., et al. (2022) · Frontiers in Marine Science · doi:10.3389/fmars.2022.1071371 · Cited by 13 · see citing works
“as one of the primary pathogen have caused serious harm to the clam aquaculture industry and food safety (Li et al., 2018).”
BackgroundZhang, X., Guo, B., Yang, L., et al. (2023) · Acta Biochimica et Biophysica Sinica · doi:10.3724/abbs.2023013 · Cited by 13 · see citing works
“vulnificus is responsible for 95% of seafood-related deaths, presenting a major food safety concern [1].”
Self-citationZhang, R., Liu, Y., Zhao, X. F., et al. (2021) · Ecotoxicology · doi:10.1007/s10646-021-02391-9 · Cited by 10 · see citing works
Long, D., Li, M., Ma, L., et al. (2025) · Communications Biology · doi:10.1038/s42003-024-07426-5 · Cited by 7 · see citing works
Self-citationGenomic and Phenotypic Characteristics for Vibrio vulnificus Infections
Zhang, J., Huang, Y., Xu, H., et al. (2021) · Infection and Drug Resistance · doi:10.2147/idr.s331468 · Cited by 7 · see citing works
Vibrio harveyi in a Caribbean spiny lobster ( Panulirus argus ) with hepatopancreas necrosis
Bennett, H. M., Griffin, M. J., Francis‐Floyd, R., et al. (2023) · Veterinary Pathology · doi:10.1177/03009858231164754 · Cited by 5 · see citing works
Wu, Q., Wu, Y., Zhang, T., et al. (2023) · Heliyon · doi:10.1016/j.heliyon.2023.e18905 · Cited by 5 · see citing works
“vulnificus isolate was the C-genotype [7].”
MethodInfluentialPotentially human‐virulentVibrio vulnificusisolates from diseased great pompano (Trachinotus goodei)
Gibello, A., Vela, A. I., Martínez‐Nevado, E., et al. (2019) · Transboundary and Emerging Diseases · doi:10.1111/tbed.13190 · Cited by 5 · see citing works
Alsalem, Z. H., Elhadi, N., Aljeldah, M. M., Alzahrani, F., & Nishibuchi, M. (2018) · Journal of Pure and Applied Microbiology · doi:10.22207/jpam.12.3.38 · Cited by 5 · see citing works
Eukaryotic communities in coastal water from Shenzhen in South China
Zhang, R., Liu, Y., Zhao, X. F., et al. (2021) · Ecotoxicology · doi:10.1007/s10646-020-02341-x · Cited by 4 · see citing works
Serrano, A., Colunga‐Salas, P., Sánchez‐Montes, S., et al. (2022) · Veterinary Research Communications · doi:10.1007/s11259-022-10007-8 · Cited by 4 · see citing works
Bharathan, A., Arafath, Y., Fathima, A., Hassan, S., Singh, P., Kiran, G. S., & Selvin, J. (2025) · Microbial Pathogenesis · doi:10.1016/j.micpath.2025.107591 · Cited by 3 · see citing works
Apparent expansion of virulent Vibrio parahaemolyticus in humans and sea otters
Sebastian, P. J., Schlesener, C., Byrne, B. A., et al. (2025) · Virulence · doi:10.1080/21505594.2025.2603698 · Cited by 3 · see citing works
Liu, J., Yu, M., Wang, X., et al. (2024) · Journal of Microbiology and Biotechnology · doi:10.4014/jmb.2312.12033 · Cited by 3 · see citing works
“Especially, V. vulnificus is responsible for 95% of seafood-related deaths, presenting a major food safety concern [14].”
Confidence-driven communication of process mining on time series
Koschmider, A., Oppelt, N., & Hundsdörfer, M. (2022) · Informatik-Spektrum · doi:10.1007/s00287-022-01470-3 · Cited by 3 · see citing works
“Most infections occur in subtropical regions between April and November [13].”
BackgroundZhang, R., & Liu, Y. (2023) · Frontiers in Marine Science · doi:10.3389/fmars.2023.1189876 · Cited by 3 · see citing works
Antibiotic Resistance in Public Aquariums
Pereira, N., & David, H. L. (2023) · Elsevier eBooks · doi:10.1016/b978-0-323-82852-9.00059-9
Nafiqoh, N., Setiadi, S., Novita, H., et al. (2024) · HAYATI Journal of Biosciences · doi:10.4308/hjb.31.5.811-819
“Vibrio in aquatic mammals of the species Vibrio vulnificus was found to cause septicemia and death in spotted seals (Li et al. 2018).”
BackgroundAbaidullah, M., Ji, Y., 黄, 勤., Scarpa, M., Li, J., Xiao, X., & Xu, D. (2026) · Frontiers in Immunology · doi:10.3389/fimmu.2026.1883529
- Authors
- Li, M., Zhao, L., Ma, J., Zhao, N., Luo, J., Wang, C., Chen, L., Ma, G., Wang, Y., & He, H.
- Affiliations
- Chinese Academy of Sciences (CN)
- National Animal Husbandry Service (CN)
- Corresponding author
- He, Hongxuan
- Venue
- Transboundary and Emerging Diseases
- Publisher
- Wiley
- Published
- 2018-07-26
- Volume
- 65
- Issue
- 6
- Pages
- 1863-1871
- ISSN
- 1865-1674 (ISSN-L)
- PMC
- PMC7169869
- OpenAlex
- W2883127692
- Semantic Scholar
- 68262326e186aeb77d88c752cc1f50455bf27dce
- Cited by
- 24
- References
- 45
- Citations by year
- 2026: 1 · 2025: 3 · 2024: 2 · 2023: 7 · 2022: 3 · 2021: 4 · 2020: 1 · 2019: 1 · 2018: 2
- FWCI
- 1.32
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- Locations
- Transboundary and Emerging Diseases (publishedVersion)
- PubMed (publishedVersion)
- PubMed Central (submittedVersion)
- Funders
- State Forestry Administration
- Chinese Academy of Sciences (CZBZX-1)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Endocrinology › Vibrio bacteria research studies
- Life Sciences › Immunology and Microbiology › Immunology › Aquaculture disease management and microbiota
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Endocrinology › Infections and bacterial resistance
- Keywords
- Vibrio vulnificus, aquariums, captive marine mammals, spotted seal, Phoca largha, septicemia, biotype 1, antibiotic resistance, zoonotic pathogens, public health risk, mariculture
- MeSH terms
- Waterborne Diseases, Animals, Animal Diseases, Animals, Zoo, China, Fishes, Genotype, Mammals, Public Health, Vibrio Infections, Water Microbiology, Vibrio vulnificus, Seals, Earless
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Claims read by deepseek-v4.1-flash under definition version 3 (extract-v3) on 2026-10-26.
Classified by jev-1.13-20260917 (gold-guideline-v0.2) on 2026-10-26.
Cited sources are checked by gpt-6-sol.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
