The DOI matches its Crossref record; 5 of the 5 references it cites were found in a registry or an index.
Maternal obesity during pregnancy and lactation programs the development of offspring non-alcoholic fatty liver disease in mice
Abstract
Background & aims Obesity induced, non-alcoholic fatty liver disease (NAFLD), is now the major cause in affluent countries, of the spectrum of steatosis-to-cirrhosis. Obesity and NAFLD rates in reproductive age women, and adolescents, are rising worldwide. Our hypothesis was that maternal obesity and lactation transmit to the offspring a pre-disposition to dysmetabolism, obesity and NAFLD. Methods Female mice were fed standard or obesogenic chow, before, throughout pregnancy, and during lactation. The critical developmental period was studied by cross-fostering offspring of lean and obese dams. Offspring were then weaned onto standard chow and studied at 3months. Read-outs included markers of metabolic dysfunction, biochemical and histological indicators of NAFLD, induction of liver fibrogenesis, and activation of pro-fibrotic pathways. Mechanisms involved in programming a dysmetabolic and NAFLD phenotype were investigated by assaying breast milk components. Results Offspring of obese dams had a dysmetabolic, insulin resistant and NAFLD phenotype compared to offspring of lean dams. Offspring of lean dams that were suckled by obese dams showed an exaggerated dysmetabolic and NAFLD phenotype, with increased body weight, as well as increased levels of insulin, leptin, aspartate transaminase, interleukin-6, tumour necrosis factor-alpha, liver triglycerides, steatosis, hepatic fibrogenesis, renal norepinephrine, and liver alpha1-D plus beta1-adrenoceptors, indicative of sympathetic nervous system activation. Obese dams also had raised breast milk leptin levels compared to lean dams. Conclusions Maternal obesity programs development of a dysmetabolic and NAFLD phenotype, which is critically dependent on the early postnatal period and possibly involving alteration of hypothalamic appetite nuclei signalling by maternal breast milk and neonatal adipose tissue derived, leptin.
Overview
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“a number of studies showed that maternal obesity induced greater adiposity and obesity [95,96,97,98] as well as hepatic steatosis [95,96,99] in the offspring.”
From Recent Experimental Studies of Maternal Obesity, Diabetes during Pregnancy and the Developmental Origins of Cardiovascular Disease (2022) · cites this paper as [95]
In the citing paper
“a number of studies showed that maternal obesity induced greater adiposity and obesity [95,96,97,98] as well as hepatic steatosis [95,96,99] in the offspring.”
From Recent Experimental Studies of Maternal Obesity, Diabetes during Pregnancy and the Developmental Origins of Cardiovascular Disease (2022) · cites this paper as [95]
Citations
Cites
Nonalcoholic Fatty Liver Disease
Angulo, P. (2002) · New England Journal of Medicine · doi:10.1056/nejmra011775 · Cited by 5,228
The fetal and infant origins of adult disease.
Barker, D. J. (1990) · BMJ · doi:10.1136/bmj.301.6761.1111 · Cited by 2,768
Positive and negative regulation of insulin signaling through IRS-1 phosphorylation
Gual, P., Le Marchand-Brustel, Y., & Tanti, J.-F. (2005) · Biochimie · doi:10.1016/j.biochi.2004.10.019 · Cited by 912 · cited 1×
“Reduced liver IRS expression and hyper-phosphorylation of IRS serine residues are key factors in the development of insulin resistance and type 2 diabetes [17,18].”
BackgroundMinireview: Leptin and Development of Hypothalamic Feeding Circuits
Bouret, S. G., & Simerly, R. B. (2004) · Endocrinology · doi:10.1210/en.2004-0231 · Cited by 210
Norepinephrine Is Required for Leptin Effects on Gene Expression in Brown and White Adipose Tissue1
Commins, S. P., Marsh, D. J., Thomas, S. A., Watson, P. M., Padgett, M. A., Palmiter, R., & Gettys, T. W. (1999) · Endocrinology · doi:10.1210/endo.140.10.7043 · Cited by 107
Research works printed but not linked: 35
- Targher, 2007, Prevalence of nonalcoholic fatty liver disease and its association with cardiovascular disease among type 2 diabetic patients, Diabetes Care, 30, 1212, 10.2337/dc06-2247 · DOI
- Hedley, 2004, Prevalence of overweight and obesity among US children, adolescents, and adults, 1999–2002, JAMA, 291, 2847, 10.1001/jama.291.23.2847 · DOI
- Barker, 1995, The fetal and infant origins of disease, Eur J Clin Invest, 25, 457, 10.1111/j.1365-2362.1995.tb01730.x · DOI
- Ravelli, 1999, Obesity at the age of 50 y in men and women exposed to famine prenatally, Am J Clin Nutr, 70, 811, 10.1093/ajcn/70.5.811 · DOI
- Yajnik, 2000, Interactions of perturbations in intrauterine growth and growth during childhood on the risk of adult-onset disease, Proc Nutr Soc, 59, 257, 10.1017/S0029665100000288 · DOI
- Catalano, 2003, Obesity and pregnancy–the propagation of a viscous cycle?, J Clin Endocrinol Metab, 88, 3505, 10.1210/jc.2003-031046 · DOI
- Catalano, 2003, Gestational diabetes and insulin resistance: role in short- and long-term implications for mother and fetus, J Nutr, 133, 1674S, 10.1093/jn/133.5.1674S · DOI
- Oken, 2003, Fetal origins of obesity, Obes Res, 11, 496, 10.1038/oby.2003.69 · DOI
- Day, 1998, Steatohepatitis: a tale of two “hits”?, Gastroenterology, 114, 842, 10.1016/S0016-5085(98)70599-2 · DOI · Paper page
- Oben, 2003, Norepinephrine induces hepatic fibrogenesis in leptin deficient ob/ob mice, Biochem Biophys Res Commun, 308, 284, 10.1016/S0006-291X(03)01360-3 · DOI
- Oben, 2004, Hepatic fibrogenesis requires sympathetic neurotransmitters, Gut, 53, 438, 10.1136/gut.2003.026658 · DOI
- Folch, 1957, A simple method for the isolation and purification of total lipides from animal tissues, J Biol Chem, 226, 497, 10.1016/S0021-9258(18)64849-5 · DOI · Paper page
- Kleiner, 2005, Design and validation of a histological scoring system for nonalcoholic fatty liver disease, Hepatology, 41, 1313, 10.1002/hep.20701 · DOI · Paper page
- Samuelsson, 2008, Diet-induced obesity in female mice leads to offspring hyperphagia, adiposity, hypertension, and insulin resistance. a novel murine model of developmental programming, Hypertension, 51, 383, 10.1161/HYPERTENSIONAHA.107.101477 · DOI · Paper page
- Zick, 2004, Uncoupling insulin signalling by serine/threonine phosphorylation: a molecular basis for insulin resistance, Biochem Soc Trans, 32, 812, 10.1042/BST0320812 · DOI
- Watanabe, 2008, Liver diseases and metabolic syndrome, J Gastroenterol, 43, 509, 10.1007/s00535-008-2193-6 · DOI
- Browning, 2004, Prevalence of hepatic steatosis in an urban population in the United States: impact of ethnicity, Hepatology, 40, 1387, 10.1002/hep.20466 · DOI · Paper page
- McCurdy, 2009, Maternal high-fat diet triggers lipotoxicity in the fetal livers of nonhuman primates, Journal of Clinical Investigation, 119, 323
- Khan, 2004, Predictive adaptive responses to maternal high-fat diet prevent endothelial dysfunction but not hypertension in adult rat offspring, Circulation, 110, 1097, 10.1161/01.CIR.0000139843.05436.A0 · DOI
- Sanchez, 2005, Leptin orally supplied to neonate rats is directly uptaken by the immature stomach and may regulate short-term feeding, Endocrinology, 146, 2575, 10.1210/en.2005-0112 · DOI
- Pico, 2007, Role of leptin present in maternal milk in the control of energy balance during the post-natal period, Genes Nutr, 2, 139, 10.1007/s12263-007-0038-1 · DOI
- Kirk, 2009, Maternal obesity induced by diet in rats permanently influences central processes regulating food intake in offspring, PLoS One, 4, e5870, 10.1371/journal.pone.0005870 · DOI
- Bouret, 2004, Formation of projection pathways from the arcuate nucleus of the hypothalamus to hypothalamic regions implicated in the neural control of feeding behavior in mice, J Neurosci, 24, 2797, 10.1523/JNEUROSCI.5369-03.2004 · DOI
- Ahima, 2000, Postnatal regulation of hypothalamic neuropeptide expression by leptin: implications for energy balance and body weight regulation, Regul Pept, 92, 1, 10.1016/S0167-0115(00)00142-7 · DOI
- Franke, 2005, ‘Programming’ of orexigenic and anorexigenic hypothalamic neurons in offspring of treated and untreated diabetic mother rats, Brain Res, 1031, 276, 10.1016/j.brainres.2004.11.006 · DOI
- McMillen, 2008, Developmental origins of adult health and disease: the role of periconceptional and foetal nutrition, Basic Clin Pharmacol Toxicol, 102, 82, 10.1111/j.1742-7843.2007.00188.x · DOI
- Plagemann, 2008, A matter of insulin: developmental programming of body weight regulation, J Matern Fetal Neonatal Med, 21, 143, 10.1080/14767050801929869 · DOI
- Tilg, 2000, Cytokines in Alcoholic and Nonalcoholic Steatohepatitis, N Engl J Med, 343, 1467, 10.1056/NEJM200011163432007 · DOI
- Nieto-Vazquez, 2008, Insulin resistance associated to obesity: the link TNF-alpha, Arch Physiol Biochem, 114, 183, 10.1080/13813450802181047 · DOI
- Diehl, 2003, Insulin resistance syndrome and nonalcoholic fatty liver disease, Endocr Pract, 9, 93, 10.4158/EP.9.S2.93 · DOI
- Saxena, 2002, Leptin in hepatic fibrosis: Evidence for increased collagen production in stellate cells and lean littermates of ob/ob mice, Hepatology, 35, 762, 10.1053/jhep.2002.32029 · DOI · Paper page
- Vickers, 2001, Dysregulation of the adipoinsular axis – a mechanism for the pathogenesis of hyperleptinemia and adipogenic diabetes induced by fetal programming, J Endocrinol, 170, 323, 10.1677/joe.0.1700323 · DOI
- Bachem, 1989, The role of thrombocytes in liver fibrogenesis: effects of platelet lysate and thrombocyte-derived growth factors on the mitogenic activity and glycosaminoglycan synthesis of cultured rat liver fat storing cells, J Clin Chem Clin Biochem, 27, 555
- Hirose, 2007, Angiotensin II type 1 receptor blocker inhibits fibrosis in rat nonalcoholic steatohepatitis, Hepatology, 45, 1375, 10.1002/hep.21638 · DOI
- Barshop, 2008, Review article: epidemiology, pathogenesis and potential treatments of paediatric non-alcoholic fatty liver disease, Aliment Pharmacol Ther, 28, 13, 10.1111/j.1365-2036.2008.03703.x · DOI
Cited by
Sorted by citations
Items 101–200 of 273
Bellatorre, A., Scherzinger, A. L., Stamm, E. R., Martinez, M., Ringham, B. M., & Dabelea, D. (2017) · The Journal of Pediatrics · doi:10.1016/j.jpeds.2017.09.008 · Cited by 48
“Animal studies have shown that murine dams that were obese prior to and during pregnancy produced offspring that had a dysmetabolic, insulin resistant, and NAFLD phenotype compared with offspring of lean dams.(33) In addition, lactation from obese dams caused lean healthy offspring to develop a similar phenotype.”
Cheong, Y., Sadek, K., Bruce, K., Macklon, N., & Cagampang, F. (2014) · Fertility and Sterility · doi:10.1016/j.fertnstert.2014.06.015 · Cited by 44
Szántó, K., Li, J., Cordero, P., & Oben, J. A. (2019) · Diabetes Metabolic Syndrome and Obesity · doi:10.2147/dmso.s182331 · Cited by 49
“Studies have shown an increased number of Kupffer cells (KC); however, these KC showed defective function.(22) Some studies also report a decreased number of natural killer T cells.”
Self-citationHow could metabolomics change pediatric health?
Bardanzellu, F., & Fanos, V. (2020) · Italian Journal of Pediatrics · doi:10.1186/s13052-020-0807-7 · Cited by 42
“In a rat model, it has been also demonstrated that maternal obesity and non-alcoholic fatty liver disease (NAFLD) influence offspring metabolism, predisposing to dysmetabolism, insulin resistance, obesity and NAFLD itself, potentially via BM (in fact, a higher content of leptin was detected in these mothers instead of…”
BackgroundEnhanced Steatosis and Fibrosis in Liver of Adult Offspring Exposed to Maternal High-Fat Diet
Thompson, M. D., Cismowski, M. J., Trask, A. J., Lallier, S. W., Graf, A. E., Rogers, L. K., Lucchesi, P. A., & Brigstock, D. R. (2016) · Gene Expression · doi:10.3727/105221616x692135 · Cited by 43
Kjaergaard, M., Nilsson, C., Rosendal, Å., Nielsen, M. O., & Raun, K. (2013) · Acta Physiologica · doi:10.1111/apha.12138 · Cited by 43
“In rodent (Bayol et al. 2009, 2010, Oben et al. 2010, Shankar et al. 2010) and primate (McCurdy et al. 2009) studies, it has been found that a maternal high-fat diet can modify gene expression and stimulate lipid deposition in adipose tissue and liver, leading to deleterious changes in the…”
BackgroundYoung, B. E., Patinkin, Z. W., Pyle, L. L., de la Houssaye, B. A., Davidson, B. S., Geraghty, S. R., Morrow, A. L., & Krebs, N. F. (2017) · Maternal and Child Health Journal · doi:10.1007/s10995-016-2243-2 · Cited by 44
Effects of pregnancy on obesity-induced inflammation in a mouse model of fetal programming
Ingvorsen, C., Thysen, A. H., Fernandez‐Twinn, D. S., Nordby, P., Nielsen, K. F., Ozanne, S. E., Brix, S., & Hellgren, L. I. (2014) · International Journal of Obesity · doi:10.1038/ijo.2014.69 · Cited by 40
Self-citationNguyen, L. T., Chen, H., Zaky, A. A., Pollock, C. A., & Saad, S. (2018) · The Journal of Physiology · doi:10.1113/jp276957 · Cited by 41
“Maternal obesity and high-fat diet (HFD) consumption in particular have been shown to predispose offspring to obesity and related metabolic disorders (Howie et al. 2009; Oben et al. 2010; Glastras et al. 2015; Saben et al. 2016).”
BackgroundDevelopmental Programming of NAFLD by Parental Obesity
Thompson, M. D. (2020) · Hepatology Communications · doi:10.1002/hep4.1578 · Cited by 47
“1395 to maternal HFD, high-fat/high-sucrose (HF/HS) diet, and high-fat, high-fructose, high-cholesterol (HFFC) diet.(17-21) Genes involved in TG and fatty acid (FA) synthesis were increased in the liver, including increased sterol regulatory element-binding protein 1c (SREBP1c).”
BackgroundMaternal Obesity Promotes Diabetic Nephropathy in Rodent Offspring
Glastras, S. J., Tsang, M., Teh, R., Chen, H., McGrath, R. T., Zaky, A. A., Pollock, C. A., & Saad, S. (2016) · Scientific Reports · doi:10.1038/srep27769 · Cited by 36
Lebovics, E., & Rubin, J. N. (2011) · Diabetes/Metabolism Research and Reviews · doi:10.1002/dmrr.1198 · Cited by 33
“The study concluded that maternal obesity programs the development of a dysmetabolic and NAFLD phenotype which is critically dependent on the early post-natal period [40].”
BackgroundBioactive compounds in mothers milk affecting offspring outcomes: A narrative review
Gregg, B. E., Ellsworth, L. A., Pavela, G., Shah, K. B., Berger, P. K., ISGANAITIS, E. M., VanOmen, S., Demerath, E. W., & Fields, D. A. (2022) · Pediatric Obesity · doi:10.1111/ijpo.12892 · Cited by 34
Chen, H., Simar, D., Pegg, K., Saad, S., Palmer, C. S., & Morris, M. J. (2013) · Diabetologia · doi:10.1007/s00125-013-3132-5 · Cited by 35
“We and others have shown that maternal obesity can influence the development of hypothalamic circuits involved in energy homeostasis, and thus predispose offspring to obesity and its associated complications early in life [2–5].”
BackgroundKereliuk, S. M., & Dolinsky, V. W. (2022) · International Journal of Molecular Sciences · doi:10.3390/ijms23084467 · Cited by 34
“Using this approach, a number of studies showed that maternal obesity induced greater adiposity and obesity [95–98] as well as hepatic steatosis [95,96,99] in the offspring.”
BackgroundCan breastfeeding affect the rest of our life?
Lisboa, P. C., Miranda, R. A., Souza, L. L., & de Moura, E. G. (2021) · Neuropharmacology · doi:10.1016/j.neuropharm.2021.108821 · Cited by 45
Zhou, C., Zhou, J., Han, N., Liu, Z., Xiao, B., & Yin, J. (2015) · International Immunopharmacology · doi:10.1016/j.intimp.2015.01.027 · Cited by 37
Developmental Programming of Body Composition: Update on Evidence and Mechanisms
ISGANAITIS, E. M. (2019) · Current Diabetes Reports · doi:10.1007/s11892-019-1170-1 · Cited by 38
Nicholas, L. M., & Ozanne, S. E. (2019) · Philosophical Transactions of the Royal Society B Biological Sciences · doi:10.1098/rstb.2018.0116 · Cited by 35
Self-citationWallace, J. G., Gohir, W., & Sloboda, D. M. (2015) · Journal of Developmental Origins of Health and Disease · doi:10.1017/s2040174415001518 · Cited by 37
Caruso, V., Chen, H., & Morris, M. J. (2011) · PLoS ONE · doi:10.1371/journal.pone.0025261 · Cited by 38
Bae-Gartz, I., Kasper, P., Grossmann, N., Breuer, S., Janoschek, R., Kretschmer, T., Appel, S., Schmitz, L., Vohlen, C., Quaas, A., et al. (2020) · Scientific Reports · doi:10.1038/s41598-020-72022-6 · Cited by 32
Deciphering the role of aberrant DNA methylation in NAFLD and NASH
Vachher, M., Bansal, S., Kumar, B., Yadav, S., & Burman, A. (2022) · Heliyon · doi:10.1016/j.heliyon.2022.e11119 · Cited by 33
SIRT1 Attenuates Kidney Disorders in Male Offspring Due to Maternal High-Fat Diet
Nguyen, L. T., Mak, C., Chen, H., Zaky, A. A., Wong, M. G., Pollock, C. A., & Saad, S. (2019) · Nutrients · doi:10.3390/nu11010146 · Cited by 35
Influence of Maternal Nutritional Status on Vascular Function in the Offspring
Poston, L. (2011) · Microcirculation · doi:10.1111/j.1549-8719.2011.00086.x · Cited by 33
“Recently, we have reported that the adult offspring develop a condition very similar to nonalcoholic fatty liver disease and show deposition of fat in the pancreas [47,48].”
BackgroundSelf-citationPan, Y., Zou, S., Xu, Y., Di, R., Gu, H., Wang, Z., Wei, X., Yang, C., & Zhang, G. (2023) · Frontiers in Endocrinology · doi:10.3389/fendo.2023.1093991 · Cited by 32
“Maternal hyperglycemia and obesity predispose offspring to metabolic dysfunction (37), although the underlying mechanism is elusive, and the fetal hyperglycemia and IR disrupt normal surfactant synthesis and function, which may lead to adverse outcome in neonates (38).”
BackgroundAntioxidant Effects of N-Acetylcysteine Prevent Programmed Metabolic Disease in Mice
Admin, A., Charron, M., Williams, L., Seki, Y., Du, X.-Q., Chaurasia, B., Saghatelian, A., Summers, S., Katz, E. B., Vuguin, P., et al. (2020) · Diabetes · doi:10.2337/db19-1129 · Cited by 30
“NAC also prevented increased hepatic TG, increased liver weight, and hepatic steatosis—changes found to be caused by HFD (44,45).”
Backgroundl-Carnitine intake prevents irregular feeding-induced obesity and lipid metabolism disorder
Wu, T., Guo, A., Shu, Q., Qi, Y., Kong, Y., Sun, Z., Sun, S., & Fu, Z. (2014) · Gene · doi:10.1016/j.gene.2014.10.040 · Cited by 34
Watkins, O. C., Yong, H. E. J., Sharma, N., & Chan, S. (2020) · Critical Reviews in Food Science and Nutrition · doi:10.1080/10408398.2020.1845604 · Cited by 40
“This suggests that myo-inositol deficiency is more dangerous during periods of massive lipid mobilization from adipose tissue, such as during lactation (Oben et al. 2010; Vernon 2005).”
BackgroundSarker, G., Litwan, K., Kästli, R., & Peleg‐Raibstein, D. (2019) · Scientific Reports · doi:10.1038/s41598-019-53652-x · Cited by 39
Thompson, M. D., Derse, A., Ferey, J. L. A., Reid, M., Xie, Y., Christ, M., Chatterjee, D., Nguyen, C., Harasymowicz, N. S., Guilak, F., et al. (2019) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.00474.2018 · Cited by 32
Nakashima, A., Sugimoto, R., Suzuki, K., Shirakata, Y., Hashiguchi, T., Yoshida, C., & Nakano, Y. (2018) · Food Science & Nutrition · doi:10.1002/fsn3.828 · Cited by 28
“Forward TTCACAGAGGATACCACTCC Oben et al. (2010) Reverse GTTTGGTAGCATCCATCATT”
BackgroundMethodInfluentialEarly life programming and the risk of non-alcoholic fatty liver disease
Lynch, C., Chan, C. S., & Drake, A. J. (2017) · Journal of Developmental Origins of Health and Disease · doi:10.1017/s2040174416000805 · Cited by 33
Soeda, J., Cordero, P., Li, J., Mouralidarane, A., Asilmaz, E., Ray, S., Nguyen, V., Carter, R. M., Novelli, M. R., Vinciguerra, M., et al. (2016) · International Journal of Food Sciences and Nutrition · doi:10.1080/09637486.2016.1261086 · Cited by 30
“These dramatically rising rates could partially be explained by obesogenic dietary patterns, and there is emerging evidence that maternal obesity (MO) also predisposes offspring to NAFLD in animal models (Oben et al. 2010; Mouralidarane et al. 2013; Mouralidarane et al. 2015).”
BackgroundInfluentialSelf-citationAltered hepatic insulin signalling in male offspring of obese mice
Martin‐Gronert, M. S., Fernandez‐Twinn, D. S., Poston, L., & Ozanne, S. E. (2010) · Journal of Developmental Origins of Health and Disease · doi:10.1017/s2040174410000231 · Cited by 29
Self-citationSaengnipanthkul, S., Noh, H. L., Friedline, R. H., Suk, S., Choi, S. H., Acosta, N. K., Tran, D. A., Hu, X., Inashima, K., Kim, A. M., et al. (2021) · Physiological Reports · doi:10.14814/phy2.14811 · Cited by 33
“In addition, offspring of obese dams developed histological and biochemical changes compatible with hepatic steatosis with liver injury and fibrogenesis (Oben et al., 2010).”
Wang, X.-K., Yang, Y.-X., Zhu, P., Wu, Y., Jin, Y., Yu, S., Wei, H.-Y., Qian, M., Cao, W., Xu, S., et al. (2019) · Environmental Pollution · doi:10.1016/j.envpol.2019.113366 · Cited by 26
Pyrroloquinoline-quinone to reduce fat accumulation and ameliorate obesity progression
Ishak, N. S. M., & Ikemoto, K. (2023) · Frontiers in Molecular Biosciences · doi:10.3389/fmolb.2023.1200025 · Cited by 25
Zeng, J., Shen, F., Zou, Z.-Y., Yang, R.-X., Jin, Q.-F., Yang, J., Chen, G.-Y., & Fan, J.-G. (2022) · World Journal of Gastroenterology · doi:10.3748/wjg.v28.i16.1681 · Cited by 25
Maragkoudaki, X., Naylor, M., Papacleovoulou, G., Stolarczyk, É., Rees, D., Pombo, J., Abu‐Hayyeh, S., Czajka, A., Howard, J. K., Malik, A. N., et al. (2020) · International Journal of Obesity · doi:10.1038/s41366-020-00682-5 · Cited by 21
“Compromised fatty acid oxidation would be consistent with the development of a fatty liver phenotype which we have previously described in this rodent model [15, 17].”
BackgroundSelf-citationDiversity and temporal dynamics of primate milk microbiomes
Muletz‐Wolz, C. R., Kurata, N. P., Himschoot, E. A., Wenker, E. S., Quinn, E. A., Hinde, K., Power, M. L., & Fleischer, R. C. (2019) · American Journal of Primatology · doi:10.1002/ajp.22994 · Cited by 29
“For instance, allowing mouse pups of lean mothers to nurse from obese mothers results in the lean pups becoming vulnerable to obesity and metabolic disease (Oben et al., 2010), possibly by establishing an obesity‐associated gut microbiome (Turnbaugh et al., 2006).”
BackgroundYoungson, N. A., Uddin, G. M., Das, A., Martinez, C., Connaughton, H. S., Whiting, S., Yu, J., Sinclair, D. A., Aitken, R. J., & Morris, M. J. (2019) · Reproduction · doi:10.1530/rep-18-0574 · Cited by 38
“Postnatally, offspring from obese mothers have reduced survival rate (Reynolds et al. 2013), which is linked to increased risk for diseases such as CVD (Reynolds et al. 2013), metabolic syndrome (Boney et al. 2005) and non-alcoholic fatty liver disease (Oben et al. 2010).”
Abeysekera, K. W. M., Orr, J. G., Madley‐Dowd, P., Fernandes, G., Zuccolo, L., Gordon, F. H., Lawlor, D. A., Heron, J., & Hickman, M. (2021) · The Lancet Regional Health - Europe · doi:10.1016/j.lanepe.2021.100206 · Cited by 25
“In addition to breastfeeding duration being lower in mothers with obesity, murine models showed in offspring of mice controldiets, when breastfed by obese mice on high-fat diets, had evidence of increased hepatic tumour necrosis factor, interleukin-6 expression, and triglyceride levels highlighting a difference in bre…”
BackgroundEarly hepatic insult in the offspring of obese maternal mice.
Bringhenti, I., Ornellas, F., Martins, M., Mandarim-de-Lacerda, C., & Aguila, M. (2015) · Nutrition Research · doi:10.1016/j.nutres.2014.11.006 · Cited by 24
“Previous data support the concept that the offspring of diet-induced obese (DIO) dams have adverse metabolic programming and develop overweight/obesity and dyslipidemia in adulthood [9, 10].”
BackgroundChen, H.-C., Chen, Y.-Z., Wang, C.-H., & Lin, F.-J. (2019) · Journal of Nutritional Biochemistry · doi:10.1016/j.jnutbio.2019.108319 · Cited by 23
Long-term behavioural effects of maternal obesity in C57BL/6J mice
Zieba, J., Uddin, G. M., Youngson, N. A., Karl, T., & Morris, M. J. (2018) · Physiology & Behavior · doi:10.1016/j.physbeh.2018.11.004 · Cited by 26
Ríos, E. A., Ruíz-Herrera, X., Tinoco-Pantoja, V., López-Barrera, F., Escalera, G. M., Clapp, C., & Macotela, Y. (2018) · The FASEB Journal · doi:10.1096/fj.201701154r · Cited by 23
Oliveira, L. S. D., Souza, L. L., Souza, A. F. P., Cordeiro, A., Kluck, G. E. G., Atella, G. C., Trevenzoli, I. H., & Pazos-Moura, C. C. (2016) · Molecular Nutrition & Food Research · doi:10.1002/mnfr.201600171 · Cited by 26
Summerfield, M., Zhou, Y., Zhou, T., Wu, C., Alpini, G., Zhang, K. K., & Xie, L. (2018) · PLOS ONE · doi:10.1371/journal.pone.0209053 · Cited by 23
George, G., Draycott, S. A. V., Muir, R., Clifford, B. L., Elmes, M. J., & Langley‐Evans, S. C. (2019) · Scientific Reports · doi:10.1038/s41598-019-50448-x · Cited by 29
Leca, B. M., Lagojda, L., Kite, C., Karteris, E., Kassi, E. N., Randeva, H. S., & Kyrou, I. (2024) · Expert Review of Endocrinology & Metabolism · doi:10.1080/17446651.2024.2365791 · Cited by 24
“…studies have shown that maternal obesity influences the development of a dysmetabolic and MAFLD phenotype, which is highly dependent on the early postnatal period and may involve changes in hypothalamic appetite signaling due to maternal breast milk and neonatal adipose tissue-derived leptin [113].”
BackgroundAssociations Among Maternal Adiposity, Insulin, and Adipokines in Circulation and Human Milk
Schneider, C. R., Bahorski, J. S., Fields, D. A., Gower, B. A., Fernández, J. R., & Chandler-Laney, P. C. (2020) · Journal of Human Lactation · doi:10.1177/0890334420962711 · Cited by 23
The Rise in the Prevalence of Nonalcoholic Fatty Liver Disease and Hepatocellular Carcinoma
Sherif, Z. A. (2019) · IntechOpen eBooks · doi:10.5772/intechopen.85780 · Cited by 22
Zhang, Z.-Y., Zeng, J., Kjaergaard, M., Guan, N., Raun, K., Nilsson, C., & Wang, M.-W. (2011) · Clinical and Experimental Pharmacology and Physiology · doi:10.1111/j.1440-1681.2011.05568.x · Cited by 21
“Furthermore, SS1 pups had a higher liver TG content than CS1 pups, suggesting that feeding of the high-energy diet during gestation augmented the impact on fat deposition in the young, possibly due to a malfunction in lipid handling, an observation consistent with previous findings.(13,37) However, the body fat mass a…”
ResultArenas, G., Barrera, M., & Contreras‐Duarte, S. (2025) · Nutrients · doi:10.3390/nu17030387 · Cited by 20
Exercised breastmilk: a kick-start to prevent childhood obesity?
Moholdt, T. T., & Stanford, K. I. (2023) · Trends in Endocrinology and Metabolism · doi:10.1016/j.tem.2023.08.019 · Cited by 24
“For example, offspring born to lean dams and cross-fostered by obese dams have a pro-foundly dysmetabolic phenotype [49].”
BackgroundMoeckli, B., Delaune, V., Prados, J., Tihy, M., Peloso, A., Oldani, G., Delmi, T., Slits, F., Gex, Q., Rubbia‐Brandt, L., et al. (2022) · Biomedicines · doi:10.3390/biomedicines10020294 · Cited by 19
“Additionally, murine studies have shown that pups born to obese mothers exhibit an increased risk of developing liver diseases such as steatosis and signs of hepatitis such as increased inflammatory markers and fibrosis [12,13].”
BackgroundDíaz, P., Harris, J., Rosario, F. J., Powell, T. L., & Jansson, T. (2015) · American Journal of Physiology-Regulatory, Integrative and Comparative Physiology · doi:10.1152/ajpregu.00385.2015 · Cited by 72
Lipotoxicity and the role of maternal nutrition
Pruis, M., van Ewijk, P. A., Schrauwen-Hinderling, V. B., & Plösch, T. (2014) · Acta Physiologica · doi:10.1111/apha.12171 · Cited by 18
da Conceição, E. P. S., de Moura, E. G., Trevenzoli, I. H., Peixoto‐Silva, N., Pinheiro, C. R., Younes-Rapozo, V., Oliveira, E., & Lisboa, P. C. (2012) · European Journal of Nutrition · doi:10.1007/s00394-012-0448-8 · Cited by 19
Developmental programming of tissue-resident macrophages
Viola, M. F., Taveras, E. F., & Mass, E. (2024) · Frontiers in Immunology · doi:10.3389/fimmu.2024.1475369 · Cited by 22
“It is intriguing to speculate that this developmental programming may contribute to the increased prevalence of fatty liver disease observed in the offspring of overweight mice, and potentially, humans (60 – 62).”
Glucocorticoids and intrauterine programming of nonalcoholic fatty liver disease
Chen, Z., Xia, L., Shen, L., Xu, D., Guo, Y., & Wang, H. (2023) · Metabolism · doi:10.1016/j.metabol.2023.155713 · Cited by 18
Nobili, V., Cianfarani, S., & Agostoni, C. V. (2010) · Journal of Hepatology · doi:10.1016/j.jhep.2010.02.010 · Cited by 14
Liang, J., Na, X., Meng, L., He, L., Shu, T., Fang, Y., Zhang, B., Zhao, Z., Guo, C., Li, J., et al. (2025) · MedComm · doi:10.1002/mco2.70245 · Cited by 15
“Moreover, such abnormal methylation levels seem to be inherited by the next generation, leading to susceptibility to NAFLD or other metabolic disorders in the offspring [239, 240].”
Non-nutritive bioactive components in maternal milk and offspring development: a scoping review
Eisha, S., Joarder, I., Wijenayake, S., & McGowan, P. O. (2022) · Journal of Developmental Origins of Health and Disease · doi:10.1017/s2040174422000149 · Cited by 19
TOS Scientific Position Statement: Breastfeeding and Obesity
Oken, E., Fields, D. A., Lovelady, C., & Redman, L. (2017) · Obesity · doi:10.1002/oby.22024 · Cited by 16
“, length, weight, BMI-z and DBMI-z, fat and lean mass) have been reported and are the subject of emerging research (18-21).”
BackgroundKruse, M., Keyhani‐Nejad, F., Isken, F., Nitz, B., Kretschmer, A., Reischl, E., Gala, T. D. L. H., Osterhoff, M. A., Grallert, H., & Pfeiffer, A. F. H. (2015) · Diabetes · doi:10.2337/db15-0478 · Cited by 18
“Animal studies have shown that mice exposed to a maternal HFD during IU/L and weaned onto a standard chow developed adiposity, insulin resistance, and hepatosteatosis later in life (13,14).”
BackgroundMaternal Brain Adaptations in Pregnancy
Brunton, P. J., & Russell, J. A. (2014) · Elsevier eBooks · doi:10.1016/b978-0-12-397175-3.00044-2 · Cited by 18
Nutritional Programming Effects on Development of Metabolic Disorders in Later Life
Ong, T. P., & Guest, P. C. (2018) · Methods in molecular biology · doi:10.1007/978-1-4939-7614-0_1 · Cited by 17
Wajsbrot, N. B., Leite, N. C., Salles, G. F., & Villela‐Nogueira, C. A. (2022) · World Journal of Gastroenterology · doi:10.3748/wjg.v28.i25.2890 · Cited by 16
Unmet needs in pediatric NAFLD research: what do we need to prioritize for the future?
Hatton, G. B., Alterio, T., Nobili, V., & Mann, J. P. (2018) · Expert Review of Gastroenterology & Hepatology · doi:10.1080/17474124.2018.1512853 · Cited by 15
Lima, M. S., Perez, G. S., Morais, G. L., Santos, L. S., Cordeiro, G. S., Couto, R. D., Deiró, T. C. B. J., Leandro, C. G., & Barreto-Medeiros, J. M. (2018) · Brazilian Journal of Biology · doi:10.1590/1519-6984.166788 · Cited by 15
Hellgren, L. I., Jensen, R. I., Waterstradt, M. S. G., Quistorff, B., & Lauritzen, L. (2014) · Acta Obstetricia Et Gynecologica Scandinavica · doi:10.1111/aogs.12458 · Cited by 18
“It is known that an obesogenic fat-rich diet during pregnancy and lactation has long-lasting effects on hepatic fat in the offspring in both rodents and non-human primates (4,22).”
BackgroundThe Origins of NAFLD: The Potential Implication of Intrauterine Life and Early Postnatal Period
Valentini, F., Rocchi, G., Gentilucci, U. V., Guarino, M. P. L., Altomare, A., & Carotti, S. (2022) · Cells · doi:10.3390/cells11030562 · Cited by 13
“Animal models suggest that a high-fat diet in early childhood both during and after weaning may exaggerate the risk and severity of pediatric NAFLD, regardless of maternal obesity during gestation and lactation [15,17,84].”
BackgroundLarsen, J. K., & Bode, L. (2021) · Nutrients · doi:10.3390/nu13020299 · Cited by 14
Alisi, A., & Vajro, P. (2017) · Journal of Hepatology · doi:10.1016/j.jhep.2017.04.016 · Cited by 14
“by maternal obesity in the postpartum period with maternal breast milk factors.(7,8) With this in mind, the elegant observational study by Ayonrinde et al.”
BackgroundMoeckli, B., Delaune, V., Gilbert, B. T. P., Peloso, A., Oldani, G., Hajji, S. E., Slits, F., Ribeiro, J. R., Mercier, R., Gleyzolle, A., et al. (2024) · JHEP Reports · doi:10.1016/j.jhepr.2024.101056 · Cited by 12
“To discern the importance of the post-natal vs . pre-natal environment on our fi ndings, conducting cross-fostering experiments, where offspring of HFD-fed mothers are transferred to and reared by ND-fed mothers after birth, 13 would have been valuable.”
InfluentialMaternal Early‐Pregnancy Glucose Concentrations and Liver Fat Among School‐Age Children
Geurtsen, M. L., Wahab, R. J., Felix, J. F., Gaillard, R., & Jaddoe, V. W. V. (2021) · Hepatology · doi:10.1002/hep.31910 · Cited by 17
“Animal studies have suggested that in utero exposure to high glucose concentrations may induce ectopic fat storage (13-15).”
BackgroundInfluentialAlexandre-Gouabau, M. C., David-Sochard, A., Royer, A., Parnet, P., & Paillé, V. (2020) · International Journal of Molecular Sciences · doi:10.3390/ijms21155428 · Cited by 16
“[20] on 171 experimental studies identified that the exposure to high fat diet during the lactation period was a key modulator of bodyweight of the offspring at weaning and in adulthood, with a significantly greater effect on offspring fat mass than when WD exposure occurred during pregnancy alone [21].”
BackgroundNairz, J., Messner, A., Zollner-Kiechl, S., Winder, B., Hochmayr, C., Egger, A., Griesmacher, A., Geiger, R., Griesmaier, E., Pechlaner, R., et al. (2024) · PLoS ONE · doi:10.1371/journal.pone.0298800 · Cited by 11
Shashikadze, B., Valla, L., Lombardo, S. D., Prehn, C. P., Haid, M., Riols, F., Stöckl, J. B., Elkhateib, R., Renner, S., Rathkolb, B., et al. (2023) · Molecular Metabolism · doi:10.1016/j.molmet.2023.101768 · Cited by 13
Mandala, A., Dobrinskikh, E., Janssen, R. C., Fiehn, O., D’Alessandro, A., Friedman, J. E., & Jonscher, K. R. (2022) · International Journal of Molecular Sciences · doi:10.3390/ijms23116043 · Cited by 13
George, G., Draycott, S. A. V., Muir, R., Clifford, B. L., Elmes, M. J., & Langley‐Evans, S. C. (2019) · Scientific Reports · doi:10.1038/s41598-019-46518-9 · Cited by 16
Chan, Y. L., Saad, S., Simar, D., Oliver, B. G. G., McGrath, K. C. Y., van Reyk, D. M., Bertrand, P. P., Gorrie, C. A., Pollock, C. A., & Chen, H. (2015) · International Journal of Developmental Neuroscience · doi:10.1016/j.ijdevneu.2015.05.009 · Cited by 12
“Here, liver PGC-1˛ expression was downregulated by maternal obesity, which may be closely linked to the phenotype of liver steatosis (Bruce et al., 2009; Bayol et al., 2010; Oben et al., 2010; Caruso et al., 2011; Chen et al., 2014b).”
BackgroundResultHistone variants and lipid metabolism
Borghesan, M., Mazzoccoli, G., Sheedfar, F., Oben, J. A., Pazienza, V., & Vinciguerra, M. (2014) · Biochemical Society Transactions · doi:10.1042/bst20140119 · Cited by 14
Self-citationXu, X., Hu, J., McGrath, B. C., & Cavener, D. R. (2013) · PLoS ONE · doi:10.1371/journal.pone.0075917 · Cited by 11
“[21–29].”
Zhang, Z.-Y., Dai, Y.-L., Wang, H.-N., & Wang, M.-W. (2013) · Clinical and Experimental Pharmacology and Physiology · doi:10.1111/1440-1681.12147 · Cited by 12
Ye, J., Shi, R., Wu, X., Fan, H., Zhao, Y., Hu, X., Wang, L., Bo, X., Li, D., Ge, Y., et al. (2025) · Gut Microbes · doi:10.1080/19490976.2025.2452241 · Cited by 13
Salto, R., Manzano, M., Girón, M. D., Cano, A., Castro, A., Vílchez, J. D., Cabrera, E., & López-Pedrosa, J. M. (2019) · Nutrients · doi:10.3390/nu11040844 · Cited by 12
“There are data in the lipid profile that point out the possibility NAFLD developing in the HF–”
BackgroundResultInfluentialEnvironmental Forces that Shape Early Development: What We Know and Still Need to Know
Shankar, K., Pivik, R. T., Johnson, S. L., van Ommen, B., Demmer, E., & Murray, R. D. (2017) · Current Developments in Nutrition · doi:10.3945/cdn.117.001826 · Cited by 14
“In experimental models, accumulation of ectopic lipids in the liver (25, 26), increased lipogenesis in white adipose tissue (24), and a greater tendency for stem cells to differentiate into adipocytes (24) have all been noted.”
BackgroundCordero, P., Li, J.-W., Nguyen, V., Pombo, J., Maicas, N., Novelli, M., Taylor, P., Samuelsson, A., Vinciguerra, M., & Oben, J. (2017) · Nutrients · doi:10.3390/nu9091041 · Cited by 11
“Our previous results showed that maternal obesity programs development of a dysmetabolic and NAFLD phenotype, which is critically dependent on the early postnatal period involving alteration of hypothalamic appetite nuclei signaling by maternal breast milk and neonatal adipose tissue-derived leptin [12,32].”
BackgroundResultSelf-citationLagisz, M., Blair, H. T., Kenyon, P. R., Uller, T., Raubenheimer, D., & Nakagawa, S. (2015) · International Journal of Obesity · doi:10.1038/ijo.2015.160 · Cited by 42
Ndisang, J., Rastogi, S., & Vannacci, A. (2014) · Journal of Diabetes Research · doi:10.1155/2014/276475 · Cited by 11
“In addition, increased hepatic lipogenesis and fatty liver disease [69, 70] found in the offspring exposed to maternal obesity also contribute to hepatic insulin resistance.”
BackgroundMetabolic control of ovarian function through the sympathetic nervous system: role of leptin
Astudillo-Guerrero, C., Paredes, A. H., Escobar, J., Fernandois, D., Barra, R., & Cruz, G. (2025) · Frontiers in Endocrinology · doi:10.3389/fendo.2024.1484939 · Cited by 10
Li, L., Zhou, Y., Li, H., Li, J., Huang, L., & Wu, W. (2025) · Diabetology & Metabolic Syndrome · doi:10.1186/s13098-024-01550-2 · Cited by 10
Developmental origins of adult diseases
Mo, J., Liu, X., Huang, Y., He, R., Zhang, Y., & Huang, H. (2022) · Medical Review · doi:10.1515/mr-2022-0027 · Cited by 14
Baptissart, M., Bradish, C. M., Jones, B. S., Walsh, E. S., Tehrani, J. M., Marrero‐Colon, V., Mehta, S., Jima, D. D., Oh, S., Diehl, A. M., et al. (2022) · Hepatology · doi:10.1002/hep.32363 · Cited by 13
“Previous studies in rodents have focused primarily on the programming effects of maternal MetS on chronic liver disease at adulthood.[23,24] However, in addition to an increasing prevalence among adults, NAFLD affects 10% of the pediatric population in the United States.”
BackgroundZhang, Q., Ye, L., Xin, F., Zhou, J., Cao, B., Dong, Y., & Qian, L. (2021) · Journal of Nutrition · doi:10.1093/jn/nxab026 · Cited by 14
Sha, L.-J., Zhou, S., Xi, Y., Li, R., & Li, X. (2019) · Journal of Biomedical Research · doi:10.7555/jbr.33.20180107 · Cited by 10
Role of sterile inflammation in fatty liver diseases
Chen, Y., Yousaf, M. N., & Mehal, W. Z. (2018) · Liver Research · doi:10.1016/j.livres.2018.02.003 · Cited by 11
Metadata
- Authors
- Oben, J. A., Mouralidarane, A., Samuelsson, A.-M., Matthews, P. J., Morgan, M. L., Mckee, C., Soeda, J., Fernandez-Twinn, D. S., Martin-Gronert, M. S., Ozanne, S. E., Sigala, B., Novelli, M., Poston, L., & Taylor, P. D.
- Affiliations
- St Thomas' Hospital (GB)
- King's College London (GB)
- The Royal Free Hospital (GB)
- University of Cambridge (GB)
- University College London (GB)
- Corresponding author
- Oben, Jude A.
- ORCID
- Venue
- Journal of Hepatology
- Publisher
- Elsevier BV
- Published
- 2010-06
- Volume
- 52
- Issue
- 6
- Pages
- 913-920
- ISSN
- 0168-8278 (ISSN-L)
- OpenAlex
- W2034714209
- Cited by
- 314
- References
- 0
- Citations by year
- 2026: 4 · 2025: 12 · 2024: 8 · 2023: 28 · 2022: 24 · 2021: 10 · 2020: 21 · 2019: 31 · 2018: 22 · 2017: 20 · 2016: 28 · 2015: 21 · 2014: 27 · 2013: 25 · 2012: 14
- FWCI
- 13.26
- Type
- journal article
- Language
- en
- Open access
- closed
- Locations
- Journal of Hepatology (publishedVersion)
- PubMed (publishedVersion)
- UCL Discovery (University College London) (submittedVersion)
- Research Portal (King's College London) (submittedVersion)
- Funders
- British Heart Foundation (FS/10/003/28163, FS/09/029/27902)
- Biotechnology and Biological Sciences Research Council (BB/F015364/1)
- Topics
- Health Sciences › Medicine › Hepatology › Liver Disease Diagnosis and Treatment
- Health Sciences › Medicine › Pediatrics, Perinatology and Child Health › Birth, Development, and Health
- Health Sciences › Medicine › Endocrinology, Diabetes and Metabolism › Diet, Metabolism, and Disease
- Keywords
- maternal obesity, non-alcoholic fatty liver disease, developmental programming, lactation, cross-fostering, insulin resistance, leptin, breast milk, liver fibrosis, sympathetic nervous system, adrenergic receptors, leptin resistance, dysmetabolism, offspring phenotype, obesogenic diet
- MeSH terms
- Actins, Adipose Tissue, Animals, Collagen, Fatty Liver, Female, Lactation, Mice, Inbred C57BL, Milk, Obesity, Pregnancy, Pregnancy Complications, Prenatal Exposure Delayed Effects, Tumor Necrosis Factor-alpha, Signal Transduction, Interleukin-6, Gene Expression, Receptors, Adrenergic, alpha-1, Leptin, Collagen Type I, Metabolic Syndrome, Mice
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
