Neuronal defects in a human cellular model of 22q11.2 deletion syndrome

In the paper

“We found either undetectable levels (dopamine, GABA) or no change (glutamate, norepinephrine) between groups”

In the paper

“PC2 (7.4%), as well as PC5, PC6 and PC7 (8.1% combined), were related to differences between the 22q11DS and control groups.”

In the paper

“We found a decrease in the amplitude of the [Ca2+]i rise, but the difference between 22q11DS and control was still present following TTX”

In the paper

“variance partitioning showed that differentiation time explained 28% of the variance, while the differentiation experiment and the hiPS cell line explained 9.3% and 3.9% of the variance, respectively”

In the paper

“We observed an enrichment for variants associated with schizophrenia, but not for DEG found in ASD or SCZ postmortem brain tissue35,36.”

What the sources say

• Not checked yetcites [35] Parikshak, N. N. et al. Genome-wide changes in lncRNA, splicing, and regional gene expression patterns in autism. Nature 540, 423–427 (2016). source
• Not checked yetcites [36] Fromer, M. et al. Gene expression elucidates functional impact of polygenic risk for schizophrenia. Nat. Neurosci. 19, 1442–1453 (2016). source

In the paper

“We found that although there was an ~48% increase in the amplitude of the [Ca2+]i rise in 22q11DS neurons from day 70–80 to day 90–100, the overall defect was present even after 5.5 months of differentiation”

In the paper

“we found no differences in AP amplitude (P= 0.69), threshold (P= 0.97), rheobase (P= 0.22), maximal rate of rise (P= 0.29), maximal rate of decay (P= 0.43) between 22q11DS and control neurons”

In the paper

“pretreatment with nimodipine, a blocker of LTCCs, decreased the amplitude of the [Ca2+]i rise by ~64% in control cortical and by ~57% in 22q11DS”

In the paper

“The majority of protein–coding genes were downregulated in 22q11DS hCS by ~50% (Extended Fig. 2g), except for DGCR8 which was down regulated by about 20%.”

In the paper

“We found that, at 10–15 days following viral delivery, DGCR8 overexpression hyperpolarized the membrane potential of 22q11DS neurons by ~7 mV, while it had little or no effect in control neurons (Fig. 5e; P= 0.01).”

In the paper

“We found that the pretreatment (in 2D- and 3D-derived neurons) resulted in a decrease in the [Ca2+]i amplitude in control neurons (~31%), partly mimicking the phenotype in 22q11DS”

In the paper

“Imaging with Fura–2, showed that overexpression increased the amplitude of [Ca2+]i rise following depolarization, although it did not restore the amplitude to control levels”

In the paper

“We found that the application of olanzapine, at a similar concentration of 10 μM, also resulted in hyperpolarization and rescue of the RMP of 22q11DS neurons (Extended Data Fig. 10f; P= 0.008).”

In the paper

“Exogenously expressing DGCR8 rescued these defects in an isogenic line but only partially in 22q11DS.”

In the paper

“We found that ATP1A243, a sodium–potassium transporter ATPase involved in maintaining the RMP, WNT5A which regulates neuronal excitability and calcium signaling44, as well as ZNF132, were also downregulated in DGCR8+/– hCS”

What the sources say

• Not checked yetcites [43] Gritz, S. M. & Radcliffe, R. A. Genetic effects of ATP1A2 in familial hemiplegic migraine type II and animal models. Hum. Genomics 7, 8 (2013). source
• Not checked yetcites [44] McQuate, A., Latorre-Esteves, E. & Barria, A. A Wnt/calcium signaling cascade regulates neuronal excitability and trafficking of NMDARs. Cell Rep. 21, 60–69 (2017). source

In the paper

“we observed a decrease in the amplitude of [Ca2+]i rise following depolarization (Fig. 4c), which was similar to the defects in 22q11DS neurons (Fig. 4d; P< 0.0001).”

In the paper

“We found that pretreatment with raclopride was sufficient to restore the deficit in [Ca2+]i in 22q11DS neurons, while having no statistically significant effect on control neurons (Fig. 6a, b; P< 0.003).”

In the paper

“Barium currents amplitude (left) and charge (right) (controls, n = 30 cells derived from 5 control hiPS cell lines derived from 5 subjects; 22q11DS, n = 17 cells derived from 4 patient hiPS cell lines derived from 4 subjects. Two–tailed Mann–Whitney, P = 0.23 for amplitude; two–tailed Mann–Whitney, P = 0.28 for charge).”

In the paper

“We did not observe any systematic differences between cells reprogrammed by the two methods.”

In the paper

“n = 12 control neurons, one–way repeated measures ANOVA, F2, 22= 14.35, ****P < 0.0001; followed by Tukey’s multiple comparisons test: **P = 0.001 for pre–sulpiride versus sulpiride, ****P < 0.0001 for sulpiride versus post-wash, P = 0.56 for pre–sulpiride versus post–wash”

In the paper

“n = 13 22q11DS neurons, one–way repeated measures ANOVA, F2, 22= 7.84, *P = 0.002; Tukey’s multiple comparisons test: *P = 0.01 for pre–sulpiride versus sulpiride, **P = 0.003 for sulpiride versus post–wash and P = 0.72 for pre–sulpiride versus post–wash”

In the paper

“Pearson’s correlation of all genes across all four lines (two control lines and two 22q11DS lines, R2> 0.96).”

In the paper

“Comparison of action potential properties (controls, n = 46 cells derived from 6 control hiPS cell lines; 22q11DS, n = 66 cells derived from 4 patient hiPS cell lines): amplitude (two–tailed t–test, P = 0.70), threshold (two–tailed t–test, P = 0.97), rheobase (two–tailed Mann–Whitney test, P = 0.22), maximal rate of rise (two–tailed t–test, P = 0.29) and minimal rate of decay (two–tailed Mann–Whit”

In the paper

“CACNB4 (two–tailed Wilcoxon test, P= 0.94), KCNJ11 (two–tailed Wilcoxon test, P= 0.94), CALY (two–tailed Wilcoxon test, P= 0.22), CALCB (two–tailed Wilcoxon test, P= 0.22), PCP4 (two–tailed Wilcoxon test, P= 0.08).”

In the paper

“Quantification of the effect of nimodipine on the Fura–2 ratio amplitude (Fura–2 ratio decreased by ~64% in control cortical and by ~57% in 22q11DS neurons; two–sided Kruskal–Wallis test, P < 0.0001; followed by Dunn’s multiple comparison test; **P = 0.001, ****P < 0.0001).”

In the paper

“n = 10 neurons derived from one 22q11DS hiPS cell line, one–way repeated measures ANOVA, F2,18= 6.3, **P = 0.008; followed by Tukey’s multiple comparisons test: *P = 0.05 for pre–olanzapine versus olanzapine, **P = 0.008 for olanzapine versus post–wash, P = 0.69 for pre–olanzapine versus post–wash”

In the paper

“Two-sided t–test, P = 0.72 for NE, P = 0.39 for GLUT, DA and GABA not detectable”

In the paper

“Up to one in four 22q11.2DS patients develop psychosis, which correspond to a ~20–fold increase in risk, and accounts for 1–2% of all schizophrenia cases4–6.”

What the sources say

• Not checked yetcites [4] Murphy, K. C., Jones, L. A. & Owen, M. J. High rates of schizophrenia in adults with velo-cardio-facial syndrome. Arch. Gen. Psychiatry 56, 940–945 (1999). source
• Not checked yetcites [5] Monks, S. et al. Further evidence for high rates of schizophrenia in 22q11.2 deletion syndrome. Schizophr. Res. 153, 231–236 (2014). source
• Not checked yetcites [6] Schneider, M. et al. Psychiatric disorders from childhood to adulthood in 22q11.2 deletion syndrome: results from the International Consortium on Brain and Behavior in 22q11.2 Deletion Syndrome. Am. J. Psychiatry 171, 627–639 (2014). source

In the paper

“22q11.2 deletion syndrome (22q11DS) is a highly penetrant and common genetic cause of neuropsychiatric disease.”

In the paper

“Rodent models of 22q11DS have provided important insights3,9,10, including describing circuit dysfunction11–13.”

What the sources say

• Not checked yetcites [3] Zinkstok, J. R. et al. Neurobiological perspective of 22q11.2 deletion syndrome. Lancet Psychiatry 6, 951–960 (2019). source
• Not checked yetcites [9] Drew, L. J. et al. The 22q11.2 microdeletion: fifteen years of insights into the genetic and neural complexity of psychiatric disorders. Int. J. Dev. Neurosci. 29, 259–281 (2011). source
• Not checked yetcites [10] Karayiorgou, M., Simon, T. J. & Gogos, J. A. 22q11.2 microdeletions: linking DNA structural variation to brain dysfunction and schizophrenia. Nat. Rev. Neurosci. 11, 402–416 (2010). source
• Not checked yetcites [11] Chun, S. et al. Specific disruption of thalamic inputs to the auditory cortex in schizophrenia models. Science 344, 1178–1182 (2014). source
• Not checked yetcites [12] Sigurdsson, T., Stark, K. L., Karayiorgou, M., Gogos, J. A. & Gordon, J. A. Impaired hippocampal-prefrontal synchrony in a genetic mouse model of schizophrenia. Nature 464, 763–767 (2010). source
• Not checked yetcites [13] Fernandez, A. et al. Mitochondrial dysfunction leads to cortical under-connectivity and cognitive impairment. Neuron 102, 1127–1142 e1123 (2019). source

In the paper

“Together, this data demonstrates high reliability of hCS and suggests that defects in early cortical differentiation may not be a significant contributor to developmental defects in 22q11DS.”

In the paper

“A power analysis based on our first batch indicated an 85% power of detecting ~18% change in expression (Extended Data Fig. 2h).”

In the paper

“Recent studies16–18 have begun to explore transcriptional changes in neural cells derived from a small 22q11DS cohort, but the functional defects in human 22q11DS neurons and the underlying mechanisms have not been investigated.”

What the sources say

• Not checked yetcites [16] Zhao, D. et al. MicroRNA profiling of neurons generated using induced pluripotent stem cells derived from patients with schizophrenia and schizoaffective disorder, and 22q11.2 Del. PLoS ONE 10, e0132387 (2015). source
• Not checked yetcites [17] Toyoshima, M. et al. Analysis of induced pluripotent stem cells carrying 22q11.2 deletion. Transl. Psychiatry 6, e934 (2016). source
• Not checked yetcites [18] Lin, M. et al. Integrative transcriptome network analysis of iPSC-derived neurons from schizophrenia and schizoaffective disorder patients with 22q11.2 deletion. BMC Syst. Biol. 10, 105 (2016).

In the paper

“hCS transcriptionally resemble the developing cerebral cortex, contain functional glutamatergic neurons and astrocytes, and their generation is highly reliable across differentiation experiments and lines22.”

What the sources say

• Not checked yetcites [22] Yoon, S. J. et al. Reliability of human cortical organoid generation. Nat. Methods 16, 75–78 (2019). source

In the paper

“We used SNP arrays to verify genome integrity and to confirm the 22q11.2 deletion (Extended Data Fig. 1c; Supplementary Table 4).”

In the paper

“The 22q11.2 deletion syndrome (22q11DS) is the most frequent (1: 3000) deletion3.”

What the sources say

• Not checked yetcites [3] Zinkstok, J. R. et al. Neurobiological perspective of 22q11.2 deletion syndrome. Lancet Psychiatry 6, 951–960 (2019). source

In the paper

“We derived 3D human cortical spheroids (hCS)19–21, which are regionalized brain organoids that show high reliability of differentiation22”

What the sources say

• Not checked yetcites [19] Pasca, A. M. et al. Functional cortical neurons and astrocytes from human pluripotent stem cells in 3D culture. Nat. Methods 12, 671–678 (2015). source
• Not checked yetcites [20] Sloan, S. A., Andersen, J., Pasca, A. M., Birey, F. & Pasca, S. P. Generation and assembly of human brain region-specific three-dimensional cultures. Nat. Protoc. 13, 2062–2085 (2018). source
• Not checked yetcites [21] Sloan, S. A. et al. Human astrocyte maturation captured in 3D cerebral cortical spheroids derived from pluripotent stem cells. Neuron 95, 779–790 (2017). source
• Not checked yetcites [22] Yoon, S. J. et al. Reliability of human cortical organoid generation. Nat. Methods 16, 75–78 (2019). source

In the paper

“This microdeletion also confers a 30–40% risk for ASD7,8.”

What the sources say

• Not checked yetcites [7] Vorstman, J. A. et al. The 22q11.2 deletion in children: high rate of autistic disorders and early onset of psychotic symptoms. J. Am. Acad. Child Adolesc. Psychiatry 45, 1104–1113 (2006). source
• Not checked yetcites [8] Olsen, L. et al. Prevalence of rearrangements in the 22q11.2 region and population-based risk of neuropsychiatric and developmental disorders in a Danish population: a case-cohort study. Lancet Psychiatry 5, 573–580 (2018). source

In the paper

“A common feature of many antipsychotics is a modulation of dopamine D2 receptor function, which has been linked to clinical response46,47.”

What the sources say

• Not checked yetcites [46] Seeman, P., Lee, T., Chau-Wong, M. & Wong, K. Antipsychotic drug doses and neuroleptic/dopamine receptors. Nature 261, 717–719 (1976). source
• Not checked yetcites [47] Kapur, S., Zipursky, R., Jones, C., Remington, G. & Houle, S. Relationship between dopamine D2 occupancy, clinical response and side effects: a double-blind PET study of first-episode schizophrenia. Am. J. Psychiatry 157, 514–520 (2000). source

In the paper

“Nonetheless, such changes could shape the formation of cortical circuits and contribute to disease susceptibility.”

In the paper

“Previous models for this disease have provided pathophysiological clues9,10,54, but we are still far from developing effective therapeutics for mental illness in 22q11DS.”

What the sources say

• Not checked yetcites [9] Drew, L. J. et al. The 22q11.2 microdeletion: fifteen years of insights into the genetic and neural complexity of psychiatric disorders. Int. J. Dev. Neurosci. 29, 259–281 (2011). source
• Not checked yetcites [10] Karayiorgou, M., Simon, T. J. & Gogos, J. A. 22q11.2 microdeletions: linking DNA structural variation to brain dysfunction and schizophrenia. Nat. Rev. Neurosci. 11, 402–416 (2010). source
• Not checked yetcites [54] Chun, S., Bayazitov, I. T., Blundon, J. A. & Zakharenko, S. S. Thalamocortical long-term potentiation becomes gated after the early critical period in the auditory cortex. J. Neurosci. 33, 7345–7357 (2013). source

In the paper

“DGCR8 works in a complex with an RNAse, DROSHA, and regulates the expression of many transcripts30.”

What the sources say

• Not checked yetcites [30] Han, J. et al. The Drosha–DGCR8 complex in primary microRNA processing. Genes Dev. 18, 3016–3027 (2004). source

In the paper

“Several reports have now confirmed an association between the LTCC CACNA1C gene and neurodevelopmental disorders25,58.”

What the sources say

• Not checked yetcites [25] Cross-Disorder Group of the Psychiatric Genomics Consortium. Identification of risk loci with shared effects on five major psychiatric disorders: a genome-wide analysis. Lancet 381, 1371–1379 (2013). source
• Not checked yetcites [58] Schizophrenia Working Group of the Psychiatric Genomics Consortium. Biological insights from 108 schizophrenia-associated genetic loci. Nature 511, 421–427 (2014). source

In the paper

“Interestingly, by contrast to the reduced [Ca2+]i in 22q11DS, we recently reported increased [Ca2+]i in Timothy syndrome, a monogenic ASD23.”

What the sources say

• Not checked yetcites [23] Pașca, S. P. et al. Using iPSC-derived neurons to uncover cellular phenotypes associated with Timothy syndrome. Nat. Med. 17, 1657–1662 (2011). source

In the paper

“It is therefore possible that similar to 22q11DS, other disorders on the schizophrenia or autism spectrum may display convergence of multiple signaling defects in pathways suggested by GWAS.”

In the paper

“Microdeletions at the 22q11.2 locus are the most frequent interstitial deletion in humans53.”

What the sources say

• Not checked yetcites [53] Kobrynski, L. J. & Sullivan, K. E. Velocardiofacial syndrome, DiGeorge syndrome: the chromosome 22q11.2 deletion syndromes. Lancet 370, 1443–1452 (2007). source

In the paper

“Thereby, any level of alteration in DGCR8 would presumably have downstream effects on protein production and, potentially, neuronal physiology.”

In the paper

“Importantly, we showed that neural differentiations are highly reliable and 22q11DS is not associated with major defects in corticogenesis.”

In the paper

“One of the genes deleted in the 22q11.2 region is DGCR8– a component of the microprocessor complex involved in microRNA biogenesis30, has been associated with neuronal defects in rodent models of disease, and therefore has an outsized potential to dysregulate downstream target genes contributing to neuronal phenotype11,42.”

What the sources say

• Not checked yetcites [30] Han, J. et al. The Drosha–DGCR8 complex in primary microRNA processing. Genes Dev. 18, 3016–3027 (2004). source
• Not checked yetcites [11] Chun, S. et al. Specific disruption of thalamic inputs to the auditory cortex in schizophrenia models. Science 344, 1178–1182 (2014). source
• Not checked yetcites [42] Schofield, C. M. et al. Monoallelic deletion of the microRNA biogenesis gene Dgcr8 produces deficits in the development of excitatory synaptic transmission in the prefrontal cortex. Neural Dev. 6, 11 (2011). source

In the paper

“Electrophysiological and imaging experiments confirmed an increase in excitability and an impaired depolarization–induced LTCC calcium signaling in 22q11DS–derived neurons, which were related to a defect in the RMP that caused voltage–dependent inactivation of calcium channels.”

In the paper

“The modulation of LTCC by D2 receptors in neurons is well established, and blocking of D2 receptors can increase the activity of LTCC by multiple pathways27,48.”

What the sources say

• Not checked yetcites [27] Yasumoto, F. et al. Dopamine receptor 2 regulates L-type voltage-gated calcium channel in primary cultured mouse midbrain neural network. Cell. Mol. Neurobiol. 24, 877–882 (2004). source
• Not checked yetcites [48] Hernandez-Lopez, S. et al. D2 dopamine receptors in striatal medium spiny neurons reduce L-type Ca2+ currents and excitability via a novel PLCβ1-IP3-calcineurin-signaling cascade. J. Neurosci. 20, 8987–8995 (2000). source

In the paper

“Cultures were regularly tested for mycoplasma and maintained mycoplasma free.”

In the paper

“Power analysis was performed using the PROPER package (v1.10.0)73 in R.”

What the sources say

• Not checked yetcites [73] Wu, H., Wang, C. & Wu, Z. PROPER: comprehensive power evaluation for differential expression using RNA-seq. Bioinformatics 31, 233–241 (2015). source

In the paper

“Batch effect were accounted for by either including batch as a covariate in the linear model (allowing for correct estimation of degrees of freedom) or by Combat function form the sva package in R (for PCA and correlation analysis)67.”

What the sources say

• Not checked yetcites [67] Johnson, W. E., Li, C. & Rabinovic, A. Adjusting batch effects in microarray expression data using empirical Bayes methods. Biostatistics 8, 118–127 (2007). source

In the paper

“Off target candidates were predicted using COSMID46 tool (https://crispr.bme.gatech.edu). Integrity was confirmed by Sanger sequencing at top 3 off–target candidates (Chr6:138404602–138404624 GCGCCGACTCGGGAGCGGAGGGG, Chr3:52534180–52534202 GGGCGGACCCGGGAGCGGAGAGG, Chr3:49902616–49902638 GGGCACCCACTGGAGCGGAGTGG)”

What the sources say

• Not checked yetcites [46] Seeman, P., Lee, T., Chau-Wong, M. & Wong, K. Antipsychotic drug doses and neuroleptic/dopamine receptors. Nature 261, 717–719 (1976). source

In the paper

“Batches were balanced for control and 22q11DS lines.”

In the paper

“These findings support the value of a major mutational model for elucidating the biology of complex neuropsychiatric disorders and open the avenue for uncovering therapeutics.”

In the paper

“Sample identity was verified using the identity by descent (IBD) algorithm from PLINK (1.09). IBD was calculated for each sample based on genotypes derived from the RNA–seq analysis and a threshold of PI_HAT< 0.8 was set.”

In the paper

“To account for this, samples from both control and 22q11DS lines were re–sequenced at one time point (day 75).”

In the paper

“Picard sequencing metrics (http://broadinstitute.github.io/picard/, v2.5.0) were summarized using the first twenty principal components (seqPCs). These seqPCs were then included in the model to control for technical variation in the RNA sequencing.”

In the paper

“Fixed covariates that were included were differentiation day, sex, batch, the first two PCs calculated for genetic ancestry and twenty sequencings PCs (SeqPCs; see above).”

In the paper

“Experiments were conducted blind to the disease status of the samples.”

In the paper

“The differentiation of hiPS cells into cortical neural progenitor cells (NPCs) and neurons was carried using a previously described and validated protocol23.”

What the sources say

• Not checked yetcites [23] Pașca, S. P. et al. Using iPSC-derived neurons to uncover cellular phenotypes associated with Timothy syndrome. Nat. Med. 17, 1657–1662 (2011). source

In the paper

“Experiments were conducted blind to the disease status of the samples.”

In the paper

“Additionally, for each hiPS cell line, the sex was verified by detection of genes expressed by the Y–chromosome.”

In the paper

“Experiments were conducted blind to the disease status of the samples.”

In the paper

“A mixed linear model was used to account for multiple samples coming from the same individual, hiPS cell line and differentiation as well as to account for samples which were sequenced more than once.”

In the paper

“Experiments in the initial calcium phenotyping assay were conducted blind to the disease status.”

In the paper

“hiPS cell lines were randomly selected for differentiation from each genotype.”

In the paper

“Some of the hiPS cell lines used in this study were extensively characterized previously23,61 using immunostaining with anti–NANOG and TRA 2–49/6E antibodies, karyotyping, generation of teratoma in nude mice and mapping of viral integration sites (Extended Data Fig. 1a).”

What the sources say

• Not checked yetcites [23] Pașca, S. P. et al. Using iPSC-derived neurons to uncover cellular phenotypes associated with Timothy syndrome. Nat. Med. 17, 1657–1662 (2011). source
• Not checked yetcites [61] Yazawa, M. et al. Using induced pluripotent stem cells to investigate cardiac phenotypes in Timothy syndrome. Nature 471, 230–234 (2011). source

In the paper

“Experiments were conducted blind to the disease status of the samples in neurons at 50–70 days of differentiation in vitro.”