The DOI matches its Crossref record; 48 of the 48 references it cites were found in a registry or an index.
Selective expression of the interleukin 7 receptor identifies effector CD8 T cells that give rise to long-lived memory cells
Abstract
A major unanswered question is what distinguishes the majority of activated CD8 T cells that die after an acute viral infection from the small fraction (5-10%) that survive to become long-lived memory cells. In this study we show that increased expression of the interleukin 7 receptor alpha-chain (IL-7Ralpha) identifies the effector CD8 T cells that will differentiate into memory cells. IL-7R(hi) effector cells contained increased amounts of antiapoptotic molecules, and adoptive transfer of IL-7R(hi) and IL-7R(lo) effector cells showed that IL-7R(hi) cells preferentially gave rise to memory cells that could persist and confer protective immunity. Thus, selective expression of IL-7R identifies memory cell precursors, and this marker may be useful in predicting the number of memory T cells generated after infection or immunization.
Overview
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“Ag-specific CD8 T cells derived from the effector phase of a response can express various combinations of CD127 and KLRG1, which define either more short-lived effector cells (SLECs; CD127−KLRG1+), which are lost during the contraction phase of the immune response, or memory precursor effector cells (MPECs; CD127+KLRG1−), which are more likely to persist and contribute to memory populations [224,”
From Guidelines for the use of flow cytometry and cell sorting in immunological studies (third edition) (2021) · cites this paper as [224]
Citations
Cites
Counting Antigen-Specific CD8 T Cells: A Reevaluation of Bystander Activation during Viral Infection
Murali‐Krishna, K., Altman, J. D., Suresh, M., Sourdive, D. J. D., Zajac, A. J., Miller, J. D., Slansky, J. E., & Ahmed, R. (1998) · Immunity · doi:10.1016/s1074-7613(00)80470-7 · Cited by 1,918
Self-citationEffector and memory T-cell differentiation: implications for vaccine development
Kaech, S. M., Wherry, E. J., & Ahmed, R. (2002) · Nature Reviews Immunology · doi:10.1038/nri778 · Cited by 1,865
Self-citationLineage relationship and protective immunity of memory CD8 T cell subsets
Wherry, E. J., Teichgräber, V., Becker, T. C., Masopust, D., Kaech, S. M., Antia, R., von Andrian, U. H., & Ahmed, R. (2003) · Nature Immunology · doi:10.1038/ni889 · Cited by 1,864
Self-citationLymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine
von Freeden-Jeffry, U., Vieira, P., Lucian, L., McNeil, T., Burdach, S. E. G., & Murray, R. (1995) · Journal of Experimental Medicine · doi:10.1084/jem.181.4.1519 · Cited by 1,648
Interleukin-7 mediates the homeostasis of naïve and memory CD8 T cells in vivo
Schluns, K. S., Kieper, W. C., Jameson, S. C., & Lefrançois, L. (2000) · Nature Immunology · doi:10.1038/80868 · Cited by 1,619
Memory CD8+ T cells vary in differentiation phenotype in different persistent virus infections
Appay, V., Dunbar, P. R., Callan, M. F. C., Klenerman, P., Gillespie, G. M. A., Papagno, L., Ogg, G. S., King, A., Lechner, F., Spina, C. A., et al. (2002) · Nature Medicine · doi:10.1038/nm0402-379 · Cited by 1,556
Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice.
Peschon, J. J., Morrissey, P., Grabstein, K. H., Ramsdell, F. J., Maraskovsky, E., Gliniak, B., Park, L. S., Ziegler, S. F., Williams, D. E., Ware, C. B., et al. (1994) · The Journal of Experimental Medicine · doi:10.1084/jem.180.5.1955 · Cited by 1,553
Phenotypic and functional separation of memory and effector human CD8+ T cells
Hamann, D., Baars, P. A., Rep, M. H. G., Hooibrink, B., Kerkhof-Garde, S. R., Klein, M. R., & Lier, R. A. W. V. (1997) · The Journal of Experimental Medicine · doi:10.1084/jem.186.9.1407 · Cited by 1,366
Kaech, S. M., & Ahmed, R. (2001) · Nature Immunology · doi:10.1038/87720 · Cited by 1,265
Self-citationMolecular and functional profiling of memory CD8 T cell differentiation.
Kaech, S., Hemby, S., Kersh, E., & Ahmed, R. (2002) · Cell · doi:10.1016/s0092-8674(02)01139-x · Cited by 1,081
Self-citation
Flagged first, then by citations
Cited by
Sorted by citations
Items 401–500 of 1,002
Dynamic Regulation of IFN-γ Signaling in Antigen-Specific CD8+ T Cells Responding to Infection
Haring, J. S., Corbin, G. A., & Harty, J. T. (2005) · The Journal of Immunology · doi:10.4049/jimmunol.174.11.6791 · Cited by 97
“These CD127 CD8 T cells survive contraction and initiate the memory pool (66, 67).”
BackgroundmTOR, linking metabolism and immunity
Xu, X., Ye, L., Araki, K., & Ahmed, R. (2012) · Seminars in Immunology · doi:10.1016/j.smim.2012.12.005 · Cited by 99
“Upon recognizing cognate antigen, CD8 T cells undergo robust proliferation followed by rapid contraction, whereby most effector cells undergo apoptosis, leaving only a small proportion to become long-term protective memory cells [51, 52].”
BackgroundSelf-citationWilson, D. C., Grotenbreg, G. M., Liu, K., Zhao, Y., Frickel, E., Gubbels, M., Ploegh, H. L., & Yap, G. S. (2010) · PLoS Pathogens · doi:10.1371/journal.ppat.1000815 · Cited by 96
“measure of memory quality, IL-2 expression, a characteristic of memory-lineage CD8+ T cells [42], was also analyzed.”
BackgroundRegulation of CD8+ T memory and exhaustion by the mTOR signals
Chen, Y., Xu, Z., Sun, H., Ouyang, X., Han, Y., Yu, H., Wu, N., Xie, Y., & Su, B. (2023) · Cellular and Molecular Immunology · doi:10.1038/s41423-023-01064-3 · Cited by 101
Kittipatarin, C., & Khaled, A. R. (2007) · Cytokine · doi:10.1016/j.cyto.2007.07.183 · Cited by 96
Archaeosome adjuvants: Immunological capabilities and mechanism(s) of action
Krishnan, L., & Sprott, G. D. (2008) · Vaccine · doi:10.1016/j.vaccine.2008.02.026 · Cited by 96
Interleukin-7: Fuel for the autoimmune attack
Dooms, H. (2013) · Journal of Autoimmunity · doi:10.1016/j.jaut.2013.06.007 · Cited by 96
Homing imprinting and immunomodulation in the gut: Role of dendritic cells and retinoids
Mora, R. J. (2007) · Inflammatory Bowel Diseases · doi:10.1002/ibd.20280 · Cited by 96
Persistent Antigen Presentation after Acute Vesicular Stomatitis Virus Infection
Turner, D., Cauley, L. S., Khanna, K. M., & Lefrançois, L. (2006) · Journal of Virology · doi:10.1128/jvi.02167-06 · Cited by 98
“CD69 expression is transiently upregulated early after activation (56), while IL-7R is initially downregulated followed by reexpression as effector CD8 T cells progress toward memory development (17, 42).”
BackgroundGenerating diversity: transcriptional regulation of effector and memory CD8+ T‐cell differentiation
Rutishauser, R. L., & Kaech, S. M. (2010) · Immunological Reviews · doi:10.1111/j.0105-2896.2010.00901.x · Cited by 97
“(16) confirmed this dynamic IL-7Ra expression pattern on antiviral CD8 T cells during LCMV infection, and also extended from these findings by determining that the small population IL-7Ra-expressing effector cells possessed higher memory cell potential and preferentially survived to become long-lived memory cells comp…”
BackgroundSelf-citationProtective Immunity Against Hepatitis C: Many Shades of Gray
Abdel-Hakeem, M. S., & Shoukry, N. H. (2014) · Frontiers in Immunology · doi:10.3389/fimmu.2014.00274 · Cited by 99
“This is consistent with data from the LCMV model showing that CD127 is a marker of cells destined to become long-lived memory T cells (150).”
ResultQiu, Y., Chen, J., Liao, H., Zhang, Y., Wang, H., Li, S., Luo, Y., Fang, D., Li, G., Zhou, B., et al. (2012) · PLoS Pathogens · doi:10.1371/journal.ppat.1002984 · Cited by 94
“high levels of another effector memory surrogate marker CD127 (IL-7 Receptor a) [39].”
BackgroundKhan, A. A., Penny, L. A., Yuzefpolskiy, Y., Sarkar, S., & Kalia, V. (2013) · Blood · doi:10.1182/blood-2012-06-435412 · Cited by 94
Flatz, L., Roychoudhuri, R., Honda, M., Filali-Mouhim, A., Goulet, J.-P., Kettaf, N., Lin, M., Roederer, M., Haddad, E. K., Sékaly, R. P., et al. (2011) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1013084108 · Cited by 91
“Analysis of surface proteins, such as the interleukin-7 receptor (IL7R) and Lselectin (CD62L), in mice has allowed the definition of three differentiation states, referred to as effector (IL7R low, CD62L low), effector memory (IL7R, CD62L−), and central memory (IL7R, CD62L) states characterized by a gradient of prolif…”
Dynamic regulation of IL-7 receptor expression is required for normal thymopoiesis
Munitić, I., Williams, J. A., Yang, Y., Dong, B., Lucas, P. J., Kassar, N. E., Gress, R. E., & Ashwell, J. D. (2004) · Blood · doi:10.1182/blood-2004-06-2484 · Cited by 94
Memory CD4 T Cells in Influenza
Zens, K. D., & Färber, D. L. (2014) · Current topics in microbiology and immunology · doi:10.1007/82_2014_401 · Cited by 95
“CD4 and CD8 cells (Kaech et al. 2003; Huster et al. 2004).”
BackgroundInfluentialFifteen Years of Gene Therapy Based on Chimeric Antigen Receptors: “Are We Nearly There Yet?”
Dotti, G., Savoldo, B., & Brenner, M. K. (2009) · Human Gene Therapy · doi:10.1089/hum.2009.142 · Cited by 93
“Similarly, IL-7 is essential for homeostatic expansion of naive T cells (Schluns et al. , 2000; Ma et al. , 2006) and for maintaining the memory T cell population (Kaech et al. , 2003; Nanjappa et al. , 2008).”
Increased T-bet is associated with senescence of influenza virus-specific CD8 T cells in aged humans
Dolfi, D. V., Mansfield, K. D., Polley, A. M., Doyle, S. A., Freeman, G. J., Pircher, H., Schmader, K. E., & Wherry, E. J. (2013) · Journal of Leukocyte Biology · doi:10.1189/jlb.0912438 · Cited by 93
“, the ability to produce cytokines and even kill target cells), lack of proliferative potential impairs their ability to mount robust immune responses and expand in number upon reinfection [19, 21, 22].”
BackgroundSelf-citationLoss of T cell receptor-induced Bmi-1 in the KLRG1 + senescent CD8 + T lymphocyte
Heffner, M., & Fearon, D. T. (2007) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0706040104 · Cited by 92
MicroRNA-directed program of cytotoxic CD8 + T-cell differentiation
Trifari, S., Pipkin, M. E., Bandukwala, H. S., Äijö, T., Bassein, J. A., Chen, R., Martínez, G., & Rao, A. (2013) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1317191110 · Cited by 92
“KLRG1 and CD127 (IL-7Rα chain) are used to distinguish CD8 T cells that have differentiated in vivo into fully armed effector CTLs from those that will preferentially generate longlived memory cells (21).”
BackgroundNdhlovu, Z. M., Proudfoot, J., Cesa, K. T., Alvino, D. M. L., McMullen, A. M., Vine, S. M., Stampouloglou, E., Trocha, A. K., Walker, B. D., & Pereyra, F. (2012) · Journal of Virology · doi:10.1128/jvi.00531-12 · Cited by 97
“cells exist in a continuum of differentiation states ranging from naïve to the terminally differentiated stage (12, 24).”
BackgroundXu, L., Yang, L., Yao, D., Wu, X., Li, J., Liu, X., Deng, L., Huang, C., Wang, Y., Li, D., et al. (2017) · Cellular Immunology · doi:10.1016/j.cellimm.2017.01.001 · Cited by 93
Distinct Requirements for Deletion versus Anergy during CD8 T Cell Peripheral Tolerance In Vivo
Redmond, W. L., Marincek, B. C., & Sherman, L. A. (2005) · The Journal of Immunology · doi:10.4049/jimmunol.174.4.2046 · Cited by 92
“It has been proposed that for memory T cell generation, the prosurvival signal initially involves expression of CD8 and is followed by up-regulation of the IL-7 receptor (56, 57).”
BackgroundPeixoto, A., Evaristo, C., Munitić, I., Monteiro, M., Charbit, A., Rocha, B., & Veiga‐Fernandes, H. (2007) · The Journal of Experimental Medicine · doi:10.1084/jem.20062349 · Cited by 92
“The IL-7R expression was fully down-regulated in PE-CD8s and progressively up-regulated later on, with some IL-7R− cells persisting into the PM phase (24).”
BackgroundInfluentialYang, T.-C., Millar, J., Groves, T., Grinshtein, N., Parsons, R., Takenaka, S., Wan, Y., & Bramson, J. L. (2006) · The Journal of Immunology · doi:10.4049/jimmunol.176.1.200 · Cited by 92
“Interestingly, 30–40% of the tetramerpositive cells were positive for the IL-7 receptor -subunit, CD127, which may be important for maintaining the memory population (40).”
BackgroundDominance of the CD4+ T helper cell response during acute resolving hepatitis A virus infection
Zhou, Y., Callendret, B., Xu, D., Brasky, K. M., Feng, Z., Hensley, L., Guedj, J., Perelson, A. S., Lemon, S. M., Lanford, R. E., et al. (2012) · The Journal of Experimental Medicine · doi:10.1084/jem.20111906 · Cited by 92
“…was still detectable in the liver of 4X0395, the majority of virusspecific CD8+ T cells had acquired a typical memory phenotype At the same time, expression of CD127, a component of the IL-7 receptor required to maintain memory populations (Kaech et al., 2003), steadily increased after week 4 (Fig.”
BackgroundGenetic Manipulation of Tumor-specific Cytotoxic T Lymphocytes to Restore Responsiveness to IL-7
Vera, J. F., Hoyos, V., Savoldo, B., Quintarelli, C., Attianese, G. M. P. G., Leen, A. M., Liu, H., Foster, A. E., Heslop, H. E., Rooney, C. M., et al. (2009) · Molecular Therapy · doi:10.1038/mt.2009.34 · Cited by 92
The molecular signature of CD8+ T cells undergoing deletional tolerance
Parish, I. A., Rao, S., Smyth, G. K., Juelich, T., Denyer, G. S., Davey, G. M., Strasser, A., & Heath, W. R. (2009) · Blood · doi:10.1182/blood-2008-10-185223 · Cited by 92
Programmed death ligand-1 expression on donor T cells drives graft-versus-host disease lethality
Saha, A., O’Connor, R. S., Thangavelu, G., Lovitch, S. B., Dandamudi, D. B., Wilson, C. B., Vincent, B. G., Tkachev, V., Pawlicki, J. M., Furlan, S. N., et al. (2016) · Journal of Clinical Investigation · doi:10.1172/jci85796 · Cited by 96
“18 during viral infection (57, 58) and for the transition of CD4 Teffs into memory cells (59).”
BackgroundNeidleman, J. A., Luo, X., McGregor, M. M., Xie, G., Murray, V., Greene, W. C., Lee, S. A., & Roan, N. R. (2021) · eLife · doi:10.7554/elife.72619 · Cited by 89
IL-15 Regulates Both Quantitative and Qualitative Features of the Memory CD8 T Cell Pool
Sandau, M. M., Kohlmeier, J. E., Woodland, D. L., & Jameson, S. C. (2009) · The Journal of Immunology · doi:10.4049/jimmunol.0803355 · Cited by 91
“It is worth reiterating that the CD127 subset is usually less prominent in the 1 ̊ memory CD8 T cell pool; therefore, despite access to physiological levels of IL-15, the majority of 1 ̊ memory cells re-express IL-7Ra, which seems critical for their differentiation from the effector stage (13, 14).”
BackgroundType‐I IFN drives the differentiation of short‐lived effector CD8+ T cells in vivo
Wiesel, M., Crouse, J., Bedenikovic, G., Sutherland, A. P. R., Joller, N., & Oxenius, A. (2011) · European Journal of Immunology · doi:10.1002/eji.201142091 · Cited by 91
FOXO3 Regulates CD8 T Cell Memory by T Cell-Intrinsic Mechanisms
Sullivan, J. A., Kim, E. H., Plisch, E. H., Peng, S. L., & Suresh, M. (2012) · PLoS Pathogens · doi:10.1371/journal.ppat.1002533 · Cited by 95
“For example, during the phase of antigen-driven proliferation, IL-7R expression is known to be very low [68], and TCR signaling along with IL-2/IL-15 might drive the phosphorylation of FOXO1/O3.”
BackgroundHuster, K. M., Koffler, M., Stemberger, C., Schiemann, M., Wagner, H., & Busch, D. H. (2006) · European Journal of Immunology · doi:10.1002/eji.200635874 · Cited by 91
Tracking the dynamics of T‐cell activation in response to Salmonella infection
Ravindran, R., & McSorley, S. J. (2005) · Immunology · doi:10.1111/j.1365-2567.2005.02140.x · Cited by 91
Joshi, N., Cui, W., Dominguez, C. X., Chen, J. H., Hand, T., & Kaech, S. (2011) · Journal of Immunology · doi:10.4049/jimmunol.1002145 · Cited by 94
“1 P14 TCR transgenic mice have previously been described (8, 17).”
BackgroundMethodResultSelf-citationDelpoux, A., Lai, C.-Y., Hedrick, S. Μ., & Doedens, A. L. (2017) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1618916114 · Cited by 92
“CD8 T cells which express CD127 (IL7R) postinfection have increased memory potential (24), although CD127 (8, 34) itself is a cytokine receptor that does not directly regulate cell specification (35).”
BackgroundInfluentialT-Cell Biology in Aging, With a Focus on Lung Disease
Lee, N., Shin, M. S., & Kang, I. (2012) · The Journals of Gerontology Series A · doi:10.1093/gerona/glr237 · Cited by 89
“Similarly, human IL-7Rahigh memory CD8+ T cells survived better in response to IL-7 compared with IL-7Ralow memory CD8+ T cells (50).”
BackgroundInfluentialChemokine-Guided CD4+ T Cell Help Enhances Generation of IL-6RαhighIL-7Rαhigh Prememory CD8+ T Cells
Castellino, F., & Germain, R. N. (2007) · The Journal of Immunology · doi:10.4049/jimmunol.178.2.778 · Cited by 90
“functional memory T cells several weeks later (33).”
BackgroundmTOR Signaling in T Cell Immunity and Autoimmunity
Liu, Y., Zhang, D., & Liu, X. (2014) · International Reviews of Immunology · doi:10.3109/08830185.2014.933957 · Cited by 94
“Alternatively, inhibiting mTORC1 with rapacymin could increase the expression of Krueppel-like factor 2 (KLF2), which subsequently prevent the downregulation of CD62L, CCR7 and sphinogosine 1-phspshate receptor 1 (S1P1) in activated CD8+ T cells, thus improving the ability to home to secondary lymphoid tissues [93, 94…”
BackgroundCellular and molecular mechanisms of CD8(+) T cell differentiation, dysfunction and exhaustion
Verdon, D. J., Mulazzani, M., & Jenkins, M. R. (2020) · International Journal of Molecular Sciences · doi:10.3390/ijms21197357 · Cited by 98
“T-bet levels are lower in MPEC and T-bet is dispensable for a transition to long-lived memory [27,120].”
BackgroundRole of vitamin D in cytotoxic T lymphocyte immunity to pathogens and cancer
Sarkar, S., Hewison, M., Studzinski, G. P., Li, Y. C., & Kalia, V. (2015) · Critical Reviews in Clinical Laboratory Sciences · doi:10.3109/10408363.2015.1094443 · Cited by 90
Fraser, K. A., Schenkel, J. M., Jameson, S. C., Vezys, V., & Masopust, D. (2013) · Immunity · doi:10.1016/j.immuni.2013.07.003 · Cited by 92
“Of note, CD127 (interleukin-7 receptor a [IL-7Ra]) expression is necessary, but not sufficient, for survival, and it marks memory precursors and memory T cells (Hand et al., 2007; Kaech et al., 2003).”
BackgroundSabbaj, S., Ghosh, M. K., Edwards, B. H., Leeth, R. R., Decker, W. D., Goepfert, P., & Aldrovandi, G. M. (2005) · The Journal of Immunology · doi:10.4049/jimmunol.174.5.2951 · Cited by 89
Kedzierska, K., Venturi, V., Field, K. A., Davenport, M. P., Turner, S. J., & Doherty, P. C. (2006) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0603289103 · Cited by 89
Surviving the crash: Transitioning from effector to memory CD8+ T cell
D’Cruz, L. M., Rubinstein, M. P., & Goldrath, A. W. (2009) · Seminars in Immunology · doi:10.1016/j.smim.2009.02.002 · Cited by 92
“This loss is even more exaggerated in the absence of both IL-7 and IL-15 [6,68,72] suggesting that they together support the survival and maintenance of CD8+ T cells following antigen stimulation.”
BackgroundResultInfluentialPenaloza‐MacMaster, P., Provine, N. M., Ra, J., Borducchi, E. N., McNally, A. G., Simmons, N. L., Iampietro, M. J., & Barouch, D. H. (2012) · Journal of Virology · doi:10.1128/jvi.02058-12 · Cited by 83
“sors that will enter the pool of long-lived memory T cells (10).”
BackgroundJohnnidis, J. B., Muroyama, Y., Ngiow, S. F., Chen, Z., Manne, S., Cai, Z., Song, S., Platt, J. M., Schenkel, J. M., Abdel-Hakeem, M. S., et al. (2021) · Science Immunology · doi:10.1126/sciimmunol.abe3702 · Cited by 91
“4L), consistent with previous data showing the emergence of CD62Lhi TMEM from CD62Llo cells (6), although a small number of contaminating CD62Lhi cells in the donor pool contributing cannot be fully excluded.”
BackgroundMethodResultInfluentialSelf-citationBlair, D. A., & Lefrançois, L. (2007) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0703767104 · Cited by 88
Ultraviolet B Suppresses Immunity by Inhibiting Effector and Memory T Cells
Rana, S., Byrne, S. N., MacDonald, L. J., Chan, C. Y.-Y., & Halliday, G. M. (2008) · American Journal Of Pathology · doi:10.2353/ajpath.2008.070517 · Cited by 89
Adékambi, T., Ibegbu, C., Kalokhe, A. S., Yu, T., Ray, S. M., & Rengarajan, J. (2012) · PLoS ONE · doi:10.1371/journal.pone.0036046 · Cited by 88
“Both LTBI and BCG groups harbored effector memory subsets as indicated by expression of CD127 (IL7Ra), which is selectively re-expressed on memory T cells [28], but no co-expression of CCR7, a chemokine receptor that is expressed preferentially on central memory subsets [29].”
BackgroundKovalovsky, D., Alonzo, E. S., Uche, O. U., Eidson, M., Nichols, K. E., & Sant’Angelo, D. B. (2010) · The Journal of Immunology · doi:10.4049/jimmunol.1000776 · Cited by 88
Chronic viral infection promotes sustained Th1-derived immunoregulatory IL-10 via BLIMP-1
Parish, I. A., Marshall, H. D., Staron, M. M., Lang, P. A., Brüstle, A., Chen, J. H., Cui, W., Tsui, Y.-C., Perry, C. J., Laidlaw, B. J., et al. (2014) · Journal of Clinical Investigation · doi:10.1172/jci66108 · Cited by 89
Self-citationZaunders, J., Ip, S., Munier, C. M. L., Kaufmann, D., Suzuki, K., Brereton, C., Sasson, S. C., Seddiki, N., Koelsch, K. K., LANDAY, A. L., et al. (2006) · Journal of Virology · doi:10.1128/jvi.00249-06 · Cited by 88
“First, murine studies suggest that the small CD127 subset of CCR5 CD38 HIV-specific effector CD4 T cells that we previously observed (94) represents precursors of long-term memory CD4 T cells (30, 39, 63).”
BackgroundBachmann, M. F., Beerli, R. R., Agnellini, P., Wolint, P., Schwarz, K., & Oxenius, A. (2006) · European Journal of Immunology · doi:10.1002/eji.200535730 · Cited by 88
Ahonen, C. L., Wasiuk, A., Fuse, S., Turk, M. J., Ernstoff, M. S., Suriawinata, A. A., Gorham, J. D., Kedl, R. M., Usherwood, E. J., & Noelle, R. J. (2008) · Blood · doi:10.1182/blood-2007-09-114371 · Cited by 86
Broomfield, S., Currie, A. J., der Most, R. G. V., Brown, M. D., van Bruggen, I., Robinson, B. W. S., & Lake, R. (2005) · Cancer Research · doi:10.1158/0008-5472.can-05-0328 · Cited by 87
“Conventional CD8 T-cell memory exists in the absence of antigen and is maintained by the homeostatic cytokines IL-7 and IL-15 (15).”
BackgroundChandele, A., Joshi, N. S., Zhu, J., Paul, W. E., Leonard, W. J., & Kaech, S. M. (2008) · The Journal of Immunology · doi:10.4049/jimmunol.180.8.5309 · Cited by 86
“CD8 T cells (2, 12, 17), and a similar process likely occurs in”
BackgroundInfluentialSelf-citationVranjkovic, A., Crawley, A. M., Gee, K., Kumar, A., & Angel, J. B. (2007) · International Immunology · doi:10.1093/intimm/dxm102 · Cited by 85
Yap, M., Boeffard, F., Clave, E., Pallier, A., Danger, R., Giral, M., Dantal, J., Foucher, Y., Guillot-Gueguen, C., Toubert, A., et al. (2014) · Journal of the American Society of Nephrology · doi:10.1681/asn.2013080848 · Cited by 87
Differential Regulation of Human IL-7 Receptor α Expression by IL-7 and TCR Signaling
Alves, N. L., van Leeuwen, E. M. M., Derks, I. A. M., & van Lier, R. A. W. (2008) · The Journal of Immunology · doi:10.4049/jimmunol.180.8.5201 · Cited by 86
“In murine models, it has been postulated that the expression of IL-7R on the small subset of activated T cells during a primary immune response defines the population of cells that constitute the pool of long-lived memory cells (12, 14).”
BackgroundDu, L., Zhao, G., Lin, Y., Chan, C. C. S., He, Y., Jiang, S., Wu, C. Y., Jin, D., Yuen, K., Zhou, Y., et al. (2008) · Vaccine · doi:10.1016/j.vaccine.2008.01.025 · Cited by 86
Pagé, N., Klimek, B., Roo, M. D., Steinbach, K., Soldati, H., Lemeille, S., Wagner, I., Kreutzfeldt, M., Liberto, G. D., Vincenti, I., et al. (2018) · Immunity · doi:10.1016/j.immuni.2018.04.005 · Cited by 85
“Throughout the observation time of >40 days, KLRG1hi CD127lo SLECs and KLRG1hi CD127hi DPECs were more abundant in Tox / OT-1 cells than in Tox+/+ cells inside the same recipients (Figure S6A).”
InfluentialDiversity in CD8+ T cell differentiation
Parish, I. A., & Kaech, S. M. (2009) · Current Opinion in Immunology · doi:10.1016/j.coi.2009.05.008 · Cited by 91
“However, some KLRG senescent effector cells can persist into early memory as ‘short-lived TEM’ [34 ,55,56] (Figure 1) generating further heterogeneity within the memory population.”
BackgroundSelf-citationOnce a killer, always a killer: from cytotoxic T cell to memory cell
Lefrançois, L., & Obar, J. J. (2010) · Immunological Reviews · doi:10.1111/j.0105-2896.2010.00895.x · Cited by 89
“IL-7Ra expression correlates with enhanced or sustained expression of intracellular anti-apoptotic survival molecules including bcl-2 (52, 53).”
BackgroundAutoimmune Memory T Helper 17 Cell Function and Expansion Are Dependent on Interleukin-23
Haines, C. J., Chen, Y., Blumenschein, W. M., JAIN, R. K., Chang, C., Joyce-Shaikh, B., Porth, K., Boniface, K., Mattson, J. D., Basham, B., et al. (2013) · Cell Reports · doi:10.1016/j.celrep.2013.03.035 · Cited by 87
“…cells retain low IL-7Ra expression (McGeachy et al., 2009), a receptor that is known to be important for the survival of memory cells in CD8 populations (Kaech et al., 2003) and is also required for susceptibility to the experimental autoimmune encephalomyelitis (EAE) model (Walline et al., 2011).”
BackgroundSerine protease inhibitor 2A is a protective factor for memory T cell development
Liu, N., Phillips, T., Zhang, M., Wang, Y., Opferman, J. T., Shah, R., & Ashton‐Rickardt, P. G. (2004) · Nature Immunology · doi:10.1038/ni1107 · Cited by 86
Immunologic and Virologic Events in Early HIV Infection Predict Subsequent Rate of Progression
Ganesan, A., Chattopadhyay, P. K., Brodie, T. M., Qin, J., Gu, W., Mascola, J. R., Michael, N. L., Follmann, D. A., & Roederer, M. (2009) · The Journal of Infectious Diseases · doi:10.1086/649430 · Cited by 85
“survival of TCM and naive T cells [21, 26], and CD127 expression appears necessary for the generation of long-lived memory T”
Host conditioning with IL-1β improves the antitumor function of adoptively transferred T cells
Lee, P., Yamamoto, T. N., Gurusamy, D., Sukumar, M., Yu, Z., Hu‐Li, J., Kawabe, T., Gangaplara, A., Kishton, R. J., Henning, A. N., et al. (2019) · The Journal of Experimental Medicine · doi:10.1084/jem.20181218 · Cited by 88
Mastaglio, S., Genovese, P., Magnani, Z. I., Ruggiero, E., Landoni, E., Camisa, B., Schiroli, G., Provasi, E., Lombardo, A., Reik, A., et al. (2017) · Blood · doi:10.1182/blood-2016-08-732636 · Cited by 85
Differentiation into an Effector Memory Phenotype Potentiates HIV-1 Latency Reversal in CD4+T Cells
Kulpa, D. A., Talla, A., Brehm, J. H., Ribeiro, S. P., Yuan, S., Bebin-Blackwell, A.-G., Miller, M. D., Barnard, R., Deeks, S. G., Hazuda, D. J., et al. (2019) · Journal of Virology · doi:10.1128/jvi.00969-19 · Cited by 86
“CD127 expression is associated with a greater ability to become long-term memory 197 and indicates dependence on IL-7 signals for homeostatic maintenance (45-50).”
Yamauchi, T., Hoki, T., Oba, T., Saito, H., Attwood, K. M., Sabel, M. S., Chang, A. E., Odunsi, K. O., & Ito, F. (2020) · JCI Insight · doi:10.1172/jci.insight.133920 · Cited by 83
“In both spleen and the tumor, the CX3CR1– subset contained more CD62L+, CD127+, and KLRG1– populations, suggesting less-differentiated T cells while the CX3CR1hi subset comprised more CD62L–, CD127–, and KLRG1+ populations consistent with terminally differentiated effector T cells (Figure 1D) (12, 20, 21).”
BackgroundCD8 T-Cell Memory Differentiation during Acute and Chronic Viral Infections
Kalia, V., Sarkar, S., & Ahmed, R. (2010) · Advances in experimental medicine and biology · doi:10.1007/978-1-4419-6451-9_7 · Cited by 86
Self-citationDynamics of T cell memory in human cytomegalovirus infection
Waller, E. C. P., Day, E., Sissons, J. G. P., & Wills, M. R. (2008) · Medical Microbiology and Immunology · doi:10.1007/s00430-008-0082-5 · Cited by 84
“These Wndings are in contrast to a number of mouse models, which suggest that its expression is required for selection [82, 83].”
ResultChemokines: Control of Primary and Memory T-Cell Traffic
Schaerli, P., & Moser, B. (2004) · Immunologic Research · doi:10.1385/ir:31:1:57 · Cited by 87
A BAF-centred view of the immune system
Chi, T. H. (2004) · Nature reviews. Immunology · doi:10.1038/nri1501 · Cited by 84
Understanding memory CD8 + T cells
Samji, T., & Khanna, K. M. (2017) · Immunology Letters · doi:10.1016/j.imlet.2017.02.012 · Cited by 91
“CD127 is an important protein that is used to distinguish effector cells from memory T cells [20].”
BackgroundOmilusik, K. D., Nadjsombati, M. S., Shaw, L. A., Yu, B., Milner, J. J., & Goldrath, A. W. (2018) · The Journal of Experimental Medicine · doi:10.1084/jem.20171584 · Cited by 85
“CD8 T cells with low KLRG1 and high CD127 surface expression in the effector phase have been defined as memory-precursor (MP) T cells and show a greater propensity to survive after infection and exhibit increased stem-like properties such as self-renewal (Kaech et al., 2003; Joshi et al., 2007; Sarkar et al., 2008).”
InfluentialKieffer, T. E. C., Laskewitz, A., Scherjon, S. A., Faas, M. M., & Prins, J. R. (2019) · Frontiers in Immunology · doi:10.3389/fimmu.2019.00625 · Cited by 85
“, EM1 (CD27CD28), EM2 (CD27CD28), EM3 (CD27CD28), and EM4 (CD27CD28) (Table 2) (47), with EM-1 being the most prominent in peripheral blood (about 70%) (47, 123).”
Cellular and molecular waypoints along the path of T cell exhaustion
Lan, X., Zebley, C. C., & Youngblood, B. (2023) · Science Immunology · doi:10.1126/sciimmunol.adg3868 · Cited by 87
Vaccine-Induced CD8+ Central Memory T Cells in Protection from Simian AIDS
Vaccari, M., Trindade, C. J., Venzon, D. J., Zanetti, M., & Franchini, G. (2005) · The Journal of Immunology · doi:10.4049/jimmunol.175.6.3502 · Cited by 82
“Although B and T cell dynamics (22) and the role of memory Ab responses in protection against infection are well understood, less is known about the quality of memory T cells required for protection against disease.”
BackgroundThe CD8 isoform CD8αα is not a functional homologue of the TCR co-receptor CD8αβ
Gangadharan, D., & Cheroutre, H. (2004) · Current Opinion in Immunology · doi:10.1016/j.coi.2004.03.015 · Cited by 83
Wang, L., Li, R. Q., Yang, G., Lim, M., O’Hara, A. C., Chu, Y., Fox, B. A., Restifo, N. P., Urba, W. J., & Hu, H. (2005) · Cancer Research · doi:10.1158/0008-5472.can-05-2117 · Cited by 83
“However, proliferation and survival of memory CD8 T cells in lymphopenic hosts is MHC independent but IL-7 or IL-15 dependent, because homeostatic proliferation–driven proliferation of memory CD8 T cells is completely inhibited when IL-7 and IL-15 are both blocked (24, 28, 29).”
BackgroundmiR-15/16 Restrain Memory T Cell Differentiation, Cell Cycle, and Survival
Gagnon, J. D., Kageyama, R., Shehata, H. M., Fassett, M. S., Mar, D. J., Wigton, E. J., Johansson, K., Litterman, A. J., Odorizzi, P. M., Simeonov, D. R., et al. (2018) · Cell Reports · doi:10.1016/j.celrep.2019.07.064 · Cited by 82
“Primers for cloning and site-directed-mutagenesis (SDM) were: Il7r F: CAGGCTCGAGATTATAAGAAAACCCTTCCATCGACAACC, Il7r R: GATGCGGCCGCTTCCAGAAA ATAGCGCATGCTTGTATTTG; Cd28 F: TAGCTCGAGCAGGGACCCCTATCCAGAAG, Cd28 R: CTAGCGGCCGCAGTCAATGAAT AAATATTTATTGCAGGCTAAGC; Adrb2 F: CAGCTCGAGAGGCTTTCTACTCTCTAAGACCC, Adrb2 R: CAGGCGGCCGC…”
BackgroundInfluentialDean, J. W., Helm, E. Y., Fu, Z., Xiong, L., Sun, N., Oliff, K. N., Muehlbauer, M., Avram, D., & Zhou, L. (2023) · Cell Reports · doi:10.1016/j.celrep.2022.111963 · Cited by 79
IL-21 synergizes with IL-7 to augment expansion and anti-tumor function of cytotoxic T cells
Liu, S., Lizee, G. A., Lou, Y., Liu, C., Overwijk, W. W., Wang, G., & Hwu, P. (2007) · International Immunology · doi:10.1093/intimm/dxm093 · Cited by 82
“a small subset of effector cells with elevated expression of IL-7Ra preferentially survive and differentiate into long-lived memory cells capable of generating protective recall responses ( 29 ).”
Backgroundand the CAPRISA 002 Acute Infection Study Team, Burgers, W. A., Riou, C., Mlotshwa, M., Maenetje, P. W., Rosa, D. D. A., Brenchley, J. M., Mlisana, K. P., Douek, D. C., Koup, R. A., et al. (2009) · The Journal of Immunology · doi:10.4049/jimmunol.0803801 · Cited by 82
“Further characterization of the differentiation status of these memory subsets in HIV-infected individuals was made by assessing expression of CD127, the IL-7 receptor associated with long-term survival of cells (33); CD57, a marker of replicative senescence (34); and PD-1, a negative regulator of activation that has…”
The Transcription Factor TCF1 in T Cell Differentiation and Aging
Kim, C., Jin, J., Weyand, C. M., & Goronzy, J. J. (2020) · International Journal of Molecular Sciences · doi:10.3390/ijms21186497 · Cited by 86
“Most effector cells express killer cell lectin-like receptor G1 (KLRG1), are short-lived and produce high amounts of inflammatory cytokines and cytolytic molecules, whereas MPEC highly expresses IL-7Rα [34,35].”
BackgroundProfound dysregulation of T cell homeostasis and function in patients with severe COVID‐19
Adamo, S., Chevrier, S., Cervia, C., Zurbuchen, Y., Raeber, M. E., Yang, L., Sivapatham, S., Jacobs, A., Baechli, E., Rudiger, A., et al. (2021) · Allergy · doi:10.1111/all.14866 · Cited by 83
Wu, X., Feng, Q., Wang, Y., Shi, J., Ge, H., & Di, W. J. (2009) · Cancer Immunology Immunotherapy · doi:10.1007/s00262-009-0749-9 · Cited by 83
“They undergo homeostatic proliferation in response to IL-7 and IL-15, and respond vigorously to antigen [ 34 ].”
BackgroundCostimulation Signals for Memory CD8+ T Cells During Viral Infections
Duttagupta, P. A., Boesteanu, A. C., & Katsikis, P. D. (2009) · Critical Reviews in Immunology · doi:10.1615/critrevimmunol.v29.i6.20 · Cited by 80
Isgrò, A., Leti, W., Santis, W. D., Marziali, M., Esposito, A., Fimiani, C., Luzi, G., Pinti, M., Cossarizza, A., Aiuti, F., et al. (2008) · Clinical Infectious Diseases · doi:10.1086/588480 · Cited by 81
“An imbalance of several cytokines, such as IL-7, and abnormalities of the IL-7 receptor have been described in association with CD4+ T cell depletion [7-10].”
BackgroundLadell, K., Hellerstein, M. K., Cesar, D., Busch, R., Boban, D., & McCune, J. M. (2008) · The Journal of Immunology · doi:10.4049/jimmunol.180.12.7907 · Cited by 81
“, mediated by IL-7 through the IL-7R ) (6, 16, 17).”
BackgroundValujskikh, A., & Li, X. C. (2007) · Journal of the American Society of Nephrology · doi:10.1681/asn.2007020151 · Cited by 81
Systemic Hematogenous Maintenance of Memory Inflation by MCMV Infection
Smith, C. J., Turula, H., & Snyder, C. M. (2014) · PLoS Pathogens · doi:10.1371/journal.ppat.1004233 · Cited by 81
“In all cases, the majority of these inflationary CD8 T cells have a phenotype that is characteristic of effector cell differentiation [29,40–43] which is consistent with repeated antigen exposure (KLRG-1, CD127, CD62L)[44,45].”
Backgroundγδ T Cell Homeostasis Is Controlled by IL-7 and IL-15 Together with Subset-Specific Factors
Baccalà, R., Witherden, D. A., González‐Quintial, R., Dummer, W., Surh, C. D., Havran, W. L., & Theofilopoulos, A. N. (2005) · The Journal of Immunology · doi:10.4049/jimmunol.174.8.4606 · Cited by 79
“2% in spleen, n 6), and may define an activated subset of Ag-experienced T cells (29).”
BackgroundResultSelf-citationStem cell-like plasticity of naïve and distinct memory CD8+ T cell subsets
Stemberger, C., Neuenhahn, M., Gebhardt, F. E., Schiemann, M., Buchholz, V. R., & Busch, D. H. (2009) · Seminars in Immunology · doi:10.1016/j.smim.2009.02.004 · Cited by 81
Induction and function of virus-specific CD4+ T cell responses
Whitmire, J. K. (2011) · Virology · doi:10.1016/j.virol.2010.12.015 · Cited by 81
“Virus-specific CD4+ T cells down-regulate IL-7R, but there are cells that re-express IL-7R (Kaech et al., 2003; Kondrack et al., 2003; Lenz et al., 2004; Li, Huston, and Swain, 2003; Seddon, Tomlinson, and Zamoyska, 2003) and downregulate KLRG1 (Hand, Morre, and Kaech, 2007; Joshi et al., 2007).”
InfluentialDistinct regulation of effector and memory T‐cell differentiation
Kallies, A. (2008) · Immunology and Cell Biology · doi:10.1038/icb.2008.16 · Cited by 76
Induction of CD4 T cell memory by local cellular collectivity
Polonsky, M., Rimer, J., Kern-Perets, A., Zaretsky, I., Miller, S., Bornstein, C., David, E., Kopelman, N. M., Stelzer, G., Porat, Z., et al. (2018) · Science · doi:10.1126/science.aaj1853 · Cited by 78
Metadata
- Authors
- Kaech, S. M., Tan, J. T., Wherry, E. J., Konieczny, B. T., Surh, C. D., & Ahmed, R.
- Affiliations
- Emory University (US)
- Scripps Research Institute (US)
- Corresponding author
- Ahmed, Rafi
- Venue
- Nature Immunology
- Published
- 2003-11-16
- Volume
- 4
- Issue
- 12
- Pages
- 1191-1198
- ISSN
- 1529-2908 (ISSN-L)
- 1529-2916
- OpenAlex
- W1974842026
- Cited by
- 1,830
- References
- 48
- Citations by year
- 2026: 41 · 2025: 57 · 2024: 42 · 2023: 63 · 2022: 67 · 2021: 69 · 2020: 67 · 2019: 70 · 2018: 56 · 2017: 59 · 2016: 77 · 2015: 73 · 2014: 73 · 2013: 96 · 2012: 91
- FWCI
- 30.27
- Type
- journal article
- Language
- en
- Open access
- closed
- Licence
- www.springer.com/tdm (tdm)
- Locations
- Nature Immunology (publishedVersion)
- PubMed (publishedVersion)
- Topics
- Life Sciences › Immunology and Microbiology › Immunology › T-cell and B-cell Immunology
- Life Sciences › Immunology and Microbiology › Immunology › Immunotherapy and Immune Responses
- Life Sciences › Immunology and Microbiology › Immunology › Immune responses and vaccinations
- Keywords
- CD127, CD8+ T cells, effector T cells, memory T cells, apoptosis, adoptive transfer, viral infection, protective immunity, memory T cell generation
- MeSH terms
- Animals, Antigens, Surface, Cell Differentiation, Immunologic Memory, Lymphocyte Activation, Lymphocytic Choriomeningitis, Lymphocytic choriomeningitis virus, Mice, Transgenic, Signal Transduction, Gene Expression, T-Lymphocyte Subsets, CD8-Positive T-Lymphocytes, Cell Lineage, Adoptive Transfer, Receptors, Interleukin-7, Oligonucleotide Array Sequence Analysis, Mice
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
