Activation of resorption in fatigue-loaded bone involves both apoptosis and active pro-osteoclastogenic signaling by distinct osteocyte populations
Open accessAbstract
Osteocyte apoptosis is required to initiate osteoclastic bone resorption following fatigue-induced microdamage in vivo; however, it is unclear whether apoptotic osteocytes also produce the signals that induce osteoclast differentiation. We determined the spatial and temporal patterns of osteocyte apoptosis and expression of pro-osteoclastogenic signaling molecules in vivo. Ulnae from female Sprague-Dawley rats (16-18weeks old) were cyclically loaded to a single fatigue level, and tissues were analyzed 3 and 7days later (prior to the first appearance of osteoclasts). Expression of genes associated with osteoclastogenesis (RANKL, OPG, VEGF) and apoptosis (caspase-3) were assessed by qPCR using RNA isolated from 6mm segments of ulnar mid-diaphysis, with confirmation and spatial localization of gene expression performed by immunohistochemistry. A novel double staining immunohistochemistry method permitted simultaneous localization of apoptotic osteocytes and osteocytes expressing pro-osteoclastogenic signals relative to microdamage sites. Osteocyte staining for caspase-3 and osteoclast regulatory signals exhibited different spatial distributions, with apoptotic (caspase 3-positive) cells highest in the damage region and declining to control levels within several hundred microns of the microdamage focus. Cells expressing RANKL or VEGF peaked between 100 and 300μm from the damage site, then returned to control levels beyond this distance. Conversely, osteocytes in non-fatigued control bones expressed OPG. However, OPG staining was reduced markedly in osteocytes immediately surrounding microdamage. These results demonstrate that while osteocyte apoptosis triggers the bone remodeling response to microdamage, the neighboring non-apoptotic osteocytes are the major source of pro-osteoclastogenic signals. Moreover, both the apoptotic and osteoclast-signaling osteocyte populations are localized in a spatially and temporally restricted pattern consistent with the targeted nature of this remodeling response.
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
RANKL is also produced by stromal cells, osteoblasts, and fibroblasts.
“There is evidence that osteocytes act as the main source of RANKL to promote osteoclastogenesis [167, 168], although this factor has also been demonstrated to be produced by other cell types such as stromal cells [194], osteoblasts, and fibroblasts [88, 89].”
From Biology of Bone Tissue: Structure, Function, and Factors That Influence Bone Cells (2015) · cites this paper as [194]
In bones subjected to fatigue loading, viable osteocytes near apoptotic ones express high RANKL/OPG ratio and increased VEGF and CCL2, promoting increased local osteoclastogenesis.
“For instance, in bones subjected to fatigue loading, viable osteocytes near the apoptotic ones express, besides high RANKL/OPG ratio, increased levels of vascular endothelial growth factor (VEGF) and monocyte chemoattractant protein-1 (CCL2) promoting an increase in local osteoclastogenesis [194, 195].”
From Biology of Bone Tissue: Structure, Function, and Factors That Influence Bone Cells (2015) · cites this paper as [194]
An in vivo immunohistochemical analysis showed that the RANKL signal in bone tissue was stronger in an area around 150-200 μm from the apoptotic osteocytes.
“An in vivo immunohistochemical analysis showed that the RANKL signal in bone tissue was stronger in an area around 150–200 μm from the apopototc osteocytes.65”
From Bone remodeling: an operational process ensuring survival and bone mechanical competence (2022) · cites this paper as [65]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Cites
Osteoclast differentiation and activation
Boyle, W. J., Simonet, W. S., & Lacey, D. L. (2003) · Nature · doi:10.1038/nature01658 · Cited by 6,670 · see citing works
Fadok, V. A., Voelker, D. R., Campbell, P. A., Cohen, J., Bratton, D. L., & Henson, P. M. (1992) · The Journal of Immunology · doi:10.4049/jimmunol.148.7.2207 · Cited by 3,321 · see citing works
Fadok, V. A., Bratton, D. L., Konowal, A., Freed, P. W., Westcott, J. Y., & Henson, P. M. (1998) · Journal of Clinical Investigation · doi:10.1172/jci1112 · Cited by 3,166 · see citing works
Evidence for osteocyte regulation of bone homeostasis through RANKL expression
Nakashima, T., Hayashi, M., Fukunaga, T., Kurata, K., Oh-hora, M., Feng, J. Q., Bonewald, L. F., Kodama, T., Wutz, A., Wagner, E. F., et al. (2011) · Nature Medicine · doi:10.1038/nm.2452 · Cited by 1,778 · cited 1× · see citing works
“The ability of cells within the osteoblast lineage to stimulate osteoclast formation and/or activity was proposed by Rodan and Martin in 1981 [38], but only recently has it become clear that this capacity was maintained and probably enhanced as osteoblasts mature into osteocytes [14,39].”
BackgroundMatrix-embedded cells control osteoclast formation
Xiong, J., Onal, M., Jilka, R. L., Weinstein, R. S., Manolagas, S. C., & O'Brien, C. A. (2011) · Nature Medicine · doi:10.1038/nm.2448 · Cited by 1,304 · cited 4× · see citing works
“Expression of RANKL has been demonstrated in osteocytes [13], and recent studies indicate that selective genetic ablation of RANKL in osteocytes of mice resulted in dramatically impaired resorption during development and a blunted remodeling response to mechanical unloading [14].”
BackgroundResultInfluentialUdagawa, N., Takahashi, N., Akatsu, T., Tanaka, H., Sasaki, T., Nishihara, T., Koga, T., Martin, T. J., & Suda, T. (1990) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.87.18.7260 · Cited by 1,048 · cited 1× · see citing works
“Since M-CSF is produced by marrow stromal cells [45,46], the lack of detectable change in M-CSF expression may be due to the lack of a significant marrow compartment in the rat ulnar diaphysis.”
BackgroundRole of osteoblasts in hormonal control of bone resorption—A hypothesis
Rodan, G. A., & Martin, T. J. (1981) · Calcified Tissue International · doi:10.1007/bf02409454 · Cited by 982 · cited 1× · see citing works
“The ability of cells within the osteoblast lineage to stimulate osteoclast formation and/or activity was proposed by Rodan and Martin in 1981 [38], but only recently has it become clear that this capacity was maintained and probably enhanced as osteoblasts mature into osteocytes [14,39].”
BackgroundHypoxia in cartilage: HIF-1α is essential for chondrocyte growth arrest and survivalPreprint
Schipani, E., Ryan, H. E., Didrickson, S., Kobayashi, T., Knight, M. C., & Johnson, R. S. (2001) · Genes & Development · doi:10.1101/gad.934301 · Cited by 812 · see citing works
Bone remodeling in response to in vivo fatigue microdamage
Burr, D. B., Martin, R. B., Schaffler, M. B., & Radin, E. L. (1985) · Journal of Biomechanics · doi:10.1016/0021-9290(85)90204-0 · Cited by 765 · see citing works
Self-citationVerborgt, O., Gibson, G. J., & Schaffler, M. B. (2000) · Journal of Bone and Mineral Research · doi:10.1359/jbmr.2000.15.1.60 · Cited by 731 · cited 3× · see citing works
“Sections (4 μm thick) were cut from the ulnar mid-diaphyseal region where microdamage, osteocyte apoptosis and bone remodeling occur in this model [4,19,20].”
BackgroundMethodSelf-citationIn vivo measurement of human tibial strains during vigorous activity
Burr, D. B., Milgrom, C., Fyhrie, D. P., Forwood, M. R., Nyska, M., Finestone, A. S., Hoshaw, S. J., Saiag, E., & Simkin, A. (1996) · Bone · doi:10.1016/8756-3282(96)00028-2 · Cited by 714 · see citing works
Stiffness of compact bone: Effects of porosity and density
Schaffler, M. B., & Burr, D. B. (1988) · Journal of Biomechanics · doi:10.1016/0021-9290(88)90186-8 · Cited by 652 · see citing works
Self-citationNakashima, T., Kobayashi, Y., Yamasaki, S., Kawakami, A., Eguchi, K., Sasaki, H., & Sakai, H. (2000) · Biochemical and Biophysical Research Communications · doi:10.1006/bbrc.2000.3379 · Cited by 508 · cited 2× · see citing works
“RANKL is typically formed as a membrane bound molecule (40–45 kDa) which under the appropriate conditions can be cleaved by metalloproteinases into a smaller soluble form(30 kDa) [41].”
BackgroundHenson, P. M., Bratton, D. L., & Fadok, V. A. (2001) · Current Biology · doi:10.1016/s0960-9822(01)00474-2 · Cited by 485 · see citing works
Intracortical remodeling in adult rat long bones after fatigue loading
Bentolila, V., Boyce, T. M., Fyhrie, D. P., Drumb, R., Skerry, T. M., & Schaffler, M. B. (1998) · Bone · doi:10.1016/s8756-3282(98)00104-5 · Cited by 439 · cited 6× · see citing works
“This load level produces initial peak strains of 3800±500 μstrain [19].”
BackgroundMethodInfluentialSelf-citation(1960) · Henry Ford Hospital medical bulletin · Cited by 397 · see citing works
Fadok, V. A., Bratton, D. L., Guthrie, L. A., & Henson, P. M. (2001) · The Journal of Immunology · doi:10.4049/jimmunol.166.11.6847 · Cited by 368 · see citing works
Osteocyte Apoptosis Controls Activation of Intracortical Resorption in Response to Bone Fatigue
Cardoso, L., Herman, B. C., Verborgt, O., Laudier, D., Majeska, R. J., & Schaffler, M. B. (2009) · Journal of Bone and Mineral Research · doi:10.1359/jbmr.081210 · Cited by 340 · cited 6× · see citing works
“Ulnar fatigue loading in vivo was used to introduce controlled amounts of bone microdamage, which has been shown to cause osteocyte apoptosis and activate bone remodeling [4].”
BackgroundMethodInfluentialSelf-citationThe phosphatidylserine receptor: a crucial molecular switch?
Henson, P. M., Bratton, D. L., & Fadok, V. A. (2001) · Nature Reviews Molecular Cell Biology · doi:10.1038/35085094 · Cited by 321 · see citing works
Acute Vasoconstriction after Subarachnoid Hemorrhage
Bederson, J. B., Lévy, A., Ding, W. H., Kahn, R. A., DiPerna, C. A., Jenkins, A. L., & Vallabhajosyula, P. (1998) · Neurosurgery · doi:10.1097/00006123-199802000-00091 · Cited by 291 · see citing works
Fatigue fractures in thoroughbred racehorses: Relationships with age, peak bone strain, and training
Nunamaker, D. M., Butterweck, D. M., & Provost, M. T. (1990) · Journal of Orthopaedic Research® · doi:10.1002/jor.1100080417 · Cited by 278 · see citing works
Baron, R., Tross, R. B., & Vignery, A. (1984) · The Anatomical Record · doi:10.1002/ar.1092080114 · Cited by 277 · cited 1× · see citing works
“First, baseline intracortical remodeling is zero in this model [19,40].”
BackgroundTHE BIOLOGY OF THE GROWTH PLATE
Ballock, R. T., & O’Keefe, R. J. (2003) · Journal of Bone and Joint Surgery · doi:10.2106/00004623-200304000-00021 · Cited by 271 · see citing works
Dias, S., Shmelkov, S. V., Lam, G. F. M., & Rafii, S. (2002) · Blood · doi:10.1182/blood.v99.7.2532 · Cited by 259 · cited 1× · see citing works
“as an anti-apoptotic response to microdamage [18,47,48].”
Carter, D. R. P., & Hayes, W. C. (1977) · Clinical Orthopaedics and Related Research · doi:10.1097/00003086-197709000-00039 · Cited by 258 · see citing works
Natural killer cells trigger osteoclastogenesis and bone destruction in arthritis
Söderström, K., Stein, E. A., Colmenero, P., Purath, U., Müller‐Ladner, U., de Matos, C. T., Tarner, I. H., Robinson, W. H., & Engleman, E. G. (2009) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1000546107 · Cited by 199 · see citing works
Verborgt, O., Tatton, N. A., Majeska, R. J., & Schaffler, M. B. (2002) · Journal of Bone and Mineral Research · doi:10.1359/jbmr.2002.17.5.907 · Cited by 192 · cited 5× · see citing works
“Bone remodeling in response to fatigue-induced microdamage is a spatially constrained process where focal tissue injury leads to localized osteocyte apoptosis followed by targeted resorption of the damaged region and its dying cells [18,19,37].”
BackgroundInfluentialSelf-citationApoptosis during wound healing, fibrocontractive diseases and vascular wall injury
Desmoulière, A., Badid, C., Bochaton‐Piallat, M., & Gabbiani, G. (1997) · The International Journal of Biochemistry & Cell Biology · doi:10.1016/s1357-2725(96)00117-3 · Cited by 181 · see citing works
M‐CSF, c‐Fms, and Signaling in Osteoclasts and their Precursors
Ross, F. P. (2006) · Annals of the New York Academy of Sciences · doi:10.1196/annals.1346.014 · Cited by 172 · cited 1× · see citing works
“Since M-CSF is produced by marrow stromal cells [45,46], the lack of detectable change in M-CSF expression may be due to the lack of a significant marrow compartment in the rat ulnar diaphysis.”
BackgroundIn vivo diffuse damage in human vertebral trabecular bone
Vashishth, D., Koontz, J., Qiu, S. J., Lundin-Cannon, D., Yeni, Y. N., Schaffler, M. B., & Fyhrie, D. P. (2000) · Bone · doi:10.1016/s8756-3282(99)00253-7 · Cited by 162 · see citing works
Self-citationThe effect of muscle fatigue on in vivo tibial strains
Milgrom, C., Radeva-Petrova, D. R., Finestone, A. S., Nyska, M., Mendelson, S. A., Benjuya, N., Simkin, A., & Burr, D. B. (2006) · Journal of Biomechanics · doi:10.1016/j.jbiomech.2006.03.006 · Cited by 157 · see citing works
The Ischemic Penumbra: Identification, Evolution and Treatment Concepts
Fisher, M. (2003) · Cerebrovascular Diseases · doi:10.1159/000074790 · Cited by 153 · see citing works
Rising crack-growth-resistance behavior in cortical bone:
Vashishth, D. (2004) · Journal of Biomechanics · doi:10.1016/j.jbiomech.2003.11.003 · Cited by 145 · see citing works
YANG, Q., McHugh, K. P., Patntirapong, S., GU, X., Wunderlich, L., & Hauschka, P. V. (2008) · Matrix Biology · doi:10.1016/j.matbio.2008.06.005 · Cited by 144 · see citing works
Delineating bone's interstitial fluid pathway in vivo
Wang, L., Ciani, C., Doty, S. B., & Fritton, S. P. (2003) · Bone · doi:10.1016/j.bone.2003.11.022 · Cited by 133 · cited 2× · see citing works
“The molecular size order for soluble RANKL would allow it to move readily easily through the osteocyte lacunar-canalicular system [12,41].”
BackgroundThe Effects of Dynamic Axial Loading on the Rat Growth Plate
Ohashi, N., Robling, A. G., Burr, D. B., & Turner, C. H. (2002) · Journal of Bone and Mineral Research · doi:10.1359/jbmr.2002.17.2.284 · Cited by 123 · see citing works
Apoptotic osteocytes regulate osteoclast precursor recruitment and differentiation in vitro
Al‐Dujaili, S. A., Lau, E., Al‐Dujaili, H., Tsang, K., Guenther, A., & You, L. (2011) · Journal of Cellular Biochemistry · doi:10.1002/jcb.23164 · Cited by 118 · cited 1× · see citing works
“as an anti-apoptotic response to microdamage [18,47,48].”
Fas/CD95 is associated with glucocorticoid-induced osteocyte apoptosis
Kogianni, G., Mann, V., Ebetino, F. H., NUTTALL, M. E., Nijweide, P. J., Simpson, H., & Noble, B. (2004) · Life Sciences · doi:10.1016/j.lfs.2004.04.048 · Cited by 110 · cited 1× · see citing works
“This form of signaling, however, requires cell-to-cell or cell-to-debris contact and thus can act only when phagocytic and apoptotic cells are in direct proximity [11].”
BackgroundBone age, mineral density, and fatigue damage
PARFITT, A. M. (1993) · Calcified Tissue International · doi:10.1007/bf01673408 · Cited by 106 · see citing works
Silvestrini, G., Ballanti, P., Patacchioli, F. R., Leopizzi, M., Gualtieri, N., Monnazzi, P., Tremante, E., Sardella, D., & BONUCCI, E. (2005) · The Histochemical Journal · doi:10.1007/s10735-004-3839-1 · Cited by 105 · see citing works
Milgrom, C., Finestone, A. S., Novack, V., Pereg, D., Goldich, Y., Kreiss, Y., Zimlichman, E., Kaufman, S., Liebergall, M., & Burr, D. B. (2004) · Bone · doi:10.1016/j.bone.2004.04.016 · Cited by 98 · see citing works
Apoptosis: giving phosphatidylserine recognition an assist – with a twist
Fadok, V. A., & Henson, P. M. (2003) · Current Biology · doi:10.1016/s0960-9822(03)00575-x · Cited by 95 · see citing works
Role of bone turnover in microdamage
Schaffler, M. B. (2003) · Osteoporosis International · doi:10.1007/s00198-003-1477-1 · Cited by 87 · see citing works
Self-citationMetatarsal Strains Are Sufficient to Cause Fatigue Fracture During Cyclic Overloading
Milgrom, C., Finestone, A. S., Sharkey, N. A., Hamel, A. J., Mandes, V., Burr, D. B., Arndt, A., & Ekenman, I. (2002) · Foot & Ankle International · doi:10.1177/107110070202300307 · Cited by 74 · see citing works
The Role of Biomechanical Shoe Orthoses in Tibial Stress Fracture Prevention
Ekenman, I., Milgrom, C., Finestone, A. S., Begin, M., Olin, C., Arndt, T., & Burr, D. B. (2002) · The American Journal of Sports Medicine · doi:10.1177/03635465020300061801 · Cited by 59 · see citing works
Feng, X., Takeshita, S., Namba, N., Wei, S., Teitelbaum, S., & Ross, F. (2002) · Endocrinology · doi:10.1210/en.2002-220467 · Cited by 43 · see citing works
Endostatin inhibits VEGF-A induced osteoclastic bone resorption in vitro
Sipola, A., Nelo, K., Hautala, T., Ilvesaro, J. M., & Tuukkanen, J. (2006) · BMC Musculoskeletal Disorders · doi:10.1186/1471-2474-7-56 · Cited by 40 · cited 1× · see citing works
“Previous studies have also shown VEGF to be involved in the regulation of osteoclastogenesis, both directly and upstream of RANKL [49,50].”
Silva, M. J., & Touhey, D. C. (2006) · Journal of Orthopaedic Research® · doi:10.1002/jor.20320 · Cited by 35 · cited 1× · see citing works
“, woven bone formation); furthermore, the rat ulna cortex has no baseline intracortical remodeling activity so all remodeling-related changes seen after loading are attributable to the experimental intervention [4,19,20,32].”
BackgroundTechniques for implementing an in vivo bone strain gage system
Caler, W. E., Carter, D. R., & Harris, W. H. (1981) · Journal of Biomechanics · doi:10.1016/0021-9290(81)90164-0 · Cited by 27 · see citing works
Mueller, R., & Richards, R. G. (2004) · Journal of Materials Science Materials in Medicine · doi:10.1023/b:jmsm.0000021103.39114.cd · Cited by 13 · cited 1× · see citing works
“Expression of RANKL has been demonstrated in osteocytes [13], and recent studies indicate that selective genetic ablation of RANKL in osteocytes of mice resulted in dramatically impaired resorption during development and a blunted remodeling response to mechanical unloading [14].”
Result
Flagged first, then by citations
Cited by
Sorted by citations
Biology of Bone Tissue: Structure, Function, and Factors That Influence Bone Cells
Florencio-Silva, R., Sasso, G. R. D. S., Sasso-Cerri, E., Simões, M. J., & Cerri, P. S. (2015) · BioMed Research International · doi:10.1155/2015/421746 · Cited by 2,044 · see citing works
The Osteocyte: An Endocrine Cell … and More
Dallas, S. L., Prideaux, M., & Bonewald, L. F. (2013) · Endocrine Reviews · doi:10.1210/er.2012-1026 · Cited by 1,042 · see citing works
Goldring, S. R., & Goldring, M. B. (2016) · Nature Reviews Rheumatology · doi:10.1038/nrrheum.2016.148 · Cited by 896 · see citing works
Bone remodelling in osteoarthritis
Burr, D. B., & Gallant, M. A. (2012) · Nature Reviews Rheumatology · doi:10.1038/nrrheum.2012.130 · Cited by 927 · see citing works
Estrogens and androgens in skeletal physiology and pathophysiology
Almeida, M., Laurent, M. R., Dubois, V., Claessens, F., O'Brien, C. A., Bouillon, R., Vanderschueren, D., & Manolagas, S. C. (2017) · Physiological Reviews · doi:10.1152/physrev.00033.2015 · Cited by 860 · see citing works
Osteocytes: master orchestrators of bone
Schaffler, M. B., Cheung, W.-Y., Majeska, R., & Kennedy, O. (2014) · Calcified Tissue International · doi:10.1007/s00223-013-9790-y · Cited by 514 · see citing works
“A recent study by Malone et al. [64] demonstrated the presence of primary cilia on MC3T3-E1 osteoblasts and MLO-Y4 osteocytes in vitro, which led the authors to posit that primary cilia in osteocytes and osteoblasts may be required to mediate both osteogenic and pro-osteoclastogenic responses (COX2 upregulation and lo…”
BackgroundInfluentialSelf-citationMicroenvironment in subchondral bone: predominant regulator for the treatment of osteoarthritis
Hu, W., Chen, Y., Dou, C., & Dong, S. (2020) · Annals of the Rheumatic Diseases · doi:10.1136/annrheumdis-2020-218089 · Cited by 516 · see citing works
Bone remodeling: an operational process ensuring survival and bone mechanical competence
Bolamperti, S., Villa, I., & Rubinacci, A. (2022) · Bone Research · doi:10.1038/s41413-022-00219-8 · Cited by 482 · see citing works
“An in vivo immunohistochemical analysis showed that the RANKL signal in bone tissue was stronger in an area around 150–200 μm from the apopototc osteocytes.(65) Interestingly, inhibiting apoptosis prevented the RANKL production by neighboring osteocytes, suggesting that “bone remodeling follows a common paradigm for l…”
BackgroundOsteocyte-Driven Bone Remodeling
Bellido, T. (2014) · Calcified Tissue International · doi:10.1007/s00223-013-9774-y · Cited by 384 · see citing works
“expression of VEGF and RANKL is elevated [68], suggesting that signals emanating from apoptotic cells alter the expression of molecules that influence angiogenesis and potentially osteoclast precursor recruitment, as well as osteoclast differentiation.”
The role of the wnt/β-catenin signaling pathway in formation and maintenance of bone and teeth
Duan, P., & Bonewald, L. F. (2016) · The International Journal of Biochemistry & Cell Biology · doi:10.1016/j.biocel.2016.05.015 · Cited by 374 · see citing works
The Relevance of Mouse Models for Investigating Age-Related Bone Loss in Humans
Jilka, R. L. (2013) · The Journals of Gerontology Series A · doi:10.1093/gerona/glt046 · Cited by 329 · see citing works
“Moreover, osteocytes stimulated to undergo apoptosis in response to fatigue damage release factors that stimulate neighboring viable osteocytes to synthesize receptor activator of NfκB ligand, as well as vascular endothelial growth factor that helps orchestrate the formation of vessels that act as a conduit for the de…”
BackgroundBasis of bone metabolism around dental implants during osseointegration and peri‐implant bone loss
Ínsua, Á., Monje, A., Wang, H., & Miron, R. J. (2017) · Journal of Biomedical Materials Research Part A · doi:10.1002/jbm.a.36060 · Cited by 278 · see citing works
“Higher levels of RANKL has previously been reported 100–200 lm away from microcracks and lower levels of OPG were observed up to 200 lm away from microcracks.(53) Verborgt et al.”
BackgroundThe osteocyte as a signaling cell
Delgado‐Calle, J., & Bellido, T. (2021) · Physiological Reviews · doi:10.1152/physrev.00043.2020 · Cited by 269 · see citing works
Osteocyte control of osteoclastogenesis
O’Brien, C. A., Nakashima, T., & Takayanagi, H. (2012) · Bone · doi:10.1016/j.bone.2012.08.121 · Cited by 237 · see citing works
“They demonstrated that osteocyte apoptosis localizes to areas containing fatigue damage whereas expression of factors that support focal bone resorption, such as RANKL and VEGF, is elevated in osteocytes surrounding the apoptotic osteocytes [83].”
BackgroundSchaffler, M. B., & Kennedy, O. D. (2012) · Current Osteoporosis Reports · doi:10.1007/s11914-012-0105-4 · Cited by 227 · see citing works
Self-citationβ-aminoisobutyric Acid, l-BAIBA, Is a Muscle-Derived Osteocyte Survival Factor
Kitase, Y., Vallejo, J. A., Gutheil, W., Vemula, H., Jähn, K., Yi, J., Zhou, J., Brotto, M., & Bonewald, L. F. (2018) · Cell Reports · doi:10.1016/j.celrep.2018.01.041 · Cited by 219 · see citing works
“Programmed osteocyte cell death is necessary to repair damaged bone (Kennedy et al., 2012; Verborgt et al., 2000, 2002).”
BackgroundRANKL/OPG; Critical role in bone physiology
Martin, T. J., & Sims, N. A. (2015) · Reviews in Endocrine and Metabolic Disorders · doi:10.1007/s11154-014-9308-6 · Cited by 213 · see citing works
“Illustrating this is a study in which microdamage of bone resulted in apoptosis of osteocytes, and increased RANKL production in a closely adjacent group of osteocytes [85].”
BackgroundOsteoporosis – a current view of pharmacological prevention and treatment
Crockett, J. C., & Das (2013) · Drug Design Development and Therapy · doi:10.2147/dddt.s31504 · Cited by 206 · see citing works
Jilka, R. L., Noble, B., & Weinstein, R. S. (2012) · Bone · doi:10.1016/j.bone.2012.11.038 · Cited by 202 · see citing works
“As in the case of RANKL, apoptotic osteocytes induced by fatigue damage did not express VEGF, but neighboring viable caspase-negative osteocytes did [48].”
BackgroundZuckerman, P. C., Frikha-Benayed, D., Majeska, R. J., Tuthill, A., Yakar, S., Judex, S., & Schaffler, M. B. (2016) · Journal of Bone and Mineral Research · doi:10.1002/jbmr.2807 · Cited by 189 · see citing works
“RNA was isolated and expression of RANKL and GAPDH were assessed by RT-PCR, using procedures and primer sequences specific to mice, as previously described.((21,22)) The respective forward and reverse primers used were ACGCAGATTTCAGGACTCG and GGGCCACATCCAACCATGAG for RANKL, and CGTGCCGCCTGGAGAAACC and TGGAAGAGTGGGAGTT…”
Self-citationOsteocytes in bone aging: Advances, challenges, and future perspectives
Cui, J., Shibata, Y., Zhu, T., Zhou, J. M., & Zhang, J. (2022) · Ageing Research Reviews · doi:10.1016/j.arr.2022.101608 · Cited by 181 · see citing works
Hoenig, T., Ackerman, K. E., Beck, B. R., Bouxsein, M., Burr, D. B., Hollander, K., Popp, K. L., Rolvien, T., Tenforde, A. S., & Warden, S. J. (2022) · Nature Reviews Disease Primers · doi:10.1038/s41572-022-00352-y · Cited by 171 · see citing works
Glucocorticoids and bone: Local effects and systemic implications
Henneicke, H., Gasparini, S. J., Brennan-Speranza, T. C., Zhou, H., & Seibel, M. J. (2014) · Trends in Endocrinology & Metabolism · doi:10.1016/j.tem.2013.12.006 · Cited by 168 · see citing works
Targeting strategies for bone diseases: signaling pathways and clinical studies
Xu, H., Wang, W., Liu, X., Huang, W. H., Chen, Z., Xu, Y., Yang, H., Bai, J., & Geng, D. (2023) · Signal Transduction and Targeted Therapy · doi:10.1038/s41392-023-01467-8 · Cited by 173 · see citing works
“An in vivo immunohistochemical analysis revealed a higher RANKL signaling in a 150–200 μm area around osteocytes undergoing apoptosis, whereas apoptosis inhibition resulted in a lower RANKL signaling.(70) In contrast, apoptotic bodies of osteoblasts exhibit no impact on osteoclastogenesis either in vivo or in vitro.”
BackgroundSclerostin's role in bone's adaptive response to mechanical loading
Galea, G. L., Lanyon, L. E., & Price, J. S. (2016) · Bone · doi:10.1016/j.bone.2016.10.008 · Cited by 153 · see citing works
“75 apoptosing osteocytes around microcracks secrete Rankl [11].”
BackgroundKennedy, O. D., Laudier, D. M., Majeska, R. J., Sun, H. B., & Schaffler, M. B. (2014) · Bone · doi:10.1016/j.bone.2014.03.049 · Cited by 151 · see citing works
“However, dying cells do not themselves produce essential osteoclastogenic cytokines, including RANKL [10].”
BackgroundMethodInfluentialSelf-citationOsteocyte apoptosis: the roles and key molecular mechanisms in resorption-related bone diseases
Ru, J., & Wang, Y.-F. (2020) · Cell Death and Disease · doi:10.1038/s41419-020-03059-8 · Cited by 149 · see citing works
Bone microdamage, remodeling and bone fragility: how much damage is too much damage?
Şeref-Ferlengez, Z., Kennedy, O. D., & Schaffler, M. B. (2015) · BoneKEy Reports · doi:10.1038/bonekey.2015.11 · Cited by 144 · see citing works
Self-citationThe Role of Osteocytes in Age-Related Bone Loss
Jilka, R. L., & O’Brien, C. A. (2016) · Current Osteoporosis Reports · doi:10.1007/s11914-016-0297-0 · Cited by 136 · see citing works
The Role of the Osteocyte in Bone and Nonbone Disease
Bonewald, L. F. (2016) · Endocrinology and Metabolism Clinics of North America · doi:10.1016/j.ecl.2016.09.003 · Cited by 130 · see citing works
Exosomes—the enigmatic regulators of bone homeostasis
Gao, M., Gao, W., Papadimitriou, J. M., Zhang, C., Gao, J., & Zheng, M. (2018) · Bone Research · doi:10.1038/s41413-018-0039-2 · Cited by 128 · see citing works
The osteocyte plays multiple roles in bone remodeling and mineral homeostasis
Chen, H., Senda, T., & Kubo, K. (2015) · Medical Molecular Morphology · doi:10.1007/s00795-015-0099-y · Cited by 131 · see citing works
Changes in the osteocyte lacunocanalicular network with aging
Tiede-Lewis, L. M., & Dallas, S. L. (2019) · Bone · doi:10.1016/j.bone.2019.01.025 · Cited by 122 · see citing works
“Osteocyte apoptosis can be induced by many different stimuli, including microdamage [96, 97], disuse [98], excess glucocorticoids [99–101], estrogen deficiency [102–105] and oxidative stress [81, 104], any of which could potentially contribute to the age-related decline in osteocyte number.”
BackgroundNovince, C. M., Whittow, C. R., Aartun, J. D., Hathaway, J. D., Poulides, N., Chavez, M. B., Steinkamp, H. M., Kirkwood, K. A., Huang, E., Westwater, C., et al. (2017) · Scientific Reports · doi:10.1038/s41598-017-06126-x · Cited by 121 · see citing works
Meakin, L. B., Price, J. S., & Lanyon, L. E. (2014) · Frontiers in Endocrinology · doi:10.3389/fendo.2014.00154 · Cited by 117 · see citing works
“For some this is a deliberate design to induce fatigue loading of bone and examine subsequent damage repair (106).”
BackgroundEndoplasmic reticulum mediates mitochondrial transfer within the osteocyte dendritic network
Gao, J., Qin, A., Liu, D., Ruan, R., Wang, Q., Yuan, J., Cheng, T. S., Filipovska, A., Papadimitriou, J. M., Dai, K., et al. (2019) · Science Advances · doi:10.1126/sciadv.aaw7215 · Cited by 117 · see citing works
The Impact of Simulated and Real Microgravity on Bone Cells and Mesenchymal Stem Cells
Ulbrich, C., Wehland, M., Pietsch, J., Aleshcheva, G., Wise, P. M., van Loon, J. J. W. A., Magnusson, N. E., Infanger, M., Grosse, J., Eilles, C., et al. (2014) · BioMed Research International · doi:10.1155/2014/928507 · Cited by 113 · see citing works
“Apoptotic osteocytes are essential for the initiation of bone remodeling, but it is the neighboring nonapoptotic osteocytes that produce proosteoclastogenic signaling [119].”
Osteocyte calcium signals encode strain magnitude and loading frequency in vivo
Lewis, K. J., Frikha-Benayed, D., Louie, J., Stephen, S. J., Spray, D. C., Thi, M. M., Şeref-Ferlengez, Z., Majeska, R. J., Weinbaum, S., & Schaffler, M. B. (2017) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1707863114 · Cited by 112 · see citing works
Self-citationNitric oxide signaling in mechanical adaptation of bone
Klein‐Nulend, J., van Oers, R. F. M., Bakker, A. D., & Bacabac, R. G. (2013) · Osteoporosis International · doi:10.1007/s00198-013-2590-4 · Cited by 95 · see citing works
“Fatigue damage produces osteocyte apoptosis and RANKL production, which attracts osteoclasts, thereby activating bone remodeling [74–77].”
BackgroundApoptotic Osteocytes and the Control of Targeted Bone Resorption
Plotkin, L. I. (2014) · Current Osteoporosis Reports · doi:10.1007/s11914-014-0194-3 · Cited by 93 · see citing works
Kitaura, H., Marahleh, A., Ohori, F., Noguchi, T., Nara, Y., Pramusita, A., Kinjo, R., Ma, J., Kanou, K., & Mizoguchi, I. (2022) · International Journal of Molecular Sciences · doi:10.3390/ijms23031481 · Cited by 101 · see citing works
The osteocyte: key player in regulating bone turnover
Goldring, S. R. (2015) · RMD Open · doi:10.1136/rmdopen-2015-000049 · Cited by 94 · see citing works
Plotkin, L. I., Gortázar, A. R., Davis, H. M., Condon, K. W., Gabilondo, H., Maycas, M., Allen, M. R., & Bellido, T. (2015) · Journal of Biological Chemistry · doi:10.1074/jbc.m115.642090 · Cited by 92 · see citing works
Evolutionary Physiology of Bone: Bone Metabolism in Changing Environments
Doherty, A. H., Ghalambor, C. K., & Donahue, S. W. (2015) · Physiology · doi:10.1152/physiol.00022.2014 · Cited by 92 · see citing works
Cheung, W. Y., Fritton, J. C., Morgan, S. A., Seref-Ferlengez, Z., Basta-Pljakic, J., Thi, M. M., Suadicani, S. O., Spray, D. C., Majeska, R. J., & Schaffler, M. B. (2016) · Journal of Bone and Mineral Research · doi:10.1002/jbmr.2740 · Cited by 89 · see citing works
Self-citationJiang, L., Zhang, W., Li, W., Zhou, Q., Yang, G., Qian, N., Yun Tian, T. A. N. G., Gao, Y., & Jiang, X. (2018) · Biomaterials · doi:10.1016/j.biomaterials.2018.06.035 · Cited by 90 · see citing works
Bone marrow lesions in osteoarthritis: What lies beneath
Alliston, T. N., Hernandez, C. J., Findlay, D. M., Felson, D. T., & Kennedy, O. D. (2017) · Journal of Orthopaedic Research® · doi:10.1002/jor.23844 · Cited by 87 · see citing works
Self-citationFatigue as the missing link between bone fragility and fracture
Acevedo, C., Stadelmann, V. A., Pioletti, D. P., Alliston, T. N., & Ritchie, R. O. (2018) · Nature Biomedical Engineering · doi:10.1038/s41551-017-0183-9 · Cited by 85 · see citing works
Middleton, K., Al‐Dujaili, S. A., Mei, X., Günther, A., & You, L. (2017) · Journal of Biomechanics · doi:10.1016/j.jbiomech.2017.05.012 · Cited by 85 · see citing works
Jilka, R. L., O’Brien, C. A., Roberson, P. K., Bonewald, L. F., Weinstein, R. S., & Manolagas, S. C. (2013) · Journal of Bone and Mineral Research · doi:10.1002/jbmr.2007 · Cited by 85 · see citing works
Structural and Mechanical Repair of Diffuse Damage in Cortical Bone In Vivo
Şeref-Ferlengez, Z., Basta‐Pljakic, J., Kennedy, O. D., Philemon, C. J., & Schaffler, M. B. (2014) · Journal of Bone and Mineral Research · doi:10.1002/jbmr.2309 · Cited by 80 · see citing works
“Under isoflurane anesthesia, ulnae of adult female Sprague‐ Dawley rats (4–5 months old, Charles River Laboratories, Wilmington, MA, USA) were loaded in vivo using end‐load bending in creep‐loading mode, in a modification of the fatigue loading protocol we have reported elsewhere.((11,14,17)) The forelimb was held bet…”
BackgroundMethodInfluentialSelf-citationThe role of integrin αVβ3 in osteocyte mechanotransduction
Haugh, M. G., Vaughan, T. J., & McNamara, L. M. (2014) · Journal of the mechanical behavior of biomedical materials/Journal of mechanical behavior of biomedical materials · doi:10.1016/j.jmbbm.2014.11.001 · Cited by 78 · see citing works
He, Z., Li, H., Han, X., Zhou, F., Du, J., Yang, Y., Xu, Q., Zhang, S., Zhang, S., Zhao, N., et al. (2020) · Bone · doi:10.1016/j.bone.2020.115573 · Cited by 76 · see citing works
Graves, D., Alshabab, A., Albiero, M. L., Mattos, M., Corrêa, J., Chen, S., & Yang, Y. (2018) · Journal of Clinical Periodontology · doi:10.1111/jcpe.12851 · Cited by 77 · see citing works
“…of RANKL in periodontal bone loss, should be considered as an important source of RANKL in periodontitis as it is in other bone pathologies such as osteoporosis, rheumatoid arthritis and fatigue- induced microdamage (Kennedy et al., 2012; O’Brien, Nakashima, & Takayanagi, 2012; Xiong et al., 2011).”
BackgroundStem cells in Osteoporosis: From Biology to New Therapeutic Approaches
Paspaliaris, V., & Kolios, G. C. (2019) · Stem Cells International · doi:10.1155/2019/1730978 · Cited by 75 · see citing works
Regulatory Mechanisms of RANKL Presentation to Osteoclast Precursors
Honma, M., Ikebuchi, Y., Kariya, Y., & Suzuki, H. (2014) · Current Osteoporosis Reports · doi:10.1007/s11914-014-0189-0 · Cited by 72 · see citing works
The role of sphingosine-1-phosphate in bone remodeling and osteoporosis
Grewe, J. M., Knapstein, P., Donat, A., Jiang, S., Smit, D. J., Xie, W., & Keller, J. (2022) · Bone Research · doi:10.1038/s41413-022-00205-0 · Cited by 68 · see citing works
“To prevent recirculation, stress-induced apoptotic osteocytes express RANKL and CXCL12, leading to decreased expression of S1PR1, chemoattraction toward the bone tissue, and increased osteoclastogenesis.(29,33,34)”
BackgroundOrmsby, R. T., Solomon, L. B., Yang, D., Crotti, T. N., Haynes, D. R., Findlay, D. M., & Atkins, G. J. (2019) · Acta Biomaterialia · doi:10.1016/j.actbio.2019.01.047 · Cited by 66 · see citing works
Effects of occlusal forces on the peri‐implant‐bone interface stability
Ruiz, R. A. D., Calvo‐Guirado, J. L., & Romanos, G. E. (2019) · Periodontology 2000 · doi:10.1111/prd.12291 · Cited by 65 · see citing works
Glucocorticoid-induced autophagy and apoptosis in bone
Wang, T., Liu, X., & He, C. (2020) · APOPTOSIS · doi:10.1007/s10495-020-01599-0 · Cited by 67 · see citing works
Role of osteocytes in multiple myeloma bone disease
Delgado‐Calle, J., Bellido, T., & Roodman, G. D. (2014) · Current Opinion in Supportive and Palliative Care · doi:10.1097/spc.0000000000000090 · Cited by 63 · see citing works
Physiological Effects of Microgravity on Bone Cells
Arfat, Y., Xiao, W.-Z., Iftikhar, S., Zhao, F., Li, D.-J., Sun, Y., Zhang, G., Shang, P., & Qian, A. (2014) · Calcified Tissue International · doi:10.1007/s00223-014-9851-x · Cited by 62 · see citing works
“The apoptotic osteocytes are essential for the initiation of bone remodeling, but it is the neighboring non-apoptotic osteocytes that produce pro-osteoclastogenic signaling [80].”
BackgroundBone and the Innate Immune System
Charles, J. F., & Nakamura, M. C. (2014) · Current Osteoporosis Reports · doi:10.1007/s11914-014-0195-2 · Cited by 58 · see citing works
Şeref-Ferlengez, Z., Maung, S., Schaffler, M. B., Spray, D. C., Suadicani, S. O., & Thi, M. M. (2016) · PLoS ONE · doi:10.1371/journal.pone.0155107 · Cited by 60 · see citing works
Self-citationWang, T., Yu, X., & He, C. (2018) · Current Drug Targets · doi:10.2174/1389450119666180405094046 · Cited by 61 · see citing works
Li, M. C. M., Chow, S. K., Wong, R. M. Y., Qin, L., & Cheung, W. (2021) · Journal of Orthopaedic Translation · doi:10.1016/j.jot.2021.04.005 · Cited by 59 · see citing works
Bonnet, N., Gineyts, É., Ammann, P., Conway, S. J., Garnero, P., & Ferrari, S. (2013) · PLoS ONE · doi:10.1371/journal.pone.0078347 · Cited by 59 · see citing works
“an increased expression of RANKL by adjacent osteocytes and the recruitment of bone resorbing cells [13,14].”
BackgroundThe Emerging Role of Osteocytes in Cancer in Bone
Atkinson, E. G., & Delgado‐Calle, J. (2019) · JBMR Plus · doi:10.1002/jbm4.10186 · Cited by 56 · see citing works
Wu, D., Schaffler, M. B., Weinbaum, S., & Spray, D. C. (2013) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1310003110 · Cited by 56 · see citing works
Self-citationPDGF-BB Delays Degeneration of the Intervertebral Discs in a Rabbit Preclinical Model
Paglia, D. N., Singh, H., Karukonda, T., Drissi, H., & Moss, I. L. (2015) · Spine · doi:10.1097/brs.0000000000001336 · Cited by 56 · see citing works
“Staining was revealed using an AEC (red) substrate kit (Thermo Fischer Scientific, Waltham, MA)(7); IHC was also performed to evaluate cell apoptosis using a polyclonal primary antibody (1:300 dilution of antibody #9661; Cell Signaling Technology, Beverly, MA) that specifically recognizes the large fragment (17/19 kDa…”
MethodManolagas, S. C. (2018) · Journal of Bone and Mineral Research · doi:10.1002/jbmr.3400 · Cited by 56 · see citing works
Yang, J., Dong, D., Luo, X., Zhou, J., Shang, P., & Zhang, H. (2020) · Calcified Tissue International · doi:10.1007/s00223-020-00735-x · Cited by 55 · see citing works
Diet and Exercise: a Match Made in Bone
Willems, H. M. E., van den Heuvel, E. G. H. M., Schoemaker, R., Klein‐Nulend, J., & Bakker, A. D. (2017) · Current Osteoporosis Reports · doi:10.1007/s11914-017-0406-8 · Cited by 53 · see citing works
Monoclonal antibodies for treating osteoporosis
Faienza, M. F., Chiarito, M., D’Amato, G., Colaianni, G., Colucci, S. C., Grano, M., & Brunetti, G. (2017) · Expert Opinion on Biological Therapy · doi:10.1080/14712598.2018.1401607 · Cited by 52 · see citing works
“recruitment from as far away as 300 mm [40].”
BackgroundPhysiological mechanisms and therapeutic potential of bone mechanosensing
Xiao, Z., & Quarles, L. D. (2015) · Reviews in Endocrine and Metabolic Disorders · doi:10.1007/s11154-015-9313-4 · Cited by 54 · see citing works
The osteocyte and its osteoclastogenic potential
Marahleh, A., Kitaura, H., Ohori, F., Noguchi, T., & Mizoguchi, I. (2023) · Frontiers in Endocrinology · doi:10.3389/fendo.2023.1121727 · Cited by 53 · see citing works
Chhana, A., Pool, B., Callon, K. E., Tay, M. L., Musson, D. S., Naot, D., McCarthy, G., McGlashan, S. R., Cornish, J., & Dalbeth, N. (2018) · Arthritis Research & Therapy · doi:10.1186/s13075-018-1704-y · Cited by 51 · see citing works
Wei, L., Chai, S., Chen, Y., Zhang, H., Li, J., & Qin, N. (2023) · Cell Death Discovery · doi:10.1038/s41420-023-01331-2 · Cited by 53 · see citing works
Adaptive and injury response of bone to mechanical loading
McBride-Gagyi, S. H., & Silva, M. J. (2012) · BoneKEy Reports · doi:10.1038/bonekey.2012.192 · Cited by 50 · see citing works
Self‐healing materials: what can nature teach us?
Dooley, C., & Taylor, D. M. (2017) · Fatigue & Fracture of Engineering Materials & Structures · doi:10.1111/ffe.12595 · Cited by 47 · see citing works
Biguetti, C. C., de Oliva, A. H., Healy, K., Mahmoud, R. H., Custódio, I. D. C., Constantino, D. H. J., Ervolino, E., Duarte, M. A. H., Fakhouri, W. D., & Matsumoto, M. A. (2019) · PLoS ONE · doi:10.1371/journal.pone.0214173 · Cited by 47 · see citing works
McCutcheon, S., Majeska, R. J., Spray, D. C., Schaffler, M. B., & Vázquez, M. (2020) · Journal of Bone and Mineral Research · doi:10.1002/jbmr.3954 · Cited by 46 · see citing works
Self-citationOsteocyte Dysfunction in Joint Homeostasis and Osteoarthritis
Zhang, L., & Wen, C. (2021) · International Journal of Molecular Sciences · doi:10.3390/ijms22126522 · Cited by 47 · see citing works
Gasser, J. A., & Kneissel, M. (2017) · Molecular and integrative toxicology · doi:10.1007/978-3-319-56192-9_2 · Cited by 45 · see citing works
Ramme, A. J., Lendhey, M., Raya, J. G., Kirsch, T., & Kennedy, O. D. (2016) · Osteoarthritis and Cartilage · doi:10.1016/j.joca.2016.05.017 · Cited by 44 · see citing works
Self-citationCiani, C., Sharma, D., Doty, S. B., & Fritton, S. P. (2013) · Bone · doi:10.1016/j.bone.2013.11.026 · Cited by 43 · see citing works
“It has also been suggested, and has been shown in a damage model [53], that surviving osteocytes surrounding apoptotic osteocytes signal via RANKL to initiate osteoclast recruitment [29].”
BackgroundThe role of subchondral bone damage in post‐traumatic osteoarthritis
Coughlin, T. R., & Kennedy, O. D. (2016) · Annals of the New York Academy of Sciences · doi:10.1111/nyas.13261 · Cited by 42 · see citing works
Self-citationBurr, D. B. (2019) · Bone · doi:10.1016/j.bone.2019.07.015 · Cited by 42 · see citing works
“The dying osteocytes close to the damage produce less osteoprotegerin (OPG), whereas the healthy osteocytes at some distance from the damage release more RANKL [24,25].”
BackgroundHunter, R. L., & Agnew, A. M. (2016) · Bone Reports · doi:10.1016/j.bonr.2016.09.002 · Cited by 40 · see citing works
“Apoptotic osteocytes signal surviving neighboring osteocytes to release RANKL to signal initiation and direct a targeted intracortical remodeling event (Kennedy et al., 2012).”
BackgroundBone: A Fertile Soil for Cancer Metastasis
Coughlin, T. R., Romero-Moreno, R., Mason, D. E., Nystrom, L. M., Boerckel, J. D., Niebur, G. L., & Littlepage, L. E. (2017) · Current Drug Targets · doi:10.2174/1389450117666161226121650 · Cited by 41 · see citing works
The molecular etiology and treatment of glucocorticoid-induced osteoporosis
Peng, C.-H., Lin, W.-Y., Yeh, K.-T., Chen, I.-H., Wu, W.-T., & Lin, M. (2021) · Tzu-Chi Medical Journal · doi:10.4103/tcmj.tcmj_233_20 · Cited by 41 · see citing works
Thermally Induced Osteocyte Damage Initiates a Remodelling Signaling Cascade
Dolan, E. B., Haugh, M. G., Voisin, M. C., Tallon, D., & McNamara, L. M. (2015) · PLoS ONE · doi:10.1371/journal.pone.0119652 · Cited by 40 · see citing works
“Recent studies have demonstrated that, in the case of micro-damage, osteocyte apoptosis is typically confined to discrete locations local to the micro-damage site and it is the nearby non-injured cells that are responsible for initiating pro-osteoclastogenic signalling [17,21], and the results of this study suggest th…”
InfluentialKo, F. C., Dragomir, C. L., Plumb, D. A., Hsia, A. W., Adebayo, O. O., Goldring, S. R., Wright, T. M., Goldring, M. B., & van der Meulen, M. C. H. (2016) · Journal of Orthopaedic Research® · doi:10.1002/jor.23204 · Cited by 40 · see citing works
Parallel mechanisms suppress cochlear bone remodeling to protect hearing
Jáuregui, E. J., Akil, O., Acevedo, C., Hall‐Glenn, F., Tsai, B. S., Bale, H., Liebenberg, E. C., Humphrey, M. B., Ritchie, R. O., Lustig, L. R., et al. (2016) · Bone · doi:10.1016/j.bone.2016.04.010 · Cited by 40 · see citing works
Oliveira, M. C., Pieters, B. C. H., Guimarães, P. B., Duffles, L. F., Heredia, J. E., Silveira, A. L. M., de Oliveira, A. C. C., Teixeira, M. M., Ferreira, A. V. M., Silva, T. A., et al. (2020) · Frontiers in Bioengineering and Biotechnology · doi:10.3389/fbioe.2020.00891 · Cited by 40 · see citing works
“On the other side, OPG is derived primarily from cells of the osteoblast lineage and is described as an antagonist of RANKL by competing with RANK for the binding of RANKL (Lacey et al., 1998, 2000).”
BackgroundRepair of Microdamage in Osteonal Cortical Bone Adjacent to Bone Screw
Wang, L., Ye, T., Deng, L., Shao, J., Jin, Q., Zhou, Q., Li, W., & Qiu, S. (2014) · PLoS ONE · doi:10.1371/journal.pone.0089343 · Cited by 39 · see citing works
Gifre, L., Vidal, J., Carrasco, J. L., Filella, X., Ruiz-Gaspà, S., Muxí, Á., Portell, E., Monegal, A., Guañabens, N., & Peris, P. (2014) · Journal of Bone and Mineral Research · doi:10.1002/jbmr.2423 · Cited by 39 · see citing works
McKenzie, J. A., Smith, C. R., Karuppaiah, K., Langberg, J., Silva, M. J., & Ornitz, D. M. (2019) · Journal of Bone and Mineral Research · doi:10.1002/jbmr.3742 · Cited by 39 · see citing works
“(49) Interestingly, it has been shown that viable osteocytes, within 100 to 300 µm from dying osteocytes, have increased expression of VEGF and RANKL.”
Xie, W., Li, F., Han, Y., Qin, Y., Wang, Y., Chi, X., Xiao, J., & Li, Z. (2020) · Aging · doi:10.18632/aging.103129 · Cited by 39 · see citing works
“Bone microdamage is generally repaired by the bone remodeling process [8], which is involved in a coupled system of bone formation and resorption.”
BackgroundPTH receptor signalling, osteocytes and bone disease induced by diabetes mellitus
Marino, S., & Bellido, T. (2024) · Nature Reviews Endocrinology · doi:10.1038/s41574-024-01014-7 · Cited by 40 · see citing works
“This finding suggests that signals from dying osteocytes increase the expression of angiogenesis-inducing molecules in nearby osteocytes 30,54,55 , which in turn facilitates the recruitment of osteoclast precursors from the circulation to bone areas that need replacement.”
- Authors
- Kennedy, O. D., Herman, B. C., Laudier, D. M., Majeska, R. J., Sun, H. B., & Schaffler, M. B.
- Affiliations
- City College of New York (US)
- Icahn School of Medicine at Mount Sinai (US)
- Corresponding author
- Schaffler, Mitchell B.
- Venue
- Bone
- Publisher
- Elsevier BV
- Published
- 2012-05
- Volume
- 50
- Issue
- 5
- Pages
- 1115-1122
- ISSN
- 1873-2763 (ISSN-L)
- 8756-3282
- PMC
- PMC3366436
- OpenAlex
- W1999925297
- Cited by
- 275
- References
- 49
- Citations by year
- 2026: 14 · 2025: 10 · 2024: 13 · 2023: 15 · 2022: 11 · 2021: 18 · 2020: 22 · 2019: 23 · 2018: 20 · 2017: 27 · 2016: 19 · 2015: 30 · 2014: 24 · 2013: 20 · 2012: 9
- FWCI
- 10.68
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Locations
- Bone (publishedVersion)
- PubMed (publishedVersion)
- Europe PMC (PubMed Central) (acceptedVersion)
- PubMed Central (acceptedVersion)
- Funders
- National Institutes of Health
- National Institute of Arthritis and Musculoskeletal and Skin Diseases (AR41210, R01AR041210, R01AR057139, R21AR060445, AR050968, R01AR050968, AR057139, AR060445)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Bone Metabolism and Diseases
- Health Sciences › Medicine › Orthopedics and Sports Medicine › Bone health and osteoporosis research
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Cell death mechanisms and regulation
- Keywords
- osteocyte apoptosis, bone fatigue, microdamage, osteoclastogenesis, RANKL, osteoprotegerin, vascular endothelial growth factor, caspase-3, bone remodeling, cyclic loading, ulna
- MeSH terms
- Animals, Bone Resorption, Calcification, Physiologic, Female, Gene Expression Regulation, Immunohistochemistry, Microscopy, Fluorescence, Osteoclasts, Osteocytes, Stress, Mechanical, Ulna, Signal Transduction, Apoptosis, Rats, Caspase 3, Osteoprotegerin, RANK Ligand
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
