An SNP in an ultraconserved regulatory element affects Dlx5/Dlx6 regulation in the forebrain

Poitras, Luc; Yu, Man; Lesage-Pelletier, Cindy; MacDonald, Ryan B.; Gagné, Jean-Philippe; Hatch, Gary; Kelly, Isabelle; Hamilton, Steven P.; Rubenstein, John L. R.; Poirier, Guy G.; Ekker, Marc

doi:10.1242/dev.051052

Cited by 69Genetics and Neurodevelopmental DisordersDevelopmental Biology and Gene RegulationGenomics and Chromatin Dynamics

An SNP in an ultraconserved regulatory element affects Dlx5/Dlx6 regulation in the forebrain

Open access

Poitras, Luc, Yu, Man, Lesage-Pelletier, Cindy, MacDonald, Ryan B., Gagné, Jean-Philippe, Hatch, Gary, Kelly, Isabelle, Hamilton, Steven P. +3 more·2010·Development

DOI 10.1242/dev.051052PMC PMC3188590

Open this paper in CoChat — free account

Abstract

Dlx homeobox genes play a crucial role in the migration and differentiation of the subpallial precursor cells that give rise to various subtypes of gamma-aminobutyric acid (GABA)-expressing neurons of the forebrain, including local-circuit cortical interneurons. Aberrant development of GABAergic interneurons has been linked to several neurodevelopmental disorders, including epilepsy, schizophrenia, Rett syndrome and autism. Here, we report in mice that a single-nucleotide polymorphism (SNP) found in an autistic proband falls within a functional protein binding site in an ultraconserved cis-regulatory element. This element, I56i, is involved in regulating Dlx5/Dlx6 homeobox gene expression in the developing forebrain. We show that the SNP results in reduced I56i activity, predominantly in the medial and caudal ganglionic eminences and in streams of neurons tangentially migrating to the cortex. Reduced activity is also observed in GABAergic interneurons of the adult somatosensory cortex. The SNP affects the affinity of Dlx proteins for their binding site in vitro and reduces the transcriptional activation of the enhancer by Dlx proteins. Affinity purification using I56i sequences led to the identification of a novel regulator of Dlx gene expression, general transcription factor 2 I (Gtf2i), which is among the genes most often deleted in Williams-Beuren syndrome, a neurodevelopmental disorder. This study illustrates the clear functional consequences of a single nucleotide variation in an ultraconserved non-coding sequence in the context of developmental abnormalities associated with disease.

Integrity signals

Registry

Crossref · 10.1242/dev.051052

Cites

60 of 60 references verified0 citation errors · 0 not checkable

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

We couldn’t retrieve this paper’s full text, so its claims and self-check weren’t run. The registry and citation checks still apply.

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

A point mutation within the I56i enhancer is associated with binding of the transcription factor GTF2I, which is deleted in Williams-Beuren syndrome characterized by hyper-vocalization and hyper-sociability.
“a point mutation within the I56i enhancer is associated with binding of the transcription factor GTF2I, which is deleted in Williams–Beuren syndrome characterized by hyper-vocalization and hyper-sociability (Poitras, et al. 2010).”
From DLX5/6 GABAergic Expression Affects Social Vocalization: Implications for Human Evolution (2021) · cites this paper as Poitras, et al. 2010
DLX5/6-N-Haplotype includes enhancers controlling gene expression in the central nervous system and sequences associated with hyper- or hypo-socialization/vocalization pathologies such as Williams-Beuren syndrome or ASDs.
“that includes enhancers controlling gene expression in the central nervous system (Fazel Darbandi, et al. 2016) and sequences associated with either hyper- or hypo-socialization/vocalization pathologies such as Williams-Buren syndrome (Poitras, et al. 2010) or ASDs (Gandal, et al. 2018).”
From DLX5/6 GABAergic Expression Affects Social Vocalization: Implications for Human Evolution (2021) · cites this paper as Poitras, et al. 2010
GTF2I is associated with Williams-Beuren syndrome, a hyper-sociability and hyper-vocalization neurodevelopmental disorder.
“a gene associated with Williams–Beuren syndrome, a hyper-sociability and hyper-vocalization neurodevelopmental disorder.”
From DLX5/6 GABAergic Expression Affects Social Vocalization: Implications for Human Evolution (2021) · cites this paper as Poitras, et al. 2010
The DLX5/6-N-Haplotype covers DLX6 and DLX5 coding and regulatory sequences including SNPs associated with either hyper- or hypo-sociability and vocalization syndromes.
“which covers DLX6 and DLX5 coding and regulatory sequences including SNPs associated with either hyper- (Williams–Beuren syndrome) or hypo- (ASDs) sociability and vocalization syndromes (Poitras, et al. 2010).”
From DLX5/6 GABAergic Expression Affects Social Vocalization: Implications for Human Evolution (2021) · cites this paper as Poitras, et al. 2010

Molecular Cloning: A Laboratory Manual
Sambrook, J., Fritsch, E., & Maniatis, T. (1989) · UCLA - Biblioteca de Ciencias de la Salud · Cited by 133,589 · see citing works
Molecular cloning: A laboratory manual
Deininger, P. L. (1990) · Analytical Biochemistry · doi:10.1016/0003-2697(90)90595-z · Cited by 84,684 · see citing works
Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search.
Keller, A., Nesvizhskii, A., Kolker, E., & Aebersold, R. (2002) · Analytical Chemistry · doi:10.1021/ac025747h · Cited by 4,970 · see citing works
A statistical model for identifying proteins by tandem mass spectrometry.
Nesvizhskii, A., Keller, A., Kolker, E., & Aebersold, R. (2003) · Analytical Chemistry · doi:10.1021/ac0341261 · Cited by 4,902 · see citing works
Model of autism: increased ratio of excitation/inhibition in key neural systems
Rubenstein, J. L. R., & Merzenich, M. M. (2003) · Genes, Brain and Behavior · doi:10.1034/j.1601-183x.2003.00037.x · Cited by 2,768 · see citing works
Ultraconserved Elements in the Human Genome
Bejerano, G., Pheasant, M., Makunin, I., Stephen, S., Kent, W. J., Mattick, J. S., & Haussler, D. (2004) · Science · doi:10.1126/science.1098119 · Cited by 1,732 · see citing works
Interneuron Migration from Basal Forebrain to Neocortex: Dependence on Dlx Genes
Anderson, S. A., Eisenstat, D. D., Shi, L., & Rubenstein, J. L. R. (1997) · Science · doi:10.1126/science.278.5337.474 · Cited by 1,462 · see citing works
The origin and specification of cortical interneurons
Wonders, C. P., & Anderson, S. A. (2006) · Nature Reviews Neuroscience · doi:10.1038/nrn1954 · Cited by 980 · see citing works
The Evf-2 noncoding RNA is transcribed from the Dlx-5/6 ultraconserved region and functions as a Dlx-2 transcriptional coactivator
Feng, J., Bi, C., Clark, B. S., Mady, R., Shah, P., & Kohtz, J. D. (2006) · Genes & Development · doi:10.1101/gad.1416106 · Cited by 712 · see citing works
Loss of silent-chromatin looping and impaired imprinting of DLX5 in Rett syndrome
Horike, S., Cai, S., Miyano, M., Cheng, J., & Kohwi-shigematsu, T. (2004) · Nature Genetics · doi:10.1038/ng1491 · Cited by 585 · see citing works
Spatially restricted expression of Dlx-1, Dlx-2 (Tes-1), Gbx-2, and Wnt- 3 in the embryonic day 12.5 mouse forebrain defines potential transverse and longitudinal segmental boundaries
Bulfone, A., Puelles, L., Porteus, M. H., FROHMAN, M., Martin, G. R., & Rubenstein, J. L. R. (1993) · Journal of Neuroscience · doi:10.1523/jneurosci.13-07-03155.1993 · Cited by 574 · see citing works
Mutations of the Homeobox Genes Dlx-1 and Dlx-2 Disrupt the Striatal Subventricular Zone and Differentiation of Late Born Striatal Neurons
Anderson, S. A., Qiu, M. S., Bulfone, A., Eisenstat, D. D., Meneses, J. J., Pedersen, R. A., & Rubenstein, J. L. R. (1997) · Neuron · doi:10.1016/s0896-6273(00)80345-1 · Cited by 541 · see citing works
Mice lacking Dlx1 show subtype-specific loss of interneurons, reduced inhibition and epilepsy
Cobos, I., Calcagnotto, M. E., Vilaythong, A. J., Thwin, M. T., Noebels, J. L., Baraban, S. C., & Rubenstein, J. L. R. (2005) · Nature Neuroscience · doi:10.1038/nn1499 · Cited by 502 · see citing works
Integrative analysis of the cancer transcriptome
Rhodes, D. R., & Chinnaiyan, A. M. (2005) · Nature Genetics · doi:10.1038/ng1570 · Cited by 490 · see citing works
The regulation of myogenin gene expression during the embryonic development of the mouse.Preprint
Yee, S., & Rigby, P. W. J. (1993) · Genes & Development · doi:10.1101/gad.7.7a.1277 · Cited by 423 · see citing works
Spatial genetic patterning of the embryonic neuroepithelium generates GABAergic interneuron diversity in the adult cortex
Fogarty, M., Grist, M., Gelman, D., Marín, O., Pachnis, V., & Kessaris, N. (2007) · The Journal of Neuroscience · doi:10.1523/jneurosci.1629-07.2007 · Cited by 412 · see citing works
Balanced gene regulation by an embryonic brain ncRNA is critical for adult hippocampal GABA circuitry
Bond, A. M., VanGompel, M. J. W., Sametsky, E. A., Clark, M. F., Savage, J. C., Disterhoft, J. F., & Kohtz, J. D. (2009) · Nature Neuroscience · doi:10.1038/nn.2371 · Cited by 399 · see citing works
A Highly Conserved Enhancer in the Dlx5/Dlx6 Intergenic Region is the Site of Cross-Regulatory Interactions between Dlx Genes in the Embryonic Forebrain
Zerucha, T., Stühmer, T., Hatch, G., Park, B. K., Long, Q., Yu, G. K., Gambarotta, A., Schultz, J. R., Rubenstein, J. L. R., & Ekker, M. (2000) · Journal of Neuroscience · doi:10.1523/jneurosci.20-02-00709.2000 · Cited by 360 · see citing works
Deletion of Ultraconserved Elements Yields Viable Mice
Ahituv, N., Zhu, Y., Visel, A., Holt, A., Afzal, V., Pennacchio, L. A., & Rubin, E. M. (2007) · PLoS Biology · doi:10.1371/journal.pbio.0050234 · Cited by 319 · see citing works
Autistic social impairment in the siblings of children with pervasive developmental disorders
Constantino, J. N., Lajonchere, C., Lutz, M., Gray, T., Abbacchi, A., McKenna, K., Singh, D., & Todd, R. D. (2006) · American Journal of Psychiatry · doi:10.1176/appi.ajp.163.2.294 · Cited by 294 · see citing works
Cloning and characterization of two members of the vertebrate Dlx gene family.
Simeone, A., Acampora, D., Pannese, M., D’Esposito, M., Stornaiuolo, A., Gulisano, M., Mallamaci, A., Kastury, K., Druck, T., & Huebner, K. (1994) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.91.6.2250 · Cited by 277 · see citing works
A mouse gene related to Distal-less shows a restricted expression in the developing forebrain
Price, M., Lemaistre, M., Pischetola, M., Lauro, R. D., & Duboule, D. (1991) · Nature · doi:10.1038/351748a0 · Cited by 274 · see citing works
Heterodimerization of Msx and Dlx Homeoproteins Results in Functional Antagonism
Zhang, H., Hu, G., Wang, H., Sciavolino, P. J., Iler, N., Shen, M. M., & Abate-Shen, C. T. (1997) · Molecular and Cellular Biology · doi:10.1128/mcb.17.5.2920 · Cited by 262 · see citing works
Ectopic expression of the Dlx genes induces glutamic acid decarboxylase and Dlx expression
Stühmer, T., Anderson, S. A., Ekker, M., & Rubenstein, J. L. R. (2002) · Development · doi:10.1242/dev.129.1.245 · Cited by 257 · see citing works
Williams-Beuren syndrome:genes and mechanisms
Francke, U. (1999) · Human Molecular Genetics · doi:10.1093/hmg/8.10.1947 · Cited by 238 · see citing works
Differential and overlapping expression domains of Dlx-2 and Dlx-3 suggest distinct roles for Distal-less homeobox genes in craniofacial development
Robinson, G. W., & Mahon, K. A. (1994) · Mechanisms of Development · doi:10.1016/0925-4773(94)90060-4 · Cited by 232 · see citing works
Fourteen new cases contribute to the characterization of the 7q11.23 microduplication syndrome
Van der Aa, N., Rooms, L., Vandeweyer, G., van den Ende, J., Reyniers, E., Fichera, M., Romano, C., Delle Chiaie, B., Mortier, G., Menten, B., et al. (2009) · European Journal of Medical Genetics · doi:10.1016/j.ejmg.2009.02.006 · Cited by 216 · see citing works
A spatial bias for the origins of interneuron subgroups within the medial ganglionic eminence
Wonders, C. P., Taylor, L. A., Welagen, J., Mbata, I. C., Xiang, J., & Anderson, S. A. (2007) · Developmental Biology · doi:10.1016/j.ydbio.2007.11.018 · Cited by 215 · see citing works
The evolution of the vertebrate Dlx gene family.
Stock, D. W., Ellies, D. L., Zhao, Z., Ekker, M., Ruddle, F. H., & Weiss, K. M. (1996) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.93.20.10858 · Cited by 214 · see citing works
Isolation and characterization of a novel cDNA clone encoding a homeodomain that is developmentally regulated in the ventral forebrain
Porteus, M. H., Bulfone, A., Ciaranello, R. D., & Rubenstein, J. L. R. (1991) · Neuron · doi:10.1016/0896-6273(91)90260-7 · Cited by 208 · see citing works
Expression from a Dlx Gene Enhancer Marks Adult Mouse Cortical GABAergic Neurons
Stühmer, T. (2002) · Cerebral Cortex · doi:10.1093/cercor/12.1.75 · Cited by 198 · see citing works
Dlx5andDlx6Regulate the Development of Parvalbumin-Expressing Cortical Interneurons
Wang, Y., Dye, C. A., Sohal, V. S., Long, J. E., Estrada, R. C., Roztocil, T., Lufkin, T., Deisseroth, K. A., Baraban, S. C., & Rubenstein, J. L. R. (2010) · Journal of Neuroscience · doi:10.1523/jneurosci.5963-09.2010 · Cited by 186 · see citing works
Dlx1&2 and Mash1 Transcription Factors Control MGE and CGE Patterning and Differentiation through Parallel and Overlapping Pathways
Long, J. E., Cobos, I., Potter, G. B., & Rubenstein, J. L. R. (2009) · Cerebral Cortex · doi:10.1093/cercor/bhp045 · Cited by 178 · see citing works
Regulatory Roles of Conserved Intergenic Domains in Vertebrate Dlx Bigene ClustersPreprint
Ghanem, N., Jarinova, O., Amores, A., Long, Q., Hatch, G., Park, B. K., Rubenstein, J. L. R., & Ekker, M. (2003) · Genome Research · doi:10.1101/gr.716103 · Cited by 177 · see citing works
Point mutations in a distant sonic hedgehog cis-regulator generate a variable regulatory output responsible for preaxial polydactyly
Lettice, L. A., Hill, A. E., Devenney, P. S., & Hill, R. E. (2007) · Human Molecular Genetics · doi:10.1093/hmg/ddm370 · Cited by 172 · see citing works
Dlx1&2 and Mash1 transcription factors control striatal patterning and differentiation through parallel and overlapping pathways
Long, J. E., Swan, C. H., Liang, W. S., Cobos, I., Potter, G. B., & Rubenstein, J. L. R. (2008) · The Journal of Comparative Neurology · doi:10.1002/cne.21854 · Cited by 156 · see citing works
Rethinking the nature of genetic vulnerability to autistic spectrum disorders
Skuse, D. H. (2007) · Trends in Genetics · doi:10.1016/j.tig.2007.06.003 · Cited by 147 · see citing works
Characteristics of the broader phenotype in autism: A study of siblings using the children's communication checklist‐2
Bishop, D., Maybery, M. T., Wong, D. K., Maley, A., & Hallmayer, J. F. (2006) · American Journal of Medical Genetics Part B Neuropsychiatric Genetics · doi:10.1002/ajmg.b.30267 · Cited by 139 · see citing works
Socio-Communicative Deficits in Young Children with Williams Syndrome: Performance on the Autism Diagnostic Observation Schedule
Klein-Tasman, B., Mervis, C. Β., Lord, C., & Phillips, K. D. (2006) · Child Neuropsychology · doi:10.1080/09297040601033680 · Cited by 129 · see citing works
Spatially restricted expression of a member of a new family of murine Distal-less homeobox genes in the developing forebrain.
Robinson, G. W., Wray, S., & Mahon, K. A. (1991) · PubMed · Cited by 129 · see citing works
An atypical deletion of the Williams–Beuren syndrome interval implicates genes associated with defective visuospatial processing and autism
Edelmann, L., Prosnitz, A., Pardo, S., Bhatt, J., Cohen, N., Lauriat, T., Ouchanov, L., González, P. J., Manghi, E. R., Bondy, P., et al. (2007) · Journal of Medical Genetics · doi:10.1136/jmg.2006.044537 · Cited by 113 · see citing works
Distinct cis -Regulatory Elements from the Dlx1/Dlx2 Locus Mark Different Progenitor Cell Populations in the Ganglionic Eminences and Different Subtypes of Adult Cortical Interneurons
Ghanem, N., Yu, M., Long, J. E., Hatch, G., Rubenstein, J. L. R., & Ekker, M. (2007) · Journal of Neuroscience · doi:10.1523/jneurosci.4725-06.2007 · Cited by 110 · see citing works
Characterization of Conserved and Nonconserved Imprinted Genes in Swine1
Bischoff, S. R., Tsai, S. Q., Hardison, N. E., Motsinger‐Reif, A. A., Freking, B. A., Nonneman, D., Rohrer, G. A., & Piedrahita, J. A. (2009) · Biology of Reproduction · doi:10.1095/biolreprod.109.078139 · Cited by 107 · see citing works
The proneural determinant MASH1 regulates forebrainDlx1/2expression through the I12b intergenic enhancer
Poitras, L., Ghanem, N., Hatch, G., & Ekker, M. (2007) · Development · doi:10.1242/dev.02845 · Cited by 103 · see citing works
Social Interaction Behaviors Discriminate Young Children With Autism and Williams Syndrome
Lincoln, A. J., Searcy, Y. M., JONES, W., & Lord, C. (2007) · Journal of the American Academy of Child & Adolescent Psychiatry · doi:10.1097/chi.0b013e31802b9522 · Cited by 94 · see citing works
The DLX1and DLX2 genes and susceptibility to autism spectrum disorders
Liu, X., Novosedlik, N., Wang, A., Hudson, M. L., Cohen, I. L., Chudley, A. E., Forster‐Gibson, C., Lewis, M. E. S., & Holden, J. J. A. (2008) · European Journal of Human Genetics · doi:10.1038/ejhg.2008.148 · Cited by 93 · see citing works
Transcriptional activation by the homeodomain protein Distal-less 3
Feledy, J. A., Sargent, T. D., Morasso, M. I., & Jang, S. I. (1999) · Nucleic Acids Research · doi:10.1093/nar/27.3.764 · Cited by 92 · see citing works
A new imprinted cluster on the human chromosome 7q21-q31, identified by human-mouse monochromosomal hybrids
Okita, C., Meguro, M., Hoshiya, H., Haruta, M., Sakamoto, Y., & Oshimura, M. (2003) · Genomics · doi:10.1016/s0888-7543(03)00052-1 · Cited by 81 · see citing works
Dlx Homeobox Genes Promote Cortical Interneuron Migration from the Basal Forebrain by Direct Repression of the Semaphorin Receptor Neuropilin-2
Le, T., Du, G., Fonseca, M. A., Zhou, Q.-P., Wigle, J. T., & Eisenstat, D. D. (2007) · Journal of Biological Chemistry · doi:10.1074/jbc.m607486200 · Cited by 80 · see citing works
Genomic Analysis of a New Mammalian Distal-less Gene: Dlx7
Nakamura, S., Stock, D. W., Wydner, K. L., Bollekens, J. A., Takeshita, K., Nagai, B. M., Chiba, S., Kitamura, T., Freeland, T. M., Zhao, Z., et al. (1996) · Genomics · doi:10.1006/geno.1996.0634 · Cited by 75 · see citing works
Analysis of four DLX homeobox genes in autistic probands
Hamilton, S. P., Woo, J. M., Carlson, E. J., Ghanem, N., Ekker, M., & Rubenstein, J. L. R. (2005) · BMC Genetics · doi:10.1186/1471-2156-6-52 · Cited by 71 · see citing works
Identification of a direct Dlx homeodomain target in the developing mouse forebrain and retina by optimization of chromatin immunoprecipitation
Zhou, Q. (2004) · Nucleic Acids Research · doi:10.1093/nar/gkh233 · Cited by 64 · see citing works
DLX5 and DLX6 Expression Is Biallelic and Not Modulated by MeCP2 Deficiency
Schüle, B., Li, H. H., Fisch-Kohl, C., Purmann, C., & Francke, U. (2007) · The American Journal of Human Genetics · doi:10.1086/520063 · Cited by 59 · see citing works
Identification of the TFII-I family target genes in the vertebrate genome
Chimge, N., Makeyev, A. V., Ruddle, F. H., & Bayarsaihan, D. (2008) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0803051105 · Cited by 46 · see citing works
Characterization of a distinct subpopulation of striatal projection neurons expressing the Dlx genes in the basal ganglia through the activity of the I56ii enhancer
Ghanem, N., Yu, M., Poitras, L., Rubenstein, J. L. R., & Ekker, M. (2008) · Developmental Biology · doi:10.1016/j.ydbio.2008.07.029 · Cited by 36 · see citing works
Expression analysis and mutation detection of DLX5 and DLX6 in autism
Nakashima, N., Yamagata, T., Mori, M., Kuwajima, M., Suwa, K., & Momoi, M. Y. (2009) · Brain and Development · doi:10.1016/j.braindev.2008.12.021 · Cited by 34 · see citing works
Dlx5, the mouse homologue of the human-imprinted DLX5 gene, is biallelically expressed in the mouse brain
Kimura, M. I., Kazuki, Y., Kashiwagi, A., Kai, Y., Abe, S., Barbieri, O., Levi, G., & Oshimura, M. (2004) · Journal of Human Genetics · doi:10.1007/s10038-004-0139-2 · Cited by 34 · see citing works
Isolation and imprinting analysis of the porcine DLX5 gene and its association with carcass traits
Cheng, H., Zhang, F. W., Jiang, C., Li, F. E., Xiong, Y. Z., & Deng, C. Y. (2008) · Animal Genetics · doi:10.1111/j.1365-2052.2008.01740.x · Cited by 27 · see citing works
Assignment of the human homolog of mouse Dlx3 to Chromosome 17q21.3-q22 by analysis of somatic cell hybrids and fluorescence in situ hybridization
Scherer, S. W., Heng, H. H., Robinson, G. W., Mahon, K. A., Evans, J. P., & Tsui, L. ‐. (1995) · Mammalian Genome · doi:10.1007/bf00352432 · Cited by 25 · see citing works
Autism and ultraconserved non-coding sequence on chromosome 7q
Richler, E., Reichert, J. G., Buxbaum, J. D., & McInnes, L. A. (2006) · Psychiatric Genetics · doi:10.1097/01.ypg.0000180683.18665.ef · Cited by 18 · see citing works

Flagged first, then by citations

Sorted by citations

Foxp2 regulates gene networks implicated in neurite outgrowth in the developing brain
Vernes, S. C., Oliver, P. L., Spiteri, E., Lockstone, H. E., Puliyadi, R., Taylor, J. M., Ho, J., Mombereau, C., Brewer, A., Lowy, E., et al. (2011) · PLoS Genetics · doi:10.1371/journal.pgen.1002145 · Cited by 276 · see citing works
“Thus it is interesting that both the DLX1/2 and DLX5/6 loci have been implicated in autism via independent studies, including a common polymorphism in the DLX5/6 enhancer itself [51–53].”
Background
CRISPR/Cas9-mediated heterozygous knockout of the autism gene CHD8 and characterization of its transcriptional networks in cerebral organoids derived from iPS cells
Wang, P., Mokhtari, R., Pedrosa, E., Kirschenbaum, M. A., Bayrak, C., Zheng, D., & Lachman, H. M. (2017) · Molecular Autism · doi:10.1186/s13229-017-0124-1 · Cited by 255 · see citing works
A High-Resolution Enhancer Atlas of the Developing Telencephalon
Visel, A., Taher, L., Girgis, H., May, D., Golonzhka, O., Hoch, R. V., McKinsey, G. L., Pattabiraman, K., Silberberg, S. N., Blow, M. J., et al. (2013) · Cell · doi:10.1016/j.cell.2012.12.041 · Cited by 257 · see citing works
“However, the functional interpretation of noncoding sequence or copy-number variants remains a major challenge, and few potentially causative connections linking neurological traits to molecular variation in enhancers have been identified (e.g. Poitras et al., 2010).”
Self-citation
Williams syndrome
Kozel, B. A., Barak, B., Kim, C. A., Mervis, C. Β., Osborne, L. R., Porter, M. A., & Pober, B. R. (2021) · Nature Reviews Disease Primers · doi:10.1038/s41572-021-00276-z · Cited by 251 · see citing works
The shape of the human language-ready brain
Boeckx, C. A. (2014) · Frontiers in Psychology · doi:10.3389/fpsyg.2014.00282 · Cited by 158 · see citing works
Genomic Perspectives of Transcriptional Regulation in Forebrain Development
Nord, A. S., Pattabiraman, K., Visel, A., & Rubenstein, J. L. R. (2015) · Neuron · doi:10.1016/j.neuron.2014.11.011 · Cited by 152 · see citing works
“…of distal enhancers (Visel et al., 2009a), changes in enhancer activity due to sequence variation associated with evolution and human disease (Poitras et al., 2010; Prabhakar et al., 2008), and to label cells in fate mapping experiments (Chen et al., 2013; Pattabiraman et al., 2014; Visel et…”
Self-citation
Evf2 (Dlx6as) lncRNA regulates ultraconserved enhancer methylation and the differential transcriptional control of adjacent genes
Berghoff, E. G., Clark, M. F., Chen, S., Cajigas, I., Leib, D. E., & Kohtz, J. D. (2013) · Development · doi:10.1242/dev.099390 · Cited by 156 · see citing works
“, 2009), transcriptional effects of a single nucleotide polymorphism (SNP) in Dlx5/6ei linked to autism (Poitras et al., 2010), and the established role of MECP2 in autism (Guy et al.”
Background
Evf2 lncRNA/BRG1/DLX1 interactions reveal RNA-dependent chromatin remodeling inhibition
Cajigas, I., Leib, D. E., Cochrane, J. C., Luo, H., Swyter, K. R., Chen, S., Clark, B. S., Thompson, J. X., Yates, J. R., Kingston, R. E., et al. (2015) · Development · doi:10.1242/dev.126318 · Cited by 103 · see citing works
“ADlx5/6 ei SNP that disrupts DLX1/2 binding was identified in an autistic proband (Poitras et al., 2010).”
Background
Dlx1andDlx2Promote Interneuron GABA Synthesis, Synaptogenesis, and Dendritogenesis
Pla, R., Stanco, A., Howard, M. A., Rubin, A. N., Vogt, D. L., Mortimer, N., Cobos, I., Potter, G. B., Lindtner, S., Price, J. D., et al. (2017) · Cerebral Cortex · doi:10.1093/cercor/bhx241 · Cited by 93 · see citing works
“…mutations have not been proven to cause neuropsychiatric disorders, we suggest that Dlx alleles could sensitize to disease (Hamilton et al. 2005; Poitras et al. 2010), which is supported by the observation that multiple Dlxregulated genes are implicated in human brain disorders, including Arx,…”
Background
Optimizing neuronal differentiation from induced pluripotent stem cells to model ASD
Kim, D.-S., Ross, P. J., Zaslavsky, K., & Ellis, J. (2014) · Frontiers in Cellular Neuroscience · doi:10.3389/fncel.2014.00109 · Cited by 70 · see citing works
“Several genetic studies in humans and mice have implicated dysfunctional development or migration of GABAergic interneurons with many psychiatric and neurodevelopmental disorders (Powell et al., 2003; Gant et al., 2009; Poitras et al., 2010).”
Background
Language Impairments in ASD Resulting from a Failed Domestication of the Human Brain
Benítez‐Burraco, A., Lattanzi, W., & Murphy, E. (2016) · Frontiers in Neuroscience · doi:10.3389/fnins.2016.00373 · Cited by 61 · see citing works
Functional characterization of tissue-specific enhancers in the DLX5/6 locus
Birnbaum, R. Y., Everman, D. B., Murphy, K. K., Gurrieri, F., Schwartz, C. E., & Ahituv, N. (2012) · Human Molecular Genetics · doi:10.1093/hmg/dds336 · Cited by 63 · see citing works
“Furthermore, a nucleotide variant found in an autistic individual affects the binding of DLX to I56i and reduces DLX5/6 expression in these GABAergic interneurons (12).”
Background
Language deficits in schizophrenia and autism as related oscillatory connectomopathies: An evolutionary account
Murphy, E., & Benítez‐Burraco, A. (2016) · Neuroscience & Biobehavioral Reviews · doi:10.1016/j.neubiorev.2016.07.029 · Cited by 64 · see citing works
“…the migration and differentiation of GABA-expressing neurons in the forebrain: This regulatory element has been found mutated in people with ASD (Poitras et al. 2010) and it is bound by GTF2I, encoded by one of the genes commonly deleted in Williams-Beuren syndrome and a candidate for ASD too…”
Background
Toward microRNA-mediated gene regulatory networks in plants
Meng, Y., Shao, C., & Chen, M. (2011) · Briefings in Bioinformatics · doi:10.1093/bib/bbq091 · Cited by 62 · see citing works
A LINE-1 Insertion in DLX6 Is Responsible for Cleft Palate and Mandibular Abnormalities in a Canine Model of Pierre Robin Sequence
Wolf, Z. T., Leslie, E. J., Arzi, B., Jayashankar, K., Karmi, N., Jia, Z., Rowland, D. J., Young, A. E., Safra, N., Saundra, S., et al. (2014) · PLoS Genetics · doi:10.1371/journal.pgen.1004257 · Cited by 57 · see citing works
“Reduced DLX5 and DLX6 expression was observed in an autistic patient with a SNP in the DLX5 and DLX6 intergenic region [41].”
Background
A polymorphism associated with depressive disorders differentially regulates brain derived neurotrophic factor promoter IV activity
Hing, B., Davidson, S., Lear, M., Breen, G., Quinn, J., McGuffin, P., & MacKenzie, A. (2012) · Biological Psychiatry · doi:10.1016/j.biopsych.2011.11.030 · Cited by 52 · see citing works
Dlx5 and Dlx6 expression in GABAergic neurons controls behavior, metabolism, healthy aging and lifespan
de Lombares, C., Heude, E., Alfama, G., Fontaine, A., Hassouna, R., Vernochet, C., de Chaumont, F., Olivo-Marin, C., Ey, E., Parnaudeau, S., et al. (2019) · Aging · doi:10.18632/aging.102141 · Cited by 52 · see citing works
Haploinsufficiency of CELF4 at 18q12.2 is associated with developmental and behavioral disorders, seizures, eye manifestations, and obesity
Halgren, C., Bache, I., Bak, M., Myatt, M. W., Anderson, C. M., Brøndum‐Nielsen, K., & Tommerup, N. (2012) · European Journal of Human Genetics · doi:10.1038/ejhg.2012.92 · Cited by 42 · see citing works
Identifying causal regulatory SNPs in ChIP-seq enhancers
Huang, D., & Ovcharenko, I. (2014) · Nucleic Acids Research · doi:10.1093/nar/gku1318 · Cited by 42 · see citing works
“So far, efforts to prioritize ncSNPs have extensively relied on evolutionary conservation (17,18).”
Background
Disruption of long-range gene regulation in human genetic disease: a kaleidoscope of general principles, diverse mechanisms and unique phenotypic consequences
Bhatia, S., & Kleinjan, D. A. (2014) · Human Genetics · doi:10.1007/s00439-014-1424-6 · Cited by 41 · see citing works
GTF2I dosage regulates neuronal differentiation and social behavior in 7q11.23 neurodevelopmental disorders
Tobon, A., Shyti, R., Villa, C. E., Cheroni, C., Fuentes-Bravo, P., Trattaro, S., Caporale, N., Troglio, F., Tenderini, E., Mihailovich, M., et al. (2023) · Science Advances · doi:10.1126/sciadv.adh2726 · Cited by 39 · see citing works
Associating schizophrenia, long non-coding RNAs and neurostructural dynamics
Merelo, V., Durand, D., Lescallette, A. R., Vrana, K. E., Hong, L. E., Faghihi, M. A., & Bellon, A. (2015) · Frontiers in Molecular Neuroscience · doi:10.3389/fnmol.2015.00057 · Cited by 37 · see citing works
“Dlx homeobox genes products play a crucial role in migration and differentiation of the subpallial precursor cells that give rise to various subtypes of gamma-aminobutiric acid (GABA)-expressing neurons of the forebrain, including localcircuit cortical interneurons (Poitras et al., 2010).”
Background
Toward the Language Oscillogenome
Murphy, E., & Benítez‐Burraco, A. (2018) · Frontiers in Psychology · doi:10.3389/fpsyg.2018.01999 · Cited by 30 · see citing works
“DLX5, DLX6, and MECP2 GAD1 interacts with DLX5 and DLX6, two genes that encode homeobox transcription factors important for GABAergic interneuron development (Cobos et al., 2006; Ghanem et al., 2008; Poitras et al., 2010).”
Background
Developing zebrafish experimental animal models relevant to schizophrenia
Demin, K. A., Мешалкина, Д. А., Volgin, A. D., Yakovlev, O. V., de Abreu, M. S., Alekseeva, P. A., Friend, A. J., Lakstygal, A. M., Zabegalov, K. N., Amstislavskaya, T. G., et al. (2019) · Neuroscience & Biobehavioral Reviews · doi:10.1016/j.neubiorev.2019.07.017 · Cited by 30 · see citing works
DLX5/6 GABAergic Expression Affects Social Vocalization: Implications for Human Evolution
Levi, G., de Lombares, C., Giuliani, C., Iannuzzi, V., Aouci, R., Garagnani, P., Franceschi, C., Grimaud-Hervé, D., & Narboux-Nême, N. (2021) · Molecular Biology and Evolution · doi:10.1093/molbev/msab181 · Cited by 29 · see citing works
Ultraconserved Elements Occupy Specific Arenas of Three-Dimensional Mammalian Genome Organization
McCole, R. B., Erceg, J., Saylor, W., & Wu, C.-T. (2018) · Cell Reports · doi:10.1016/j.celrep.2018.06.031 · Cited by 29 · see citing works
The impact of maternal immune activation on GABAergic interneuron development: A systematic review of rodent studies and their translational implications
Gillespie, B., Panthi, S., Sundram, S., & Hill, R. (2023) · Neuroscience & Biobehavioral Reviews · doi:10.1016/j.neubiorev.2023.105488 · Cited by 30 · see citing works
“1 pathway in schizophrenia (Malt et al., 2016; Kathuria et al., 2020; Volk et al., 2012), and associations between mutations in ARX (Sherr, 2003) and multiple DLX genes (Liu et al., 2009; Poitras et al., 2010) with ASD.”
DLX genes and proteins in mammalian forebrain development
Rubenstein, J. L. R., Nord, A. S., & Ekker, M. (2024) · Development · doi:10.1242/dev.202684 · Cited by 27 · see citing works
Conceptualizing neurodevelopmental disorders through a mechanistic understanding of fragile X syndrome and Williams syndrome
Fung, L. K., Quintin, E., Haas, B. W., & Reiss, A. L. (2012) · Current Opinion in Neurology · doi:10.1097/wco.0b013e328351823c · Cited by 27 · see citing works
The evolution of ultraconserved elements with different phylogenetic origins
Ryu, T., Seridi, L., & Ravasi, T. (2012) · BMC Evolutionary Biology · doi:10.1186/1471-2148-12-236 · Cited by 28 · see citing works
“Single nucleotide polymorphisms (SNPs) in UCEs have been linked to cancer risk, impaired TF binding, and homeobox gene regulation in the central nervous system [11,12].”
Background
A DNA-Centric Protein Interaction Map of Ultraconserved Elements Reveals Contribution of Transcription Factor Binding Hubs to Conservation
Viturawong, T., Meissner, F., Butter, F., & Mann, M. (2013) · Cell Reports · doi:10.1016/j.celrep.2013.09.022 · Cited by 27 · see citing works
Lens development depends on a pair of highly conserved Sox21 regulatory elements
Pauls, S., Smith, S. F., & Elgar, G. S. (2012) · Developmental Biology · doi:10.1016/j.ydbio.2012.02.025 · Cited by 25 · see citing works
Transcription factors in neurodevelopmental and associated psychiatric disorders: A potential convergence for genetic and environmental risk factors
Santos‐Terra, J., Deckmann, I., Fontes‐Dutra, M., Schwingel, G. B., Bambini-Júnior, V., & Gottfried, C. (2021) · International Journal of Developmental Neuroscience · doi:10.1002/jdn.10141 · Cited by 24 · see citing works
“, 2005) decreased DLX5/6 transcriptional activity in GABAergic interneurons from embryonic to postnatal life (Poitras et al., 2010), impairing cell migration, maturation, and survival (Lindtner et al.”
Background
Abnormal Dosage of Ultraconserved Elements Is Highly Disfavored in Healthy Cells but Not Cancer Cells
McCole, R. B., Fonseka, C. Y., Koren, A., & Wu, C.-T. (2014) · PLoS Genetics · doi:10.1371/journal.pgen.1004646 · Cited by 23 · see citing works
Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila
Warnefors, M., Hartmann, B., Thomsen, S., & Alonso, C. R. (2016) · Molecular Biology and Evolution · doi:10.1093/molbev/msw101 · Cited by 22 · see citing works
“…to link mutations in UCEs to phenotypic outcomes (Drake et al. 2006; Ahituv et al. 2007; Chen et al. 2007; Yang et al. 2008; Catucci et al. 2009; Poitras et al. 2010; Chiang et al. 2012), a recent survey of 11 insertions into Drosophila UCEs identified four as recessive lethal (Makunin et al.…”
Background
Single-Cell Transcriptomics Supports a Role of CHD8 in Autism
Hoffmann, A., & Spengler, D. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22063261 · Cited by 19 · see citing works
“In mice, a splice variant of Dlx6-AS1, called Dlx6-AS2, cooperates with Dlx1 and Dlx2 proteins in coactivation of the Dlx5/Dlx6 enhancer [77] and promotes differentiation of GABAergic interneurons in the developing forebrain [78,79].”
Background
Regulatory variations in the era of next-generation sequencing: Implications for clinical molecular diagnostics
Jarinova, O., & Ekker, M. (2012) · Human Mutation · doi:10.1002/humu.22083 · Cited by 18 · see citing works
“This example illustrates how a combination of experimental approaches can provide important insights into the biological significance of regulatory changes in the context of human disease [Poitras et al., 2010].”
BackgroundMethod
LncRNAs in neuropsychiatric disorders and computational insights for their prediction
Baruah, C., Nath, P., & Barah, P. (2022) · Molecular Biology Reports · doi:10.1007/s11033-022-07819-x · Cited by 17 · see citing works
“Dlx expression brings about the migration and differentiation of subpallial cells that are precursors of various subtypes of GABA [ 10, 11, 23].”
Background
Implications of genomic signatures in the differential vulnerability to fetal alcohol exposure in C57BL/6 and DBA/2 mice
Lossie, A. C., Muir, W. M., Lo, C., Timm, F. A., Liu, Y., Gray, W., & Zhou, F. (2014) · Frontiers in Genetics · doi:10.3389/fgene.2014.00173 · Cited by 16 · see citing works
Comparison of Ultra-Conserved Elements in Drosophilids and Vertebrates
Makunin, I. V., Shloma, V. V., Stephen, S. J., Pheasant, M., & Belyakin, S. N. (2013) · PLoS ONE · doi:10.1371/journal.pone.0082362 · Cited by 15 · see citing works
“Indeed, an SNP in an ultraconserved regulatory sequence is linked with Dlx5/Dlx6 expression in the forebrain [34].”
Background
Dlx5/6 Expression Levels in Mouse GABAergic Neurons Regulate Adult Parvalbumin Neuronal Density and Anxiety/Compulsive Behaviours
Aouci, R., Soudany, M. E., Maakoul, Z., Fontaine, A., Kurihara, H., Levi, G., & Narboux‐Nême, N. (2022) · Cells · doi:10.3390/cells11111739 · Cited by 14 · see citing works
Association of GTF2I gene polymorphisms with renal involvement of systemic lupus erythematosus in a Chinese population
Meng, Y., He, Y., Zhang, J., Xie, Q., Yang, M., Chen, Y., & Wu, Y. (2019) · Medicine · doi:10.1097/md.0000000000016716 · Cited by 14 · see citing works
“As a signal-induced transcription, TFII-I can not only regulate transcription,([8]) signal transduction and development of bone, neural tissue,([9]) but also participate in the process of immune regulation.”
Background
The regulatory landscape of the Dlx gene system in branchial arches: Shared characteristics among Dlx bigene clusters and evolution
Sumiyama, K., & Tanave, A. (2020) · Development, Growth and Differentiation · doi:10.1111/dgd.12671 · Cited by 11 · see citing works
“This intergenic region also includes I56ii, which is not a branchial arch enhancer but is active in the developing forebrain and in the specific GABAergic interneurons (Ghanem et al., 2003, Poitras et al., 2010) (Figure 2a, 3b).”
Background
Increased Sociability in Mice Lacking Intergenic Dlx Enhancers
Darbandi, S. F., Esau, C., Lesage‐Pelletier, C., Monis, S., Poitras, L., Yu, M., Perin, S., Hatch, G., & Ekker, M. (2021) · Frontiers in Neuroscience · doi:10.3389/fnins.2021.718948 · Cited by 12 · see citing works
“Our biochemical analysis of I56i (Poitras et al., 2010) identified factors that bind to the region of I56i where the SNP was found.”
BackgroundMethodInfluential
Evolution of General Transcription Factors
Владимирович, Г. К., & Ruvinsky, A. O. (2012) · Journal of Molecular Evolution · doi:10.1007/s00239-012-9535-y · Cited by 11 · see citing works
“…of immunoglobulin heavy-chain gene (Ren et al. 2011), beta-globin gene (Crusselle-Davis et al. 2007), Dlx5/Dlx6 genes in the forebrain (Poitras et al. 2010), troponin I (Tay et al. 2003), some HIV-1 genes (Malcolm et al. 2007, 2008), Rous sarcoma virus genes (Mobley and Sealy 2000),…”
Background
The mutational landscape and functional effects of noncoding ultraconserved elements in human cancers
Bayraktar, R., Tang, Y., Dragomir, M. P., Ivan, C., Peng, X., Fabris, L., Zhang, J., Carugo, A., Aneli, S., Liu, J., et al. (2025) · Science Advances · doi:10.1126/sciadv.ado2830 · Cited by 10 · see citing works
“Subsequently, a few UCE sequence variations were reported to be associated with human diseases ( 22 – 24 ).”
Dlx5 Homeodomain:DNA Complex: Structure, Binding and Effect of Mutations Related to Split Hand and Foot Malformation Syndrome
Proudfoot, A., Axelrod, H. L., Geralt, M., Fletterick, R. J., Yumoto, F., Deacon, A. M., Elsliger, M., Wilson, I. A., Kurt Wüthrich, A., & Serrano, P. (2016) · Journal of Molecular Biology · doi:10.1016/j.jmb.2016.01.023 · Cited by 10 · see citing works
“A 21 bp DNA sequence, AAATGCAGCCATAATTAGAGT, had previously been identified to target expression of the Dlx5/Dlx6 bi-gene cluster to the developing forebrain in mice [24].”
Early developmental gene enhancers affect subcortical volumes in the adult human brain
Becker, M., Guadalupe, T. M., Franke, B., Hibar, D. P., Rentería, M. E., Stein, J. L., Thompson, P. M., Francks, C., Vernes, S. C., & Fisher, S. E. (2016) · Human Brain Mapping · doi:10.1002/hbm.23136 · Cited by 9 · see citing works
“For example, a rare variant implicated in autism was found in an enhancer that is active during forebrain development [Poitras et al., 2010].”
Background
Transcription factor TFII-I fine tunes innate properties of B lymphocytes
Singh, A., Kaileh, M., De, S., Mazan-Mamczarz, K., Bayarsaihan, D., Sen, R., & Roy, A. L. (2023) · Frontiers in Immunology · doi:10.3389/fimmu.2023.1067459 · Cited by 8 · see citing works
“Given that TFII-I has been implicated in regulating homeotic genes like Dlx5 and Dlx6 (45) our observation that loss of TFII-I results in the open chromatin of homeobox containing motifs (Fig 5C) also suggests that regulation of homeobox genes in B cell function could be an important role of TFII-I.”
Background
The Antidepressant Action of Fluoxetine Involves the Inhibition of Dlx5/6 in Cortical GABAergic Neurons through a TrkB-Dependent Pathway
Aouci, R., Fontaine, A., Vion, A., Belz, L., Levi, G., & Narboux‐Nême, N. (2024) · Cells · doi:10.3390/cells13151262 · Cited by 7 · see citing works
“Patients carrying mutations in the DLX5/6 brain-specific enhancers, which include the I56i , I56ii and MEF2 [55,56], present a higher incidence of ASD and speech delay [11,57–59].”
Background
Role of Splice Variants of Gtf2i, a Transcription Factor Localizing at Postsynaptic Sites, and Its Relation to Neuropsychiatric Diseases
Shirai, Y., Li, W., & Suzuki, T. (2017) · International Journal of Molecular Sciences · doi:10.3390/ijms18020411 · Cited by 7 · see citing works
“These mutations may alter the binding properties of this element to GTF2I and DLX2, which would impair the transcriptional activation of I56i [47].”
BackgroundInfluential
Evaluation of conserved and ultra‐conserved non‐genic sequences in chromosome 15q15‐linked periodic catatonia
Schanze, D., Ekici, A. B., Pfuhlmann, B., Reis, A., & Stöber, G. (2011) · American Journal of Medical Genetics Part B Neuropsychiatric Genetics · doi:10.1002/ajmg.b.32004 · Cited by 6 · see citing works
Novel splice variants in the 5'UTR of Gtf2i expressed in the rat brain: alternative 5'UTRs and differential expression in the neuronal dendrites
Shirai, Y., Watanabe, M., Sakagami, H., & Suzuki, T. (2015) · Journal of Neurochemistry · doi:10.1111/jnc.13136 · Cited by 5 · see citing works
“Gtf2i regulates, via binding to the enhancer region, the expression of the Dlx homeobox gene (Poitras et al. 2010) that is involved in the differentiation and migration of GABA-expressing neurons in the forebrain.”
Background
GC-biased gene conversion drives accelerated evolution of ultraconserved elements in mammalian and avian genomesPreprint
Liu, A., Wang, N., Xie, G., Li, Y., Yan, X., Li, X., Zhu, Z., Li, Z., Yang, J., Meng, F., et al. (2023) · Genome Research · doi:10.1101/gr.277784.123 · Cited by 5 · see citing works
“UCEs have also been found to encompass various functions, including enhancer, promoter, splicing, and repressive activities (Pennacchio et al. 2006; Poitras et al. 2010; Snetkova et al. 2022).”
Functional associations of evolutionarily recent human genes exhibit sensitivity to the 3D genome landscape and diseasePreprint
Fleck, K., Luria, V., Garag, N., Karger, A., Hunter, T., Marten, D., Phu, W., Nam, K.-M., Šestan, N., O’Donnell‐Luria, A., et al. (2024) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/2024.03.17.585403 · Cited by 5 · see citing works
Small SNPs, Big Effects: A Review of Single Nucleotide Variations and Polymorphisms in Key Genes Associated With Autism Spectrum Disorder
Srinath, S., Kalal, A. A., Anand, P., Mohapatra, S., & Chakraborty, P. (2025) · International Journal of Developmental Neuroscience · doi:10.1002/jdn.70016 · Cited by 4 · see citing works
“…Caps2/Cadps2 model of ASD (Sadakata et al. 2013), studied the role of SNPs in K+ channels in the valproic acid model of autism (Sun et al. 2021), and an SNP in the Dlx5/Dlx6 homeobox domain affects cortical neuronal migration and reduced inhibition in the somatosensory cortex (Poitras et al. 2010).”
Increased expression levels of DLX5 inhibit the development of the nervous system
Liao, T., Xu, X., Wu, J., Xie, Y., & Yan, J. (2023) · International Journal of Developmental Neuroscience · doi:10.1002/jdn.10300 · Cited by 3 · see citing works
“The abnormal development of GABAergic interneurons is associated with a variety of neurodevelopmental disorders, including epilepsy, schizophrenia, Rett syndrome, and autism (Poitras et al., 2010).”
Background
Learning about mammalian gene regulation from functional enhancer assays in the mouse
Nord, A. S. (2015) · Genomics · doi:10.1016/j.ygeno.2015.06.008 · Cited by 3 · see citing works
Structural disruption of genomic regions containing ultraconserved elements is associated with neurodevelopmental phenotypesPreprint
McCole, R. B., Saylor, W., Redin, C. E., Fonseka, C. Y., Brand, H., Erceg, J., Talkowski, M. E., & Wu, C.-T. (2017) · bioRxiv (Cold Spring Harbor Laboratory) · doi:10.1101/233197 · Cited by 3 · see citing works
Tangential Migration
Petros, T. J., & Anderson, S. A. (2013) · Elsevier eBooks · doi:10.1016/b978-0-12-397266-8.00031-4 · Cited by 1 · see citing works
Ultraconserved Elements ( UCEs ) in the Human Genome
Lee, A., & Venkatesh, B. (2013) · Encyclopedia of Life Sciences · doi:10.1002/9780470015902.a0020842.pub2 · Cited by 1 · see citing works
Functional Analysis of Dlx Intergenic Enhancers in the Developing Mouse Forebrain
Darbandi, S. F. (2014) · uO Research (University of Ottawa) · doi:10.20381/ruor-3734 · Cited by 1 · see citing works
Noncoding Elements: Evolution and Epigenetic Regulation
Seridi, L. (2016) · King Abdullah University of Science and Technology Repository (King Abdullah University of Science and Technology) · doi:10.25781/kaust-v431p
Functional characterization of Dlx enhancers in the developing mouse
Esau, C. (2013)
TrkB-dependent antidepressants action involves Dlx5/6 inhibition in cortical GABAergic neurons.Preprint
Narboux‐Nême, N., Aouci, R., Fontaine, A., Vion, A., Levi, G., & Belz, L. (2024) · Research Square · doi:10.21203/rs.3.rs-4188176/v1
Identification of GTF2I Polymorphisms as Potential Biomarkers for CKD in the Han Chinese Population
Lu, K., Chiu, K., Chen, I., & Lin, G. (2024) · Kidney360 · doi:10.34067/kid.0000000000000517
ASD mutations in the ciliary gene CEP41 impact development of projection neurons and interneurons in a human cortical organoid model
Hasenpusch‐Theil, K., Lesayová, A., Kozić, Z., Beltrán, M., Wilson, G., Henderson, N. C., Dando, O., & Theil, T. (2026) · Molecular Psychiatry · doi:10.1038/s41380-026-03615-2
Fonction et régulation des gènes Dlx5/6 dans les neurones GABAergiques corticaux : Implications pour le comportement et pour le mécanisme d'action des antidépresseurs
Aouci, R. (2024) · theses.fr (ABES) · doi:10.70675/93bae735zda72z4d5fz90d7zdc1fd3628cee
Epigenetic processes in neurodevelopmental disorders
Ventura, E., & Sessa, A. (2026) · Handbook of clinical neurology · doi:10.1016/b978-0-443-19043-8.00003-7

A SNP Associated With Autism Affects Dlx5/Dlx6 Regulation in the Forebrain
Lesage‐Pelletier, C. (2011) · uO Research (University of Ottawa) · doi:10.20381/ruor-5006 · Cited by 1 · see citing works
Phenotype Characterization of Mice with Targeted Deletions of Dlx Enhancers
Zhao, P. (2017) · uO Research (University of Ottawa) · doi:10.20381/ruor-21176
Increased Sociability in Mice Lacking Intergenic Dlx Enhancers
Darbandi, S. F., Esau, C., Lesage‐Pelletier, C., Monis, S., Poitras, L., Yu, M., Perin, S., Hatch, G., & Ekker, M. (2021) · Frontiers in Neuroscience · doi:10.3389/fnins.2021.718948 · Cited by 12 · see citing works
Functional Analysis of the Cis-Regulatory Elements I56i, I56ii and I12b that Control Dlx Gene Expression in the Developing Forebrain of Mouse and Zebrafish
Yu, M. (2011) · uO Research (University of Ottawa) · doi:10.20381/ruor-4730
Functional consequences of I56ii Dlx enhancer deletion in the developing mouse forebrain
Fazel Darbandi, S., Poitras, L., Monis, S., Lindtner, S., Yu, M., Hatch, G., Rubenstein, J. L., & Ekker, M. (2016) · Developmental Biology · doi:10.1016/j.ydbio.2016.10.015 · Cited by 18 · see citing works

Authors: Poitras, L., Yu, M., Lesage-Pelletier, C., MacDonald, R. B., Gagné, J.-P., Hatch, G., Kelly, I., Hamilton, S. P., Rubenstein, J. L. R., Poirier, G. G., & Ekker, M.
Affiliations: University of Ottawa (CA)
Center for Advanced Research in Environmental Genomics (CAREG), Department of Biology, University of Ottawa, Ottawa, ON K1N 6N5, Canada
Centre hospitalier universitaire de Québec (CA)
University of California, San Francisco (US)
Corresponding author: Ekker, Marc
ORCID: Yu, Man
MacDonald, Ryan B.
Gagné, Jean-Philippe
Kelly, Isabelle
Hamilton, Steven P.
Rubenstein, John L. R.
Poirier, Guy G.
Ekker, Marc
Venue: Development
Publisher: The Company of Biologists
Published: 2010-09-15
Volume: 137
Issue: 18
Pages: 3089-3097
ISSN: 0950-1991 (ISSN-L)
1477-9129
DOI: 10.1242/dev.051052
PMC: PMC3188590
OpenAlex: W2111888024
Cited by: 69
References: 60
Citations by year: 2026: 2 · 2025: 2 · 2024: 6 · 2023: 5 · 2022: 2 · 2021: 5 · 2020: 1 · 2019: 3 · 2018: 2 · 2017: 4 · 2016: 6 · 2015: 5 · 2014: 8 · 2013: 7 · 2012: 8
FWCI: 3.24
Type: journal article
Language: en
Open access: green
www.ncbi.nlm.nih.gov
Locations: Development (publishedVersion)
Europe PMC (PubMed Central) (publishedVersion)
PubMed Central (publishedVersion)
PubMed (publishedVersion)
Funders: Genome Canada
Génome Québec
Canada Research Chairs
Canadian Institutes of Health Research (MOP14460, 74564_1)
National Institute of Mental Health (R37MH049428)
Topics: Life Sciences › Biochemistry, Genetics and Molecular Biology › Genetics › Genetics and Neurodevelopmental Disorders
Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Developmental Biology and Gene Regulation
Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Chromatin Dynamics
Keywords: single nucleotide polymorphisms, ultraconserved elements, cis-regulatory elements, GTF2I, GABAergic interneurons, forebrain development, tangential migration, Williams syndrome, autism spectrum disorder, transcriptional regulation, neurodevelopmental disorders
MeSH terms: Animals, Base Sequence, Cell Movement, Embryo, Mammalian, Enhancer Elements, Genetic, Humans, Transcription, Genetic, Sequence Alignment, Prosencephalon, Conserved Sequence, Homeodomain Proteins, Gene Expression Regulation, Developmental, Polymorphism, Single Nucleotide, Mice

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

An SNP in an ultraconserved regulatory element affects Dlx5/Dlx6 regulation in the forebrain

Abstract

Integrity signals

Claims the paper makes

Claims other papers make about this one

Cites

Cited by

Related

Record

About these checks