The DOI matches its Crossref record; 29 of the 29 references it cites were found in a registry or an index; 3 of the 6 sources its claims cite were checked for support.
LDLRAD3 is a receptor for Venezuelan equine encephalitis virus
Open accessAbstract
Venezuelan equine encephalitis virus (VEEV) is a neurotropic alphavirus transmitted by mosquitoes that causes encephalitis and death in humans1. VEEV is a biodefence concern because of its potential for aerosol spread and the current lack of sufficient countermeasures. The host factors that are required for VEEV entry and infection remain poorly characterized. Here, using a genome-wide CRISPR–Cas9-based screen, we identify low-density lipoprotein receptor class A domain-containing 3 (LDLRAD3)—a highly conserved yet poorly characterized member of the scavenger receptor superfamily—as a receptor for VEEV. Gene editing of mouse Ldlrad3 or human LDLRAD3 results in markedly reduced viral infection of neuronal cells, which is restored upon complementation with LDLRAD3. LDLRAD3 binds directly to VEEV particles and enhances virus attachment and internalization into host cells. Genetic studies indicate that domain 1 of LDLRAD3 (LDLRAD3(D1)) is necessary and sufficient to support infection by VEEV, and both anti-LDLRAD3 antibodies and an LDLRAD3(D1)–Fc fusion protein block VEEV infection in cell culture. The pathogenesis of VEEV infection is abrogated in mice with deletions in Ldlrad3, and administration of LDLRAD3(D1)–Fc abolishes disease caused by several subtypes of VEEV, including highly virulent strains. The development of a decoy-receptor fusion protein suggests a strategy for the prevention of severe VEEV infection and associated disease in humans. LDLRAD3 is a receptor for infection with Venezuelan equine encephalitis virus, and in mouse models deletion of Ldlrad3 or treatment with a soluble LDLRAD3 decoy molecule abrogates infection and disease caused by this virus.
Overview
AI snapshot
Written from the paper’s full text.
TL;DR
Using a genome-wide CRISPR/Cas9 screen, the authors identify LDLRAD3/Ldlrad3 as a receptor for Venezuelan equine encephalitis virus (VEEV). Ldlrad3 domain 1 mediates VEEV binding and infection, and a Ldlrad3-D1-Fc decoy protein or Ldlrad3 deletion protects mice against pathogenic VEEV strains.
Key findings
- A genome-wide CRISPR/Cas9 screen in ΔB4galt7 Neuro2a cells, using a mouse GeCKO v2 library of 130,209 sgRNAs targeting 20,611 genes and SINV-VEEV-GFP, identified Ldlrad3 as the top candidate required for VEEV infection.
- Editing Ldlrad3 or human LDLRAD3 markedly reduced VEEV infection in neuronal and other cells, and complementation restored infection; Ldlrad3 bound VEEV particles and enhanced attachment/internalization, with monovalent Ldlrad3-D1 binding VEEV p62-E1 at an affinity of 209 nM.
- Ldlrad3 domain 1 (D1) was necessary and sufficient to support VEEV infection; Ldlrad3-D1-Fc and anti-Ldlrad3 antibodies blocked VEEV infection in cell culture, while Ldlrad3-D1-Fc did not inhibit SINV-EEEV.
- In mice, Ldlrad3 deletions abrogated VEEV pathogenesis, and Ldlrad3-D1-Fc prophylaxis or therapy protected against SINV-VEEV TrD, VEEV TrD, and VEEV ZPC738, including after intracranial VEEV TrD challenge.
Methods
- Genome-wide CRISPR/Cas9 knockout screen in HS-deficient ΔB4galt7 N2a cells with SINV-VEEV-GFP (VEEV IAB strain TrD structural proteins), followed by sorting GFP-negative cells, expansion with anti-VEEV mAbs, repeated infection/sorting, sgRNA sequencing, and MAGeCK analysis.
- Validation used CRISPR/Cas9 editing of mouse Ldlrad3 and human LDLRAD3, lentiviral complementation with full-length, truncated, GPI-anchored, or domain-deleted constructs, infectivity assays, binding/internalization assays, PI-PLC treatment, ELISA, and surface plasmon resonance.
- In vivo studies used C57BL/6J, CD-1, and Ldlrad3 gene-edited mice; Ldlrad3-D1-Fc or isotype control was administered before or after infection with SINV-VEEV TrD, VEEV TrD, or VEEV ZPC738, with survival, weight, clinical disease, viral RNA burden, histology, and in situ hybridization assessed.
Limitations
- The paper states that low levels of residual VEEV infection in Ldlrad3-deficient N2a or SH-SY5Y cells suggest additional factors may contribute to entry; whether laminin-binding proteins or other host factors are involved is undetermined.
- The paper states that mosquitoes lack an apparent Ldlrad3 ortholog and must have separate entry receptors, and that EEEV and WEEV do not require Ldlrad3, so additional receptors for this virus family likely exist.
- The text makes evident that in vivo studies were not blinded, mice were randomly assigned to treatment groups, and no sample-size calculations were performed; sample sizes were based on previous in vivo virus challenge experiments.
Model-written summary. Check it against the paper before relying on it.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
42 Own result · 10 Own method · 5 Own interpretation · 1 Supported so far · 1 Partly supported · 1 Couldn’t confirm · accuracy not yet measured
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Ldlrad3 binds directly to VEEV particles and enhances virus attachment and internalization into cells.”
- Also stated in: § Abstract · plain
“The Ldlrad3-D1-Fc variants and Ldlrad3-D1+D2-Fc fusion protein bound to VEEV but not to CHIKV virus-like particles (VLPs); however, Ldlrad3-D2-Fc did not bind to VEEV VLPs (Fig 3b).”
- Also stated in: § Abstract · plain
“We found a slow association rate, a long half-life, and an affinity of 209 nM (Fig 3d).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Abstract · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Using a genome-wide CRISPR/Cas9-based screen, we identify Ldlrad3, a highly conserved member of the scavenger receptor superfamily, as a receptor for VEEV.”
- Also stated in: § Abstract · plain
“The top candidate was low-density lipoprotein (LDL) receptor class A domain containing 3 (Ldlrad3) (Fig 1a), a conserved plasma membrane protein of the LDL scavenger receptor family found in mammals, birds, reptiles, amphibians, and fish (Extended Data Fig 1d).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Abstract · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“both anti-Ldlrad3 antibodies and a Ldlrad3-D1-Fc fusion protein block VEEV infection in cell culture.”
- Also stated in: § Abstract · plain
“pre-treatment of ΔB4galt7 N2a cells with anti-Ldlrad3 immune but not naïve serum blocked infection of SINV-VEEV-GFP but not SINV-EEEV-GFP (Fig 2e).”
- Also stated in: § Abstract · plain
“pre-treatment of primary cells with anti-Ldlrad3 immune serum reduced SINV-VEEV-GFP TrD infection (Fig 2f).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Abstract · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“however, Ldlrad3-D2-Fc did not bind to VEEV VLPs (Fig 3b).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Ectopic expression of LDLRAD3 in ΔLdlrad3 ΔB4galt7 N2a cells also increased SINV-VEEV-GFP TrD infection (Fig 1l and Extended Data Fig 2i).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“VEEV ZPC738 viral RNA levels were abrogated in mice treated with Ldlrad3-D1-Fc (Fig 4f–g and Extended Data Fig 8a and c).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“treatment with Ldlrad3-D1-Fc via intraperitoneal injection protected mice against intracranial challenge with VEEV TrD (Fig 4h and Extended Data Fig 7e–f).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Administration of Ldlrad3-D1-Fc at 24 h post-infection also protected mice against weight loss and lethality (Fig 4c and Extended Data Fig 7b).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In situ hybridization (brown) of Ldlrad3 (olfactory bulb, cortex, thalamus, and hippocampus) from WT mice (left panels).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Extended Data
plainn = 5- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Ldlrad3-D1 does not bind appreciably to CHIKV p62-E1.”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Extended Data
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Probably not a substantial claim. 16
- It may state two separate claims as one. 18
The sources with a verdict support this claim; the rest weren’t checked yet, have no full text we could read, or their verdicts aren’t rated yet.
In the paper
“Because some alphaviruses can attach to cells via engagement of HS11–13, we performed the screen using mouse Neuro2a (termed N2a hereafter) cells that were edited to lack expression of B4galt7 (Extended Data Fig 1b), an enzyme required for glycosaminoglycan (GAG) and HS biosynthesis.”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
What the sources say
- Supportedcites [11] Ryman, K. D. et al. Heparan sulfate binding can contribute to the neurovirulence of neuroadapted and nonneuroadapted Sindbis viruses. J. Virol. 81, 3563–3573 (2007). source
The citation supports the sentence’s background premise that some alphaviruses attach to cells through heparan sulfate, not the citing authors’ choice of CRISPR-screen cells. In “Dependence of binding/infectivity on HS-mediated attachment” (page not provided), the paper reports HS-dependent attachment and infection by Sindbis virus variants. It does not need to document the citing authors’ B4galt7 editing to support the cited premise. (LLM, conf=0.93)
- Not checked — no full text of the sourcecites [12] Gardner, C. L., Ebel, G. D., Ryman, K. D. & Klimstra, W. B. Heparan sulfate binding by natural eastern equine encephalitis viruses promotes neurovirulence. Proc. Natl Acad. Sci. USA 108, 16026–16031 (2011). source
- Not checked — no full text of the sourcecites [13] Tanaka, A. et al. Genome-wide screening uncovers the significance of N-sulfation of heparan sulfate as a host cell factor for Chikungunya virus infection. J. Virol. 91, e00432-17 (2017). source
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
- Supported
The cited sources support only part of this claim — read each source’s verdict below.
In the paper
“sample sizes were determined based on previous in vivo virus challenge experiments4.”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > METHODS > Mouse experiments.
What the sources say
- Partly supportedcites [4] Zhang, R. et al. Mxra8 is a receptor for multiple arthritogenic alphaviruses. Nature 557, 570–574 (2018). sourceExperimental — accuracy not yet measured
The Methods section (“Mouse experiments”; page not provided) says sample sizes were estimated to detect a 3- to 5-fold difference in the in vivo experiments. It does not say those estimates were based on previous in vivo virus challenge experiments. (LLM, conf=0.86)
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
- Partly supported
The cited sources that could be checked couldn’t confirm or dispute this claim.
In the paper
“The insertion of GFP has minimal effects on virus infection and replication20,24.”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Extended Data
What the sources say
- Not checked — no full text of the sourcecites [20] Sun, C., Gardner, C. L., Watson, A. M., Ryman, K. D. & Klimstra, W. B. Stable, high-level expression of reporter proteins from improved alphavirus expression vectors to track replication and dissemination during encephalitic and arthritogenic disease. J. Virol. 88, 2035–2046 (2014). source
- Could not verifycites [24] Kim, A. S. et al. Protective antibodies against Eastern equine encephalitis virus bind to epitopes in domains A and B of the E2 glycoprotein. Nat. Microbiol. 4, 187–197 (2019). sourceExperimental — accuracy not yet measured
The Results section (‘Generation of anti-EEEV mAbs’; page unavailable) says that a SINV-EEEV chimera replicated efficiently in cell culture. The Methods section (‘Cell lines and plasmids’; page unavailable) describes that chimera, but neither passage addresses GFP insertion into SINV-VEEV or its effects on infection and replication. Searches for GFP insertion and a fluorescent reporter found no passage that settles the claim. (LLM, conf=0.76)
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Gene editing of mouse Ldlrad3 or human LDLRAD3 results in markedly reduced viral infection of neuronal cells, which is restored upon complementation.”
- Also stated in: § Abstract · plain
“Markedly reduced infection of SINV-VEEV-GFP TrD was detected in ΔB4galt7 ΔLdlrad3 cells under single- or multi-step growth conditions (Fig 1b–d). Complementation with a full-length, seed-sequence Ldlrad3 variant restored expression and infectivity (Fig 1b–d and Extended Data Fig 2c and i).”
- Also stated in: § Abstract · plain
“A loss of LDLRAD3 expression in SH-SY5Y cells resulted in decreased SINV-VEEV TrD infection, which was restored by expression of the full-length but not truncated isoform of Ldlrad3 (Fig 1m–n and Extended Data Fig 2h).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Also stated in: § Abstract · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Ldlrad3 binds directly to VEEV particles and enhances virus attachment and internalization into cells.”
- Also stated in: § Abstract · plain
“SINV-VEEV TrD showed reduced binding at 4°C to ΔLdlrad3 ΔB4galt7 cells compared to control ΔB4galt7 N2a cells and increased binding to cells expressing Ldlrad3 (Fig 2a).”
- Also stated in: § Abstract · plain
“When virus internalization assays were performed at 37°C, less SINV-VEEV TrD RNA was measured in ΔLdlrad3 ΔB4galt7 cells, and increased levels were detected in cells expressing Ldlrad3 (Fig 2b).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Also stated in: § Abstract · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Genetic studies indicate that domain 1 (D1) of Ldlrad3 is necessary and sufficient to support VEEV infection, and both anti-Ldlrad3 antibodies and a Ldlrad3-D1-Fc fusion protein block VEEV infection in cell culture.”
- Also stated in: § Abstract · hedged
“Whereas D1+D2 supported SINV-VEEV-GFP TrD infection, D2+D3 did not, consistent with a role for D1 in binding VEEV (Fig 3e and Extended Data Fig 6h).”
- Also stated in: § Abstract · plain
“Despite being expressed at lower levels, D1 alone still promoted SINV-VEEV-GFP TrD infection (Extended Data Fig 6i).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Also stated in: § Abstract · hedged
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Whereas expression of full-length Ldlrad3 restored infection in ΔLdlrad3 ΔB4galt7 N2a cells, Δ32 Ldlrad3 did not (Fig 3f).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“We found a slow association rate, a long half-life, and an affinity of 209 nM (Fig 3d).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“we observed that human dermal microvascular endothelial cells and dermal fibroblasts, but not peripheral blood monocytes and peripheral blood T cells, express LDLRAD3 and were permissive for SINV-VEEV-GFP TrD infection (Extended Data Fig 5b).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Founder lines (Δ11 and Δ14 nucleotides) were confirmed and genotyped by next-generation sequencing.”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > METHODS > Generation of mice with deletions in Ldlrad3.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Histological evaluation of VEEV ZPC738-infected brains showed neuronal injury and hemorrhage, which was absent in mice treated with Ldlrad3-D1-Fc (Extended Data Fig 8b and d).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Ldlrad3 mRNA was detected in many tissues in wild-type mice, whereas no signal was detected in ΔLdlrad3 mice by qRT-PCR (Extended Data Fig 10b–c).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The Ldlrad3-D1-Fc variants and Ldlrad3-D1+D2-Fc fusion protein bound to VEEV but not to CHIKV virus-like particles (VLPs); however, Ldlrad3-D2-Fc did not bind to VEEV VLPs (Fig 3b).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Whereas D1+D2 supported SINV-VEEV-GFP TrD infection, D2+D3 did not, consistent with a role for D1 in binding VEEV (Fig 3e and Extended Data Fig 6h).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Two human tumor cell lines (Jurkat and Raji cells) lack surface expression of LDLRAD3 and were resistant to SINV-VEEV-GFP TrD infection (Extended Data Fig 3a and c).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plainn = 2- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“A similar LDLRAD3-D1 fusion protein with human IgG1 Fc domain also bound to VEEV but not to CHIKV VLPs (Fig 3c and Extended Data Fig 6b–c).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“at 4 days post-infection (dpi), SINV-VEEV TrD viral RNA was largely absent from sites normally targeted by VEEV including the brain of mice administered Ldlrad3-D1-Fc, whereas high levels were present in the control mAb-treated animals (Fig 4b).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Ldlrad3-D1+D2-Fc, but not Ldlrad3-D2-Fc, inhibited SINV-VEEV-GFP TrD infection comparably to Ldlrad3-D1-Fc (Fig 3i).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“The full-length human isoform of LDLRAD3 is 96% identical to mouse Ldlrad3 and differs by only three amino acids in the ectodomain (Extended Data Fig 1d).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“One sgRNA gave rise to two out-of-frame deletion variants (Δ11 and Δ14 nucleotides) (Extended Data Fig 9b).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“While substantially reduced infection was observed with VEEV TrD, no difference was observed with EEEV (Fig 1f). This phenotype was confirmed with SINV-EEEV and extended to SINV-WEEV (MacMillan) (Fig 1g).”
- Also stated in: § Abstract · plain
“Similarly, we observed no loss of infection by arthritogenic alphaviruses (SINV and MAYV), an unrelated rhabdovirus (Vesicular stomatitis virus), or an unrelated flavivirus (West Nile virus) when Ldlrad3 was edited (Fig 1h–k).”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
- Also stated in: § Abstract · plain
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“The Ldlrad3 sgRNA target sequence was mutated synonymously (sgRNA-1: ACCAACGAGTGCAACATCCC to ACAAATGAATGTAATATTCC; sgRNA-2: AGCATCACGTACGCCATCAT to TCTATTACTTATGCTATTAT) to prevent editing of the re-introduced gene.”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > METHODS > Complementation experiments.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Ldlrad3 gene-editing was validated by next generation sequencing on an Illumina HiSeq 2500 platform (Genome Technology Access Center, Washington University) with 300 base pair paired-end sequencing.”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > METHODS > Gene validation.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“mice were randomly assigned to treatment groups”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > METHODS > Mouse experiments.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“In vivo studies were not blinded”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > METHODS > Mouse experiments.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Anti-HCV mAb H77.39 was included as a negative isotype control.”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > METHODS > Ldlrad3-Fc inhibition assays.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“Immobilized CHIKV p62-E1 served as a reference surface to correct for bulk refractive index changes.”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > METHODS > Surface plasmon resonance.
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“All experiments were conducted with approval of the Institutional Animal Care and Use Committee at Washington University School of Medicine (Assurance number A3381-01) or University of Pittsburgh.”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > METHODS > Mouse experiments.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Mosquitoes, a natural host for VEEV, lack an apparent Ldlrad3 ortholog and thus must have separate entry receptors.”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: fails — The paper may give no reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it. The paper may give no reason why it holds. It may state two separate claims as one.
- Rests on an assumption: Mosquitoes lack an apparent Ldlrad3 ortholog.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Moreover, since EEEV and WEEV do not require Ldlrad3 for infection, additional receptors for this virus family likely exist.”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > Abstract
hedgedconditional- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“No sample-size calculations were performed to power each study.”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > METHODS > Mouse experiments.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
What the paper did — it cites no source for this, so there is none to check. The quote shows it is in the paper.
In the paper
“A ZIKV RNA probe (Advanced Cell Diagnostics #467771) was used as a negative control.”
§ LDLRAD3 is a receptor for Venezuelan equine encephalitis virus > METHODS > Histology and in situ viral RNA hybridization.
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
The paper relies on this without support.
Host factors required for VEEV entry and infection remain poorly characterized.
“The host factors required for VEEV entry and infection remain poorly characterized.”
The paper relies on this without support.
No physiologically relevant entry receptor for VEEV has been established.
“For VEEV, no physiologically relevant entry receptor has been established, although a laminin-binding protein reportedly enhances infection of mosquito and human cells6,7.”
The paper relies on this without support.
Mosquitoes lack an apparent Ldlrad3 ortholog.
“Mosquitoes, a natural host for VEEV, lack an apparent Ldlrad3 ortholog and thus must have separate entry receptors.”
The paper relies on this without support.
Ldlrad3-D1-Fc and Ldlrad3-D1-HRV-Fc have equivalent VEEV binding and neutralizing activity.
“which have equivalent VEEV binding and neutralizing activity”
Citations
Cites
Improved vectors and genome-wide libraries for CRISPR screening
Sanjana, N. E., Shalem, O., & Zhang, F. (2014) · Nature Methods · doi:10.1038/nmeth.3047 · Cited by 5,239
Li, W., Xu, H., Xiao, T., Cong, L., Love, M. I., Zhang, F., Irizarry, R. A., Liu, J. S., Brown, M., & Liu, X. S. (2014) · Genome Biology · doi:10.1186/s13059-014-0554-4 · Cited by 2,684
Transmission cycles, host range, evolution and emergence of arboviral disease
Weaver, S. C., & Barrett, A. D. T. (2004) · Nature Reviews Microbiology · doi:10.1038/nrmicro1006 · Cited by 717
A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo
Diez-Roux, G., Banfi, S., Sultan, M., Geffers, L., Anand, S., Rozado, D., Magen, A., Canidio, E., Pagani, M., Peluso, I., et al. (2011) · PLoS Biology · doi:10.1371/journal.pbio.1000582 · Cited by 638
Mxra8 is a receptor for multiple arthritogenic alphaviruses
Zhang, R., Kim, A. S., Fox, J. M., Nair, S., Basore, K., Klimstra, W. B., Rimkunas, R., Fong, R. H., Lin, H., Poddar, S., et al. (2018) · Nature · doi:10.1038/s41586-018-0121-3 · Cited by 448
Self-citationDevelopment of a Highly Protective Combination Monoclonal Antibody Therapy against Chikungunya Virus
Pal, P., Dowd, K. A., Brien, J. D., Edeling, M. A., Gorlatov, S. N., Johnson, S., Lee, I. T., Akahata, W., Nabel, G. J., van Duijl-Richter, M. K. S., et al. (2013) · PLoS Pathogens · doi:10.1371/journal.ppat.1003312 · Cited by 301
Self-citationWillnow, T. E., Rohlmann, A., Horton, J., Otani, H., Braun, J. R., Hammer, R. E., & Herz, J. (1996) · The EMBO Journal · doi:10.1002/j.1460-2075.1996.tb00623.x · Cited by 276
Klimstra, W. B., Nangle, E. M., Smith, M. S., Yurochko, A. D., & Ryman, K. D. (2003) · Journal of Virology · doi:10.1128/jvi.77.22.12022-12032.2003 · Cited by 269
Self-citationDavis, N., Willis, L. V., Smitht, J. F., & Johnston, R. E. (1989) · Virology · doi:10.1016/0042-6822(89)90526-6 · Cited by 237
Bernard, K. A., Klimstra, W. B., & Johnston, R. E. (2000) · Virology · doi:10.1006/viro.2000.0546 · Cited by 223
Self-citationKinney, R. M., Chang, G. J., Tsuchiya, K. R., Sneider, J. M., Roehrig, J. T., Woodward, T. M., & Trent, D. W. (1993) · Journal of Virology · doi:10.1128/jvi.67.3.1269-1277.1993 · Cited by 207
Endemic Venezuelan equine encephalitis in the Americas: Hidden under the dengue umbrella
Aguilar, P. V., Estrada-Franco, J. G., Navarro-Lopez, R., Ferro, C., Haddow, A. D., & Weaver, S. C. (2011) · Future Virology · doi:10.2217/fvl.11.50 · Cited by 203
Cryo-EM Structure of Chikungunya Virus in Complex with the Mxra8 Receptor
Basore, K., Kim, A. S., Nelson, C. A., Zhang, R., Smith, B. K., Uranga, C., Vang, L., Cheng, M., Gross, M. L., Smith, J. D., et al. (2019) · Cell · doi:10.1016/j.cell.2019.04.006 · Cited by 202
Self-citationHeparan sulfate binding by natural eastern equine encephalitis viruses promotes neurovirulence
Gardner, C. L., Ebel, G. D., Ryman, K. D., & Klimstra, W. B. (2011) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1110617108 · Cited by 144
Self-citationSmith, S. A., Silva, L. A., Fox, J. M., Flyak, A. I., Kose, N., Sapparapu, G., Khomandiak, S., Ashbrook, A. W., Kahle, K. M., Fong, R. H., et al. (2015) · Cell Host & Microbe · doi:10.1016/j.chom.2015.06.009 · Cited by 143
Self-citationSun, C., Gardner, C. L., Watson, A. M., Ryman, K. D., & Klimstra, W. B. (2014) · Journal of Virology · doi:10.1128/jvi.02990-13 · Cited by 139
Self-citationA putative receptor for Venezuelan equine encephalitis virus from mosquito cells
Ludwig, G. V., Kondig, J. P., & Smith, J. F. (1996) · Journal of Virology · doi:10.1128/jvi.70.8.5592-5599.1996 · Cited by 132
Tanaka, A., Tumkosit, U., Nakamura, S., Motooka, D., Kishishita, N., Priengprom, T., Sa-ngasang, A., Kinoshita, T., Takeda, N., & Maeda, Y. (2017) · Journal of Virology · doi:10.1128/jvi.00432-17 · Cited by 108
Sharma, A., & Knollmann-Ritschel, B. (2019) · Viruses · doi:10.3390/v11020164 · Cited by 88
Ryman, K. D., Gardner, C. L., Burke, C. W., Meier, K. C., Thompson, J. M., & Klimstra, W. B. (2007) · Journal of Virology · doi:10.1128/jvi.02494-06 · Cited by 79
Self-citationYin, J., Gardner, C. L., Burke, C., Ryman, K., & Klimstra, W. (2009) · Journal of Virology · doi:10.1128/jvi.01209-09 · Cited by 79
Self-citationA virus-like particle vaccine prevents equine encephalitis virus infection in nonhuman primates
Ko, S., Akahata, W., Yang, E. S., et al. (2019) · Science Translational Medicine · doi:10.1126/scitranslmed.aav3113 · Cited by 76
Anishchenko, M., Paessler, S., Greene, I. P., et al. (2003) · Journal of Virology · doi:10.1128/jvi.78.1.1-8.2004 · Cited by 70
Kim, A. S., Austin, S. K., Gardner, C. L., Zuiani, A., Reed, D. S., Trobaugh, D. W., Sun, C., Basore, K., Williamson, L. E., Crowe, J. E., et al. (2018) · Nature Microbiology · doi:10.1038/s41564-018-0286-4 · Cited by 54
Self-citationRanganathan, S., Noyes, N. C., Migliorini, M., Winkles, J. A., Battey, F. D., Hyman, B. T., Smith, E., Yepes, M., Mikhailenko, I., & Strickland, D. K. (2011) · Journal of Neuroscience · doi:10.1523/jneurosci.5065-10.2011 · Cited by 49
Malygin, A. A., Bondarenko, E. I., Иванисенко, В. А., Протопопова, Е. В., Karpova, G. G., & Loktev, V. B. (2009) · Biochemistry (Moscow) · doi:10.1134/s0006297909120050 · Cited by 46
Ryman, K. D., Meier, K. C., Gardner, C. L., Adegboyega, P. A., & Klimstra, W. B. (2007) · Virology · doi:10.1016/j.virol.2007.06.039 · Cited by 44
Self-citationRegulation of Itch and Nedd4 E3 Ligase Activity and Degradation by LRAD3
Noyes, N. C., Hampton, B., Migliorini, M. M., & Strickland, D. K. (2016) · Biochemistry · doi:10.1021/acs.biochem.5b01218 · Cited by 26
Rodent Herpesvirus Peru Encodes a Secreted Chemokine Decoy Receptor
Lubman, O., Cella, M., Wang, X., Monte, K. J., Lenschow, D. J., Huang, Y. H., & Fremont, D. H. (2013) · Journal of Virology · doi:10.1128/jvi.02729-13 · Cited by 16
Self-citation
Cited by
Sorted by citations
Bartholomeeusen, K., Daniel, M., LaBeaud, A. D., Gasque, P., Peeling, R. W. W., Stephenson, K. E., Ng, L. F. P., & Ariën, K. K. (2023) · Nature Reviews Disease Primers · doi:10.1038/s41572-023-00429-2 · Cited by 345
VLDLR and ApoER2 are receptors for multiple alphaviruses
Clark, L. E., Clark, S. A., Lin, C., Liu, J., Coscia, A., Smith, K. N., Yang, P., Neel, D. V., Lee, H., Brusic, V., et al. (2021) · Nature · doi:10.1038/s41586-021-04326-0 · Cited by 135
ACE2-Independent Alternative Receptors for SARS-CoV-2
Lim, S., Zhang, M., & Chang, T. L.-Y. (2022) · Viruses · doi:10.3390/v14112535 · Cited by 90
“LDLRAD3 is expressed in various tissues, including the brain, respiratory system, GI tract, reproductive tracts, and connective and soft tissues; its expression is abundant in myeloid cells [109] LDLRAD3 promotes the activity of E3 ubiquitin ligases [110] and serves a receptor for Venezuelan equine encephalitis virus,…”
BackgroundA molecular understanding of alphavirus entry and antibody protection
Kim, A. S., & Diamond, M. (2022) · Nature Reviews Microbiology · doi:10.1038/s41579-022-00825-7 · Cited by 87
“), LDLRAD3 (refs.(67,68)), VLDLR(70) and ApoER2 (ref.”
Self-citationPan-protective anti-alphavirus human antibodies target a conserved E1 protein epitope
Kim, A. S., Kafai, N. M., Winkler, E. S., Gilliland, T. C., Cottle, E. L., Earnest, J. T., Jethva, P. N., Kapłonek, P., Shah, A. P., Fong, R. H., et al. (2021) · Cell · doi:10.1016/j.cell.2021.07.006 · Cited by 79
Self-citation
Metadata
- Authors
- Ma, H., Kim, A. S., Kafai, N. M., Earnest, J. T., Shah, A. P., Case, J. B., Basore, K., Gilliland, T. C., Sun, C., Nelson, C. A., Thackray, L. B., Klimstra, W. B., Fremont, D. H., & Diamond, M. S.
- Affiliations
- Washington University in St. Louis (US)
- University of Pittsburgh (US)
- Corresponding author
- Diamond, Michael S.
- ORCID
- Venue
- Nature
- Published
- 2020-11-18
- Volume
- 588
- Issue
- 7837
- Pages
- 308-314
- ISSN
- 0028-0836 (ISSN-L)
- 1476-4687
- PMC
- PMC7769003
- OpenAlex
- W3105847615
- Semantic Scholar
- 9b4dc7dec6bd2485669bd58a0f9c9a413946a3ec
- Cited by
- 161
- References
- 29
- Citations by year
- 2026: 23 · 2025: 38 · 2024: 33 · 2023: 31 · 2022: 19 · 2021: 15 · 2020: 2
- FWCI
- 11.53
- Type
- journal article
- Language
- en
- Open access
- green
- www.ncbi.nlm.nih.gov
- Locations
- Nature (publishedVersion)
- PubMed (publishedVersion)
- PubMed Central (submittedVersion)
- RePEc: Research Papers in Economics (submittedVersion)
- Funders
- National Institute of Allergy and Infectious Diseases (R01AI153209, U19 AI142790, U19AI142759, HHSN272201700060C, R01AI095436, R01AI143673, T32AI007172)
- Topics
- Health Sciences › Medicine › Public Health, Environmental and Occupational Health › Mosquito-borne diseases and control
- Health Sciences › Medicine › Infectious Diseases › Viral Infections and Vectors
- Health Sciences › Medicine › Epidemiology › Virology and Viral Diseases
- Keywords
- Venezuelan equine encephalitis virus, viral receptor, alphavirus, scavenger receptors, viral entry, viral attachment, viral internalization, decoy receptor, neurotropic viruses, encephalitis, CRISPR-Cas9 screen, mouse model
- MeSH terms
- Animals, Cell Line, Encephalitis Virus, Venezuelan Equine, Encephalomyelitis, Venezuelan Equine, Female, Genetic Complementation Test, Humans, Male, Mice, Inbred C57BL, Protein Binding, Receptors, LDL, Receptors, Virus, Mice, Virus Attachment, Virus Internalization, CRISPR-Cas Systems
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
A language model drew the claims from the paper on 2026-10-18, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).
A second model labelled each claim on 2026-10-18 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).
Cited sources are checked with a language model’s help (gpt-6-sol).
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
